Characterization of DP103, a Novel DEAD Box Protein That Binds to the Epstein-Barr Virus Nuclear Proteins EBNA2 and EBNA3C
1999; Elsevier BV; Volume: 274; Issue: 27 Linguagem: Inglês
10.1074/jbc.274.27.19136
ISSN1083-351X
AutoresAdam Grundhoff, Elisabeth Kremmer, Özlem Türeci, Andrea Glieden, Christiane Gindorf, Judith Atz, Nikolaus Mueller‐Lantzsch, William H. Schubach, Friedrich A. Grässer,
Tópico(s)RNA modifications and cancer
ResumoThe Epstein-Barr virus-encoded nuclear antigens EBNA2 and EBNA3C both interact with the cellular transcription factor RBP-Jκ and modulate the expression of several shared target genes, suggesting a tight cooperation in latently infected cells. In a survey for additional cellular factors that bind to EBNA2 as well as EBNA3C, we have isolated and characterized DP103, a novel human member of the DEAD box family of putative ATP-dependent RNA helicases. The interaction with DP103 is mediated by amino acids (aa) 121–213 of EBNA2 and aa 534–778 of EBNA3C, regions that are not involved in binding of the viral proteins to RBP-Jκ. TheDP103-cDNA encodes a protein of 824 aa that harbors all of the common DEAD box motifs. Monoclonal antibodies raised against DP103 detect a protein of 103 kDa in mammalian cells that resides in high molecular weight complexes in vivo. We have detected an ATPase activity intrinsic to or closely associated with DP103. By subcellular fractionation, we find DP103 in both a soluble nuclear fraction as well as in the insoluble skeletal fraction. Whereas the protein and its mRNA are uniformly expressed in all tested cell lines, we observed differential expression of the mRNA in normal human tissues. The Epstein-Barr virus-encoded nuclear antigens EBNA2 and EBNA3C both interact with the cellular transcription factor RBP-Jκ and modulate the expression of several shared target genes, suggesting a tight cooperation in latently infected cells. In a survey for additional cellular factors that bind to EBNA2 as well as EBNA3C, we have isolated and characterized DP103, a novel human member of the DEAD box family of putative ATP-dependent RNA helicases. The interaction with DP103 is mediated by amino acids (aa) 121–213 of EBNA2 and aa 534–778 of EBNA3C, regions that are not involved in binding of the viral proteins to RBP-Jκ. TheDP103-cDNA encodes a protein of 824 aa that harbors all of the common DEAD box motifs. Monoclonal antibodies raised against DP103 detect a protein of 103 kDa in mammalian cells that resides in high molecular weight complexes in vivo. We have detected an ATPase activity intrinsic to or closely associated with DP103. By subcellular fractionation, we find DP103 in both a soluble nuclear fraction as well as in the insoluble skeletal fraction. Whereas the protein and its mRNA are uniformly expressed in all tested cell lines, we observed differential expression of the mRNA in normal human tissues. Epstein-Barr virus Burkitt's lymphoma lymphoblastoid cell lines monoclonal antibodies amino acids polymerase chain reaction rapid amplification of 5′-cDNA ends phosphate-buffered saline base pair(s) nickel-nitrilotriacetic acid dithiobis[succinimidyl propionate] eukaryotic initiation factor The Epstein-Barr virus (EBV),1 a ubiquitous human γ-herpesvirus, is the etiological agent of infectious mononucleosis and is associated with a number of tumors, such as the endemic form of Burkitt's lymphoma (BL), nasopharyngeal carcinoma, and Hodgkin's disease (reviewed in Ref. 1Kieff E. Fields B.N. Knipe D.M. Howley P.M. Chanock R.M. Melnick J.L. Monath T. Roizman B. Straus S.E. Virology. Raven Press, Ltd., New York1996: 2343-2496Google Scholar). Infection of primary B cells with EBVin vitro results in continuous proliferation of latently infected B cells, giving rise to