A Balance of Opposing Signals within the Cytoplasmic Tail Controls the Lysosomal Targeting of P-selectin
1998; Elsevier BV; Volume: 273; Issue: 43 Linguagem: Inglês
10.1074/jbc.273.43.27896
ISSN1083-351X
AutoresAnastasia Blagoveshchenskaya, Eric W. Hewitt, Daniel F. Cutler,
Tópico(s)Cellular transport and secretion
ResumoThe 35-amino acid cytoplasmic tail of the adhesion receptor P-selectin is subdivided into stop transfer, C1 and C2 domains. It contains structural signals needed for targeting this protein to specialized secretory organelles and to lysosomes. Recently, using site-directed mutagenesis of horseradish peroxidase-P-selectin chimeras, we have uncovered a novel sequence within the C1 domain, KCPL, that mediates sorting from early, transferrin-positive endosomes to lysosomes and therefore operates as a positive lysosomal targeting signal (Blagoveshchenskaya, A. D., Norcott, J. P., and Cutler, D. F. (1998) J. Biol. Chem. 273, 2729–2737). In the current study, we examined lysosomal targeting by both subcellular fractionation and an intracellular proteolysis assay and found that a balance of positive and negative signals is required for proper lysosomal sorting of P-selectin. First, we have found that within the sequence KCPL, Cys-766 plays a major role along with Pro-767, whereas Lys-765 and Leu-768 make no contribution to promoting lysosomal targeting. In addition, horseradish peroxidase-P-selectin chimeras were capable of acylation in vivo with [3H]palmitic acid at Cys-766, since no labeling of a chimera in which Cys-766 was replaced with Ala was detected. Second, analysis of mutations within the C2 domain revealed that substitution of two sequences, YGVF and DPSP, causes an increase in both lysosomal targeting and intracellular proteolysis suggesting the presence of lysosomal avoidance signals. The inhibition or promotion of lysosomal targeting resulted from alterations in endosomal sorting since internalization was not changed in parallel with lysosomal delivery. Analysis of the double mutants KCPL/YGVF or KCPL/DPSP revealed that although the positive lysosomal targeting signal operates in the early/sorting transferrin-positive endosomes, the negative lysosomal targeting (lysosomal avoidance) signals act at later stages of the endocytic pathway, most likely in late endosomal compartments. The 35-amino acid cytoplasmic tail of the adhesion receptor P-selectin is subdivided into stop transfer, C1 and C2 domains. It contains structural signals needed for targeting this protein to specialized secretory organelles and to lysosomes. Recently, using site-directed mutagenesis of horseradish peroxidase-P-selectin chimeras, we have uncovered a novel sequence within the C1 domain, KCPL, that mediates sorting from early, transferrin-positive endosomes to lysosomes and therefore operates as a positive lysosomal targeting signal (Blagoveshchenskaya, A. D., Norcott, J. P., and Cutler, D. F. (1998) J. Biol. Chem. 273, 2729–2737). In the current study, we examined lysosomal targeting by both subcellular fractionation and an intracellular proteolysis assay and found that a balance of positive and negative signals is required for proper lysosomal sorting of P-selectin. First, we have found that within the sequence KCPL, Cys-766 plays a major role along with Pro-767, whereas Lys-765 and Leu-768 make no contribution to promoting lysosomal targeting. In addition, horseradish peroxidase-P-selectin chimeras were capable of acylation in vivo with [3H]palmitic acid at Cys-766, since no labeling of a chimera in which Cys-766 was replaced with Ala was detected. Second, analysis of mutations within the C2 domain revealed that substitution of two sequences, YGVF and DPSP, causes an increase in both lysosomal targeting and intracellular proteolysis suggesting the presence of lysosomal avoidance signals. The inhibition or promotion of lysosomal targeting resulted from alterations in endosomal sorting since internalization was not changed in parallel with lysosomal delivery. Analysis of the double mutants KCPL/YGVF or KCPL/DPSP revealed that although the positive lysosomal targeting signal operates in the early/sorting transferrin-positive endosomes, the negative lysosomal targeting (lysosomal avoidance) signals act at later stages of the endocytic pathway, most likely in late endosomal compartments. trans-Golgi network multivesicular bodies lysosomal targeting signals lysosome avoidance motifs cation-dependent mannose 6-phosphate receptor horseradish peroxidase N-acetyl-β-d-glucosaminidase phosphate-buffered saline polyacrylamide gel electrophoresis lysosomal targeting index. The endocytic trafficking of transmembrane proteins is controlled by sequences (sorting signals) within their cytoplasmic domains or within the cytoplasmic domains of associated proteins (for review see Ref. 1Trowbridge I.S. Collawn J.F. Hopkins C.R. Annu. Rev. Cell Biol. 1993; 9: 129-161Crossref PubMed Scopus (712) Google Scholar). The best documented signal-dependent sorting step is the recruitment of transmembrane proteins into clathrin-coated pits on the plasma membrane followed by internalization via clathrin-coated vesicles which, after uncoating, fuse with early/sorting endosomes (2Robinson M.S. Watts C. Zerial M. Cell. 1996; 84: 13-21Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar,3Riezman H. Woodman P.G. van Meer G. Marsh M. Cell. 1997; 91: 731-738Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). This initial recruitment is mediated by sorting signals, most of which fall into one of the following two groups: tyrosine- or di-leucine-based motifs (4Sandoval I.V. Bakke O. Trends Cell Biol. 1994; 4: 292-297Abstract Full Text PDF PubMed Scopus (263) Google Scholar, 5Marks M.S. Ohno H. Kirchhausen T. Bonifacino J.S. Trends Cell Biol. 1997; 7: 124-128Abstract Full Text PDF PubMed Scopus (279) Google Scholar). Early/sorting endosomes are thought to be a major sorting compartment along the endocytic pathway where the fate of internalized proteins is determined. From here, some proteins recycle back to the TGN1 or to the plasma membrane, whereas others are directed to the late endosomes, morphologically identified as multivesicular bodies (MVB), and then to lysosomes for degradation. Moreover, in specialized cells, proteins can be transported to GLUT4-containing vesicles or may be transcytosed to an alternate plasma membrane (2Robinson M.S. Watts C. Zerial M. Cell. 1996; 84: 13-21Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 6Mellman I. Annu. Rev. Cell Biol. 1996; 12: 575-625Crossref Scopus (1353) Google Scholar). Sorting signals that mediate the delivery of proteins to lysosomes are also often members of the tyrosine- or di-leucine-based signal families. In most cases, internalization signals and lysosomal targeting signals (LTS) have been found to be identical (4Sandoval I.V. Bakke O. Trends Cell Biol. 1994; 4: 292-297Abstract Full Text PDF PubMed Scopus (263) Google Scholar). However, recently described novel LTS (7Subtil A. Delepierre M. Dautry-Varsat A. J. Cell Biol. 1997; 136: 583-595Crossref PubMed Scopus (49) Google Scholar, 8Kornilova E. Sorkina T. Beguinot L. Sorkin A. J. Biol. Chem. 1996; 271: 30340-30346Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar, 9Opresko L.K. Chang C.-P. Will B.H. Burke P.M. Gill G.N. Wiley H.S. J. Biol. Chem. 1995; 270: 4325-4333Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar, 10Blagoveshchenskaya A.D. Norcott J.P. Cutler D.F. J. Biol. Chem. 1998; 273: 2729-2737Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar) provide evidence that the structural requirements for internalization and lysosomal trafficking can be different. The selectivity of endosomal transport remains controversial. The earliest data showed that cross-linking of recycling proteins caused a re-direction to lysosomes, suggesting a default mechanism (11Mellman I. Plutner H. J. Cell Biol. 1984; 98: 1170-1176Crossref PubMed Scopus (176) Google Scholar, 12Neutra M.R. Ciechanover A. Owen L.S. Lodish H.F. J. Histochem. Cytochem. 