lymphoblastoid cell lines (LCLs). Among the restricted set of 9 viral proteins expressed in LCLs are the two nuclear antigens EBNA2 and EBNA3C, both of which are absolutely essential for the ability of EBV to transform B cells in vitro. EBNA2 is a strong transactivator of the latent viral as well as cellular (CD21, CD23, and c-fgr) genes (reviewed in Ref. 1Kieff E. Fields B.N. Knipe D.M. Howley P.M. Chanock R.M. Melnick J.L. Monath T. Roizman B. Straus S.E. Virology. Raven Press, Ltd., New York1996: 2343-2496Google Scholar). However, EBNA2 does not bind directly to DNA but targets responsive promoters by binding to the ubiquitously expressed cellular transcription factor RBP-Jκ, a component of the Notch signaling pathway, and the hematopoietic lineage-restricted ets family protein PU.1 (2Zimber-Strobl U. Strobl L.J. Meitinger C. Hinrichs R. Sakai T. Furukawa T. Honjo T. Bornkamm G.W. EMBO J. 1994; 13: 4973-4982Crossref PubMed Scopus (177) Google Scholar, 3Henkel T. Ling P.D. Hayward S.D. Peterson M.G. Science. 1994; 265: 92-95Crossref PubMed Scopus (365) Google Scholar, 4Ling P.D. Hsieh J.J. Ruf I.K. Rawlins D.R. Hayward S.D. J. Virol. 1994; 68: 5375-5383Crossref PubMed Google Scholar, 5Grossman S.R. Johannsen E. Tong X. Yalamanchili R. Kieff E. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 7568-7572Crossref PubMed Scopus (298) Google Scholar, 6Waltzer L. Logeat F. Brou C. Israel A. Sergeant A. Manet E. EMBO J. 1994; 13: 5633-5638Crossref PubMed Scopus (129) Google Scholar, 7Laux G. Dugrillon F. Eckert C. Adam B. Zimber-Strobl U. Bornkamm G.W. J. Virol. 1994; 68: 6947-6958Crossref PubMed Google Scholar, 8Johannsen E. Koh E. Mosialos G. Tong X. Kieff E. Grossman S.R. J. Virol. 1995; 69: 253-262Crossref PubMed Google Scholar). EBNA3C is also able to interact with RBP-Jκin vitro and in vivo, resulting in a reduction of RBP-Jκ electrophoretic mobility shift activity and a decrease in the amount of EBNA2/RBP-Jκ complexes (9Robertson E.S. Grossman S. Johannsen E. Miller C. Lin J. Tomkinson B. Kieff E. J. Virol. 1995; 69: 3108-3116Crossref PubMed Google Scholar, 10Robertson E.S. Lin J. Kieff E. J. Virol. 1996; 70: 3068-3074Crossref PubMed Google Scholar, 11Waltzer L. Perricaudet M. Sergeant A. Manet E. J. Virol. 1996; 70: 5909-5915Crossref PubMed Google Scholar, 12Zhao B. Marshall D.R. Sample C.E. J. Virol. 1996; 70: 4228-4236Crossref PubMed Google Scholar). These observations have led to the suggestion that EBNA3C antagonizes the function of EBNA2 by competing for RBP-Jκ, a model supported by the finding that transient expression of EBNA3C down-regulates the EBNA2-dependent transactivation of the viral LMP1 and LMP2A promoters (9Robertson E.S. Grossman S. Johannsen E. Miller C. Lin J. Tomkinson B. Kieff E. J. Virol. 1995; 69: 3108-3116Crossref PubMed Google Scholar, 13Le-Roux A. Kerdiles B. Walls D. Dedieu J.F. Perricaudet M. Virology. 1994; 205: 596-602Crossref PubMed Scopus (84) Google Scholar, 14Marshall D. Sample C. J. Virol. 1995; 69: 3624-3630Crossref PubMed Google Scholar). Other data demonstrate that EBNA3C may also directly modulate transcription from the viral Cp promoter as well as expression of the viral LMP1 and the cellular CD21 genes independent of EBNA2 (15Radkov S.A. Bain M. Farrell P.J. West M. Rowe M. Allday M.J. J. Virol. 1997; 71: 8552-8562Crossref PubMed Google Scholar, 16Wang F. Gregory C. Sample C. Rowe M. Liebowitz D. Murray R. Rickinson A. Kieff E. J. Virol. 1990; 64: 2309-2318Crossref PubMed Google Scholar, 17Allday M.J. Crawford D.H. Thomas J.A. J. Gen. Virol. 1993; 74: 361-369Crossref PubMed Scopus (58) Google Scholar, 18Allday M.J. Farrell P.J. J. Virol. 1994; 68: 3491-3498Crossref PubMed Google Scholar). Taken together, these data suggest that EBNA2 and EBNA3C cooperate in the course of B cell immortalization on multiple levels, including competition for cellular factors as well as direct modulation of the expression of shared target genes. The studies described here were undertaken to identify additional cellular factors that may participate in this complex regulation. We report the cloning and characterization of DP103, a novel member of the DEAD box family of putative ATP-dependent RNA helicases, which was isolated due to its ability to bind to EBNA2 as well as EBNA3C. The rapidly growing DEAD box family includes members from a broad range of pro- as well as eukaryotic organisms (for a review see Ref. 19Schmid S.R. Linder P. Mol. Microbiol. 1992; 6: 283-291Crossref PubMed Scopus (449) Google Scholar). The family's name is derived from the amino acid sequence Asp-Glu-Ala-Asp (DEAD), one of at least eight highly conserved motifs shared by the family members. The conserved motifs are separated by similar spacings and are arranged in a common core region as represented by the prototype of the family, the DEAD box protein eIF-4A. Based on the observation that this core region harboring the full set of conserved motifs is present in all family members, they are all thought to act as RNA helicases, although helicase activity has been demonstrated for only a minority of DEAD box proteins. In many family members, the core region is flanked by N- or C-terminal extensions sharing little or no sequence homology, suggesting a role for these regions in more specialized functions. DEAD box proteins have been shown to play important roles in cell development, differentiation, and proliferation. They are implicated in nearly all processes that are linked to RNA metabolism, such as translation initiation, pre-mRNA splicing, ribosome assembly, mRNA stabilization, and mRNA transport (reviewed in Refs. 19Schmid S.R. Linder P. Mol. Microbiol. 1992; 6: 283-291Crossref PubMed Scopus (449) Google Scholar and 20Fuller-Pace F.V. Trends Cell Biol. 1994; 4: 271-274Abstract Full Text PDF PubMed Scopus (154) Google Scholar). All non-adherent B and T cell lines were maintained in RPMI 1640 medium (Life Technologies, Inc.). Adherent mammalian cell lines were grown in Dulbecco's modified Eagle medium (Life Technologies, Inc.). The insect cell line SF158 (21Knudson D.L. Tinsley T.W. J. Virol. 1974; 14: 934-944Crossref PubMed Google Scholar) was kept at 27 °C in TC100 medium (Life Technologies, Inc.). All media were supplemented with 10% fetal calf serum (Seromed), 40 IU/ml penicillin, and 50 μg/ml streptomycin. Recombinant baculoviruses His6DP103 expressing the full-length or DP103ΔN expressing an N-terminal truncated DP103 were generated by lipofection (InsectinPlusTM, Invitrogen) of plasmid pBBHis2B:dp103 with Bac-N-BlueTM (Invitrogen) or pACYM1:dp103ΔN with BaculoGold® (PharMingen) DNA, respectively, into SF158 cells as described elsewhere (22Hille A. Klein K. Baumler S. Grasser F.A. Mueller-Lantzsch N. J. Med. Virol. 1993; 39: 233-241Crossref PubMed Scopus (22) Google Scholar). Recombinant baculoviruses expressing EBNA2 of the type 1 EBV strain M-ABA were described previously (22Hille A. Klein K. Baumler S. Grasser F.A. Mueller-Lantzsch N. J. Med. Virol. 1993; 39: 233-241Crossref PubMed Scopus (22) Google Scholar). Recombinant baculoviruses expressing the full-length EBNA3C with an N-terminally fused His6-tag were a generous gift from Marion Buck and Tom Sculley (Queensland Institute of Medical Research, Brisbane, Australia). The rat monoclonal antibodies (mAbs) R3 directed against EBNA2 and 1H-4 directed against EBNA1 have been described (23Kremmer E. Kranz B. Hille A. Klein K. Eulitz M. Hoffmann-Fezer G. Feiden W. Herrmann K. Delecluse H.J. Delsol G. Bornkamm G.W. Mueller-Lantzsch N. Grasser F.A. Virology. 