1985; 33: 1134-1144Crossref PubMed Scopus (56) Google Scholar). However, the existence of LTS supports the view that endosome-to-lysosome trafficking is a signal-dependent step. In addition, sorting within the late endosomal system is not well understood at a more than superficial level. First, it is still unclear whether late endosomes or MVB are involved in sorting to the same extent as early endosomes. Second, the mechanism of transfer between late endosomes and lysosomes also remains to be defined. In H.Ep.2 cells, where MVB were shown to be the dominant endocytic organelles (13van Deurs B. Holm P.K. Kayser L. Sandvig K. Hansen S.H. Eur. J. Cell Biol. 1993; 61: 208-224PubMed Google Scholar, 14van Deurs B. Holm P.K. Kayser L. Sandvig K. Eur. J. Cell Biol. 1995; 66: 309-323PubMed Google Scholar, 15Futter C.E. Pearse A. Hewlett L.J. Hopkins C.R. J. Cell Biol. 1996; 132: 1011-1023Crossref PubMed Scopus (445) Google Scholar), the removal of recycling proteins from early/sorting MVB gives rise to late MVB which gradually mature and then directly fuse with relatively stable pre-existing lysosomes (15Futter C.E. Pearse A. Hewlett L.J. Hopkins C.R. J. Cell Biol. 1996; 132: 1011-1023Crossref PubMed Scopus (445) Google Scholar). These findings have been extended with observations that the fusion of pre-existing lysosomes with late endosomes is followed by reformation of lysosomes from the resultant hybrid structures (16Bright N.A. Reaves B.J. Mullock B.M. Luzio J.P. J. Cell Sci. 1997; 110: 2027-2040Crossref PubMed Google Scholar, 17Mullock B.M. Bright N.A. Fearon C.W. Gray S.R. Luzio J.P. J. Cell Biol. 1998; 140: 591-601Crossref PubMed Scopus (179) Google Scholar). Having reached mature MVB, further transfer to the lysosomes, while apparently the default route, is neither obligatory nor a final destination. However, little is known about the molecular signals that divert proteins from delivery to lysosomes or to retrieve them thereafter. To date, two lysosome avoidance motifs (LAM) found in the cytoplasmic tail of the cation-dependent mannose 6-phosphate receptor (CD-M6PR) are the only sequences identified. The first LAM, Cys-Arg-Ser-Lys-Pro-Arg, does not reveal any homology to other sorting signals known so far (18Rohrer J. Schweizer A. Russel D. Kornfeld S. J. Cell Biol. 1995; 132: 565-576Crossref Scopus (219) Google Scholar). Subsequent studies established that the palmitoylation of the Cys within this sequence facilitates the exposure of a second, upstream LAM, the di-aromatic motif Phe-Trp (19Schweizer A. Kornfeld S. Rohrer J. J. Cell Biol. 1996; 132: 577-584Crossref PubMed Scopus (85) Google Scholar,20Schweizer A. Kornfeld S. Rohrer J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14471-14476Crossref PubMed Scopus (63) Google Scholar). These data suggest a requirement for a positive retrieval signal to avoid transfer from late endosomes to lysosomes. P-selectin is a type I membrane protein originally found within the secretory organelles of endothelial cells and platelets (21McEver R.P. Beckstead J.H. Moore K.L. Marshall-Carlson L. Bainton D.F. J. Clin. Invest. 1989; 84: 92-99Crossref PubMed Scopus (872) Google Scholar, 22Bonfanti R. Furie B.C. Furie B. Wagner D.D. Blood. 1989; 73: 1109-1112Crossref PubMed Google Scholar, 23Berman C.L. Yeo E.L. Wencel-Drake J.D. Furie B.C. Ginsberg M.H. Furie B. J. Clin. Invest. 1986; 78: 130-137Crossref PubMed Scopus (374) Google Scholar). Following the stimulation of these cells with thrombin or other agonists, it is redistributed to the plasma membrane (24Koedam J.A. Cramer E.M. Briend E. Furie B. Furie B.C. Wagner D.D. J. Cell Biol. 1992; 116: 617-625Crossref PubMed Scopus (105) Google Scholar, 25Hamburger S.A. McEver R.P. Blood. 