1995; 208: 336-342Crossref PubMed Scopus (66) Google Scholar, 24Grasser F.A. Murray P.G. Kremmer E. Klein K. Remberger K. Feiden W. Reynolds G. Niedobitek G. Young L.S. Mueller-Lantzsch N. Blood. 1994; 84: 3792-3798Crossref PubMed Google Scholar). The mouse mAb A10 directed against EBNA3C (25Maunders M.J. Petti L. Rowe M. J. Gen. Virol. 1994; 75: 769-778Crossref PubMed Scopus (46) Google Scholar) was kindly provided by Martin Rowe (University of Wales, Cardiff, UK). For the production of rat mAbs directed against different epitopes of DP103, either amino acids 713–824 or 352–614 of DP103 were expressed in Escherichia coli as TrpE fusion proteins from plasmids pATH2:dp103CT or pATH2:Δdp103Δ, respectively, in BL21/DE3 (26Studier F.W. Rosenberg A.H. Dunn J.J. Dubendorff J.W. Methods Enzymol. 1990; 185: 60-89Crossref PubMed Scopus (6005) Google Scholar). The gel-purified proteins were used to immunize Lou/c rats. The fusion and screening for DP103-specific mAbs were done as described (23Kremmer E. Kranz B. Hille A. Klein K. Eulitz M. Hoffmann-Fezer G. Feiden W. Herrmann K. Delecluse H.J. Delsol G. Bornkamm G.W. Mueller-Lantzsch N. Grasser F.A. Virology. 1995; 208: 336-342Crossref PubMed Scopus (66) Google Scholar). The specific clones 9A-3 (IgG2c), directed against aa 713–824, and 8H-4 (IgG2a), directed against aa 352–614 of DP103 were subcloned and used for further experiments. A polyclonal rabbit serum was raised against the TrpE fusion protein comprising aa 713–824 of DP103 as described (27Grasser F.A. Haiss P. Gottel S. Mueller-Lantzsch N. J. Virol. 1991; 65: 3779-3788Crossref PubMed Google Scholar). For a review of the yeast two-hybrid system, see Ref. 28Phizicky E.M. Fields S. Microbiol. Rev. 1995; 59: 94-123Crossref PubMed Google Scholar. The cDNA library and yeast strains used for the two-hybrid screen with plasmid pBTM116:ΔE2Δ (encoding aa 122–344 of EBNA2 from the type 1 EBV strain M-ABA) have been described previously (29Wu D.Y. Kalpana G.V. Goff S.P. Schubach W.H. J. Virol. 1996; 70: 6020-6028Crossref PubMed Google Scholar). The library clones isolated from this screen, expressing the cDNA inserts as fusion proteins with the transactivation domain of GAL4 (GAL4AD), were co-transformed into the yeast strain SFY526 (30Bartel P.L. Chien C.T. Sternglanz R. Fields S. Hartley D.A. Cellular Interactions in Development: A Practical Approach. Oxford University Press, Oxford1993: 53-179Google Scholar) as described (31Ito H. Fukuda Y. Murata K. Kimura A. J. Bacteriol. 1983; 153: 163-168Crossref PubMed Google Scholar) together with various deletion mutants of EBNA2A, -2B, and -3C cloned in the vector pGBT9. Co-transformants were grown on 100-mm plates with synthetic medium lacking tryptophan and leucine at 30 °C until colonies were 2 mm in diameter, and β-galactosidase activity was determined by the hydrolysis of 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal)in situ (32Breeden L. Naysmith K. Cold Spring Harbar Symp. Quant. Biol. 1985; 50: 643-650Crossref PubMed Scopus (470) Google Scholar). The lacking 5′-region of the DP103-encoding cDNA was isolated by performing three successive rounds of 5′-RACE. Briefly, mRNA from 8 × 107 BJAB cells was prepared using the mRNA Isolation Kit (CLONTECH). For the generation of cDNA, 1 μg of mRNA was reverse-transcribed using SuperscriptTM reverse transcriptase (Life Technologies, Inc.). The reaction was primed withDP103 cDNA-specific primers RC01 (5′, TACCAATCATCTTCCTGGGCTTCAGTC), RC03 (5′, CAACAGTAGGTCACTGTCAGCCCCAAT), or RC05 (5′, AAAGCTTGATTAAATGGAATTCTGCTG) in the first, second, or third round of RACE, respectively. The reaction was carried out either at 42 °C or, in order to overcome secondary structures, at 51 °C for 30 min. Subsequent steps were performed using the MarathonTM cDNA Amplification Kit (CLONTECH) according to the manufacturer's instructions. Briefly, double-stranded cDNA was generated, ligated to an adaptor (CLONTECH), and subjected to PCR amplification with an 5′-primer specific for the adaptor andDP103-specific primers RC02 (5′, TGTCTTCATCTGGATTCCAGGTGATTC), RC04 (5′, CCAGATTCACCTTCTCAGCATCAATCC), or RC06 (5′, CCCTCCAATAAAGACATGACACTCTAAGCC) in the first, second, or third round of RACE, respectively. Products were subsequently cloned in the vector pGEM (Promega). For the generation of plasmid pATH2:dp103CT, a segment encoding amino acids 713–824 from the open reading frame of the DP103-cDNA was amplified by polymerase chain reaction (PCR) using primersDP103BamHI(713)5′ (5′-CGCGGATCCAGAATCACCTGGAATCCAGATG) andDP103HindIII(UTR)3′ (5′-AAAGACTCAAAGCTTTTCAAG), digested with BamHI and HindIII, and ligated to the BamHI/HindIII-cleaved vector pATH2. Plasmid pATH2:Δdp103Δ was generated in a similar way using primersDP103BamHI(352)5′ (5′, GCAGCGTCTGGATCCTATGGCTA) and DP103SalI(614)3′ (5′, GCCTGTGTCGACCCTGATGATTTCC). Plasmid pATH2:dp103ΔN was constructed by digestion of the first RACE product withBamHI and PflMI and ligation to theBamHI/PflMI-cleaved pATH2:dp103CT vector. Removal of the insert with BamHI and BglII and cloning into the BamHI site of pACYM1 yielded plasmid pACYM1:dp103ΔN. The recombinant protein was expressed as a non-fusion protein initiating with the ATG codon at position 1064, comprising amino acids 352–824 of DP103. Plasmid pGEM:dp103 was constructed by reverse transcriptase-PCR amplification of the complete coding region of the DP103-cDNA with primers DP103(9)5′ (CCATGGCGGCGGCAGTTGAAG) and DP103(2631)3′ (ATGGATGTGTCCCAGTGGAAAGACTC) and subsequent ligation to the linearized vector pGEM (Promega). For in vitro translation, the insert from pGEM:dp103 was removed with NcoI/SalI and cloned into the NcoI/SalI-cleaved pGEM vector to yield plasmid pGEM:dp103ivt. Plasmid pBBHis2B:dp103 was generated by removal of the insert from pGEM:dp103ivt byNcoI/SalI digestion and ligation to theNcoI/SalI-cleaved pBBHis2B vector (Invitrogen). This construct expresses DP103 as a fusion protein with an N-terminal tag consisting of an antibody epitope (Anti-Xpress, Invitrogen) and a His6-tag. The GAL4 DNA binding domain (GAL4BD) fusions of EBNA2 and EBNA3C were constructed in the vector pGBT9 (30Bartel P.L. Chien C.T. Sternglanz R. Fields S. Hartley D.A. Cellular Interactions in Development: A Practical Approach. Oxford University Press, Oxford1993: 53-179Google Scholar). For cloning of pGBT9:E2A-(1–213), the corresponding region of EBNA2 from the EBV type 1 strain M-ABA was PCR-amplified with primers E2AEcoRI(1)5′ (5′, GCCGAATTCATGCCTACATTCTATCTTGCG) and E2ASalI(213)3′ (5′,GTCGACTGGTGGCACCGTTAGTGTTGCAGG), digested withEcoRI and SalI, and subsequently cloned into theEcoRI/SalI-cleaved vector pGBT9. Additional fusions of EBNA2 and EBNA3C were generated in a similar way using primers with suitable restriction sites. Sequence information concerning these primers can be obtained from the authors upon request. Two pGBT9 constructs expressing GAL4BD fusions of aa 127–985 of EBNA3C from the type 1 EBV strain B95-8 and aa 127–1062 of EBNA3C from the type 2 EBV strain AG876 were kindly provided by Kenia Krauer (Queensland Institute of Medical Research, Brisbane, Australia). Soluble extracts of 2 × 107 EBV-positive and EBV-negative cells were separated by centrifugation through a 5–30% sucrose gradient as described (27Grasser F.A. Haiss P. Gottel S. Mueller-Lantzsch N. J. Virol. 