1990; 75: 550-554Crossref PubMed Google Scholar, 26Larsen E. Celi A. Gilbert G.E. Furie B.C. Erban J.K. Bonfanti R. Furie B. Cell. 1989; 59: 305-312Abstract Full Text PDF PubMed Scopus (765) Google Scholar) and then rapidly internalized (27Setiadi H. Disdier M. Green S.A. Canfield W.M. McEver R.P. J. Biol. Chem. 1995; 270: 26818-26826Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 28Green S.A. Setiadi H. McEver R.P. Kelly R.B. J. Cell Biol. 1994; 124: 435-448Crossref PubMed Scopus (125) Google Scholar, 29Subramaniam M. Koedam J.A. Wagner D.D. Mol. Biol. Cell. 1993; 4: 791-801Crossref PubMed Scopus (155) Google Scholar, 30Disdier M. Morrisey J.H. Fugate R.D. Bainton D.F. McEver R.P. Mol. Biol. Cell. 1992; 3: 309-321Crossref PubMed Scopus (127) Google Scholar, 31Hattori R. Hamilton K.K. Fugate R.D. McEver R.P. Sims P.J. J. Biol. Chem. 1989; 264: 7768-7771Abstract Full Text PDF PubMed Google Scholar). When heterologously expressed in cells lacking a regulated secretory pathway, P-selectin is constitutively transported to the cell surface and efficiently endocytosed to lysosomes for degradation (10Blagoveshchenskaya A.D. Norcott J.P. Cutler D.F. J. Biol. Chem. 1998; 273: 2729-2737Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 28Green S.A. Setiadi H. McEver R.P. Kelly R.B. J. Cell Biol. 1994; 124: 435-448Crossref PubMed Scopus (125) Google Scholar). The cytoplasmic tail of P-selectin comprises three different domains as follows: ST (stop transfer), membrane-proximal C1, and membrane-distal C2 (32Johnston G.I. Cook R.G. McEver R.P. Cell. 1989; 56: 1033-1044Abstract Full Text PDF PubMed Scopus (672) Google Scholar). The sequence KCPL within the C1 domain has been found to mediate transfer from early to late MVB and lysosomes, acting in a similar way to some other LTS (8Kornilova E. Sorkina T. Beguinot L. Sorkin A. J. Biol. Chem. 1996; 271: 30340-30346Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar, 9Opresko L.K. Chang C.-P. Will B.H. Burke P.M. Gill G.N. Wiley H.S. J. Biol. Chem. 1995; 270: 4325-4333Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar, 33Zwart D.E. Brewer C.B. Lazarovits J. Henis Y.I. Roth M.G. J. Biol. Chem. 1996; 271: 907-917Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). The cytoplasmic tail of P-selectin therefore provides a good model system with which to study the regulation of lysosomal targeting. In the present work, we have exploited a series of HRP-P-selectin chimeras containing point mutations across the KCPL sequence as well as mutations within the C2 domain to examine traffic to late MVB and lysosomes in H.Ep.2 cells. We have found that Cys-766 (a palmitoylation site within the P-selectin cytoplasmic tail (34Fujimoto T. Stroud E. Whatley R.E. Prescott S.M. Muszbek L. Laposata M. McEver R.P. J. Biol. Chem. 1993; 268: 11394-11400Abstract Full Text PDF PubMed Google Scholar)) is a crucial amino acid within the positive LTS. In addition, we have found two sequences within the C2 domain, YGVF and DPSP, which operate as negative LTS or LAM modulating the activity of the positive LTS. Alanine substitution of these sequences resulted in increased lysosomal targeting and intracellular proteolysis. Immobilon-P membrane was obtained from Millipore (Bedford, MA); affinity purified125I-protein A was from Amersham Corp. (UK); Express35S-label from NEN Life Science Products; [9,10-3H]palmitic acid was from NEN Life Science Products; NHS-SS-biotin was from Pierce (UK); pansorbin was from Calbiochem; polyclonal anti-HRPs were from DAKO (Denmark). Other chemicals were purchased from Sigma (UK). A chimeric cDNA containing the human growth hormone signal sequence, followed by HRP, the transmembrane domain, and cytoplasmic tail of P-selectin (Fig. 1) was generated as described previously (35Norcott J.P. Solari R. Cutler D.F. J. Cell Biol. 1996; 134: 1229-1240Crossref PubMed Scopus (52) Google Scholar). cDNAs encoding the deletion mutants, ssHRPP-selectin763, ssHRPP-selectin786, ssHRPP-selectin782, and ssHRPP-selectin776 were constructed as described (35Norcott J.P. Solari R. Cutler D.F. J. Cell Biol. 1996; 134: 1229-1240Crossref PubMed Scopus (52) Google Scholar). The tetra-alanine substitutions and point mutations were made using the pRK34 plasmid containing ssHRPP-selectin as a template and Stratagene QuikChange Site-directed Mutagenesis Kit according to the manufacturer's instructions. The constructs obtained were confirmed by sequencing. The sequences of the oligonucleotide primers used to generate the mutants