1991; 65: 3779-3788Crossref PubMed Google Scholar). Fifteen fractions collected by bottom puncture were precipitated with ethanol and analyzed by immunoblotting. Total cellular RNA from cultured cells was isolated using the "RNAeasy kit" (Qiagen), following the manufacturer's instructions. Isolation of total RNA from tissues was done as described (33Tureci O. Schmitt H. Fadle N. Pfreundschuh M. Sahin U. J. Biol. Chem. 1997; 272: 6416-6422Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). For the generation of probes, nucleotides 1654–2113 of the DP103-cDNA from plasmid pATH2:dp103ΔN were removed by digestion withEcoRI/PflMI. Multiprime labeling of the probe, blot transfer, and hybridization were performed as described (33Tureci O. Schmitt H. Fadle N. Pfreundschuh M. Sahin U. J. Biol. Chem. 1997; 272: 6416-6422Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). Approximately 1 × 107 SF128 cells were infected with recombinant baculoviruses expressing full-length His6-tagged EBNA3C, full-length EBNA2, or N-terminally truncated DP103ΔN protein as described previously (22Hille A. Klein K. Baumler S. Grasser F.A. Mueller-Lantzsch N. J. Med. Virol. 1993; 39: 233-241Crossref PubMed Scopus (22) Google Scholar). Cells were washed twice in ice-cold PBS and lysed in 500 μl of ice-cold lysis buffer NLB (150 mmTris-HCl, pH 9.0, 150 mm NaCl, 1 mmβ-mercaptoethanol, 10% glycerol, 0.5% Nonidet P-40) supplemented with a protease inhibitor mixture (Roche Molecular Biochemicals) for 30 min. Lysates were centrifuged at 13,000 × g for 30 min, and 300 μl of a 1:1 slurry of Ni-NTA-agarose (Qiagen) in ice-cold buffer NLB were added to 500 μl of clarified supernatants containing EBNA2 or EBNA3C. After incubation overnight at 4 °C on a rotating wheel, the Ni-NTA-agarose was loaded on a column and washed with 1 ml of ice-cold buffer NWB (150 mm Tris-HCl, pH 8.0, 150 mm NaCl, 1 mm β-mercaptoethanol, 10% glycerol) 20 times. The beads were removed from the column and incubated overnight with 500 μl of clarified lysates from dp103ΔN-expressing cells at 4 °C on a rotating wheel. The beads were again applied on a column and washed with 1 ml of ice-cold buffer NWB 20 times. Bound proteins were eluted with a step gradient using 500 μl of buffer NWB supplemented with imidazole in final concentrations of 25, 50, 100, 250, and 500 mm. 40 μl from each fraction were analyzed by immunoblotting. Chemical cross-linking was essentially carried out as described (34de Gunzburg J. Riehl R. Weinberg R.A. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4007-4011Crossref PubMed Scopus (37) Google Scholar). Briefly, EBV-negative BJAB or EBV-positive B95-8 cells were harvested and washed twice in PBS. All subsequent steps were carried out at 4 °C. Cells were incubated in PBS supplemented with 1 mm DSP (dithiobis[succinimidyl propionate]/Lomant's reagent, Pierce) for 30 min, washed twice in PBS, and lysed for 30 min in buffer K (20 mm Tris-HCl, pH 8.0, 100 mm NaCl, 0.1% Nonidet P-40, 1 mm phenylmethylsulfonyl fluoride, 2 μg/ml aprotinin, 1 μg/ml leupeptin, 1 μg/ml pepstatin A) at a concentration of 2 × 107 cells per 0.5 ml. Debris was sedimented (30 min, 4 °C, 13,000 rpm), and 50 μl of hybridoma supernatants were added to 0.5 ml of the clarified lysates. After incubation for 1 h, 20 μl of protein G-Sepharose (Amersham Pharmacia Biotech) were added, and samples were incubated again for 1 h. Pellets were washed five times with lysis buffer and boiled in SDS-sample buffer containing β-mercaptoethanol for 5 min. Samples were analyzed by immunoblotting. 2 × 108 cells from suspension cultures were pelleted, washed twice in ice-cold PBS, and lysed for 30 min on ice in 1 ml of buffer K (see above) with 1 mm DTT. After centrifugation (13,000 × g, 30 min, 4 °C), the clarified supernatants were pre-adsorbed on 150 μl of a 1:1 slurry of protein A-Sepharose beads (Amersham Pharmacia Biotech) in PBS at 4 °C for 2 h on a rotating wheel. The DP103-specific mAb 9A-3 or an irrelevant mAb directed against TrpE were added to the supernatants at a final concentration of 25 ng/μl. The samples were incubated at 4 °C overnight, and 80 μl of a 1:1 slurry of protein A-Sepharose beads in PBS were added. After incubation at 4 °C on a rotating wheel for 1.5 h, the beads were washed three times in ice-cold lysis buffer, once in ice-cold ATPase buffer (20 mm HEPES, pH 7.2, 100 mm NaCl, 5 mm MgCl2), and twice in ice-cold ATPase buffer supplemented with ATP (Roche Molecular Biochemicals) at a final concentration of 50 μm. The samples were supplemented with 800 ng of total cellular RNA isolated from B95-8 or Akata cells and brought to a final volume of 80 μl with ice-cold ATPase buffer. After addition of 1 μCi of [α-32P]ATP (ICN), reactions were incubated at 37 °C. After 0.5, 1, 1.5, and 3.5 h of incubation, 1 μl of the samples were spotted on TLC plates (Sigma). TLC plates were developed in 0.75 mKH2PO4, pH 3.0, and subjected to autoradiography. Data base searches were performed using the BLOCKS, BLASTP, and TBLASTN programs (35Henikoff S. Henikoff J.G. Genomics. 1994; 19: 97-107Crossref PubMed Scopus (347) Google Scholar, 36Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (59920) Google Scholar). Hydrophilicity of DP103 was determined according to the method of Kyte and Doolittle (37Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Crossref PubMed Scopus (17215) Google Scholar) over a window length of 17 residues. All programs were accessed through the Baylor College of Medicine search launcher internet pages. 2The on-line address is as follows:http://kiwi.imgen.bcm.tmc. edu:8088/search-launcher/launcher.html. In a search for proteins that interact with both EBNA2 and EBNA3C, we determined whether candidate clones identified in a previous two-hybrid screen for EBNA2-associated proteins could also bind to EBNA3C in this assay. Details of the original screen have been described previously (29Wu D.Y. Kalpana G.V. Goff S.P. Schubach W.H. J. Virol. 1996; 70: 6020-6028Crossref PubMed Google Scholar). The GAL4AD-fusion protein encoded by the cDNA clone SE97 induced β-galactosidase activity when co-expressed with the full-length EBNA3C fused to the DNA binding domain of GAL4. To map further the regions mediating the interaction, additional deletion mutants of EBNA2 and EBNA3C from the type 1 EBV strains M-ABA or B95-8, respectively, were co-expressed with SE97. As shown in Fig. 1, the smallest fragments that conferred binding to SE97 comprised aa 121–213 of EBNA2 and aa 534–778 of EBNA3C. Since these regions are poorly conserved between the EBNA2 and EBNA3C alleles of the type 1 and type 2 viruses, additional mutants of EBNA2 and EBNA3C from the type 2 strains Jijoye or AG876, respectively, were employed in the yeast two-hybrid system. In both cases, the EBV type 2-derived mutants induced β-galactosidase activity when co-expressed with SE97 (Fig. 1). Thus, the ability to interact with the protein encoded by SE97 is conserved between the EBNA2 and EBNA3C alleles of both types 1 and 2 EBV strains. The cDNA insert in SE97 comprised 793 bp with an open reading frame of 479 bp. The clone was assumed to be incomplete since it lacked both a candidate start codon and a polyadenylation signal. Furthermore, this sequence hybridized to a unique transcript of approximately 3.0 kilobase pairs in Northern blots (see Fig.7 A). Using mRNA derived from the EBV-negative B cell line BJAB, a segment containing an additional 2003 bp was obtained by 5′-RACE. The complete 3′-end of the clone is likely to be represented by an expressed sequence tag (EST) of 140 bp derived from human tonsillar cells (GenBankTM accession number AA731204). The EST shows a perfect match of its 5′-terminal 74 bp to the 3′-end of the library clone and harbors a polyadenylation signal (AAUAAA) at position 101, 18 bp upstream of the binding site of the oligo(dT) primer. The size of the cloned sequence together with the 3′-region covered by the EST is 2842 bp and correlates with the size of the transcript observed in Northern blotting, assuming an additional 200 bases for an average sized poly(A)-tail (38Sachs A.B. Deardorff J.A. Cell. 1992; 70: 961-973Abstract Full Text PDF PubMed Scopus (160) Google Scholar). Moreover, two additional independent 5′-RACE experiments yielded products terminating at the same 5′-position. Thus, the cloned sequence is likely to represent the complete 5′-end of the DP103-encoding transcript. To rule out the possibility that the sequence retrieved by RACE resulted from nonspecific cDNA fusion or was unique to the starting material used, cDNAs spanning the entire 2796 bp were amplified, cloned, and sequenced, using mRNA derived from human placenta, the human B cell line BJAB, as well as peripheral blood lymphocytes from two healthy donors. The cDNAs were identical with the exception of an average of four base substitutions per clone, which are likely to represent reverse transcriptase-PCR artifacts since they are located randomly throughout the sequence and were always unique to a specific clone. The aa sequence shown in Fig. 2was translated from the consensus nucleotide sequence deposited in GenBankTM (accession number AF106019). A putative start codon in good context for translation initiation (39Kozak M. Nucleic Acids Res. 1987; 15: 8125-8148Crossref PubMed Scopus (4168) Google Scholar) is present at position 11, initiating a continuous open reading frame of 2472 bp that encodes a protein of 824 aa. The presence of highly conserved motifs in the predicted amino acid sequence clearly identifies the protein as a novel member of the DEAD box family of putative ATP-dependent RNA helicases. Since monoclonal antibodies detect a cellular protein with an apparent molecular mass of 103 kDa (see following paragraph and Fig.3 B), the protein was designated DP103 (DEAD box protein of 103 kDa), whereas we will refer to the human gene as DP103 in the following. We note that a short segment of 22 aa with a high proportion of basic residues (41%) is present at the C terminus of DP103, the first five residues of which (KTRLK) are repeated at position 55–59 (indicated in Fig. 2).Figure 3Characterization of the DP103 protein. A, expression of DP103 by in vitrotranscription/translation (lane dp103-ivt) or in insect cells by recombinant baculoviruses DP103ΔN and His6DP103. Extracts of wild-type-infected insect cells were applied in thelanes wt. The protein was detected by autoradiography or immunoblot using mAb 9A-3, respectively.B, detection of endogenous protein with mAb 9A-3 by immunoblotting. The positions of DP103 and the 130-kDa protein are indicated and labeled a and b, respectively.C, detection of DP103 in fractionated cell extracts.Upper panel, immunoblot of soluble cytoplasmic (C) and nuclear (N) fractions prepared as described (40Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9160) Google Scholar). Detection of DP103 was performed with mAb 9A-3.Lower panel, immunoblot of nuclear (N), soluble cytoplasmic (C), membrane (M), and skeletal (S) fractions prepared as described (41Niederman T.M. Hastings W.R. Ratner L. Virology. 1993; 197: 420-425Crossref PubMed Scopus (69) Google Scholar). DP103 was detected with mAb 8H-4.View Large Image Figure ViewerDownload (PPT) As predicted from the amino acid composition of the protein encoded byDP103, in vitro transcription/translation yielded a protein with an apparent mass of about 92.5 kDa (Fig. 3 A, lane dp103-ivt). For further
Referência(s)