are listed below. Only the sense primer is shown; the antisense primer used is the exact complement. HLGT, AATCCTCACAGCGCCGCAGCAGCATATGGAGTTTTT; TNAAF, TATGGAGTTTTTGCAGCCGCTGCAGCTGACCCGAGTCCT; YGVF, AGCCACCTAGGAACAGCTGCAGCTGCTACAAACGCTGCATT; DPSP, AACGCTGCATTTGCCGCGGCTGCTTAAGGTTTCCAT; K765A, CAGAAAGATGATGGGGCATGCCCCTTGAATCCT; C766A, AAAGATGATGGGAAAGCCCCCTTGAATCCTCAC; L768A, GATGGGAAATGCCCCGCGAATCCTCACAGCCAC. Primers used for construction of ssHRPP-selectinKCPLand ssHRPP-selectinP767A chimera were those as described previously (10Blagoveshchenskaya A.D. Norcott J.P. Cutler D.F. J. Biol. Chem. 1998; 273: 2729-2737Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Double mutants (KCPL/DPSP and KCPL/YGVF) have been generated with the corresponding oligonucleotide primers indicated above using the same kit, except that pRK34 containing the ssHRPP-selectinKCPL was used as a template. The human cell line H.Ep.2 (American Type Culture Collection CCL23, Rockville, MD) was maintained and transiently transfected with cDNA encoding HRP-P-selectin chimeras as described previously (10Blagoveshchenskaya A.D. Norcott J.P. Cutler D.F. J. Biol. Chem. 1998; 273: 2729-2737Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Where necessary, cells have been treated with protease inhibitors, 100 μm mixture of pepstatin A and leupeptin, as indicated (10Blagoveshchenskaya A.D. Norcott J.P. Cutler D.F. J. Biol. Chem. 1998; 273: 2729-2737Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Following two rinses with ice-cold HB (320 mmsucrose, 10 mm HEPES, pH 7.3), cells were scraped into 1.5 ml of HB with a rubber policeman and passed 10 times through a ball-bearing homogenizer with a 0.009-mm clearance (made in the EMBL, Heidelberg, Germany). The cell homogenate was spun at 8500 ×g for 5 min, and 1.3 ml of postnuclear supernatant was layered on an 11-ml 1–16% preformed linear Ficoll gradient made in HB. The gradients were centrifuged for 45 min at 35,000 rpm in an SW40Ti rotor (Beckman Instruments, Palo Alto, CA), fractionated in 0.5-ml fractions from the top of the tube using an Autodensi-Flow IIC (Buchler Instruments, Kansas City, MO), and then radioactivity of fractions was counted. Positions of lysosomes and late endosomes were identified by measurement of activity of the lysosomal marker enzyme,N-acetyl-β-d-glucosaminidase (NAGA), as described previously (38Rose J.K. Adams G.A. Gallione C.J. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 2050-2054Crossref PubMed Scopus (102) Google Scholar). The fractions containing most NAGA activity were further purified using a second centrifugation. Fractions 17–23 from the 1–16% Ficoll gradient were pooled together, and 2.5 ml of this material was diluted with HB to make 4 ml and layered on a 9-ml 7–25% Ficoll gradient. Centrifugation, fractionation, and measurement of NAGA activity were then carried out as described for initial Ficoll gradients. Targeting data were described as a lysosomal targeting index (LTI),i.e. the amount of HRP activity present in LE/Lys fractions for each mutant normalized to that for ssHRPP-selectin. Accordingly, in all the experiments, the LTI for ssHRPP-selectin was set at 1. To take into account variations of expression level, number of cells and lysosomal yield, the amount of HRP activity present in the LE/Lys peak (HRP-peak) has been corrected for the amount of NAGA activity (NAGA peak) within the LE/Lys fractions and for total HRP activity in the homogenate (HRP hmg). After simplifying the original equation, the LTI was defined as follows:LTI=mutant HRP peak/mutant NAGA peak×mutant HRP hmgWT HRP peak/WT NAGA peak×WT HRP hmg(Eq. 1) Typically, the LTI for tail-less ssHRPP-selectin763was about 20% of that for ssHRPP-selectin and was subtracted from those for the other chimeras in each experiment to provide a base-line. Thus the LTI for ssHRPP-selectin763 was considered as 0. The LTIs of the mutants were therefore described on a scale within a range set by ssHRPP-selectin (1Trowbridge I.S. Collawn J.F. Hopkins C.R. Annu. Rev. Cell Biol. 1993; 9: 129-161Crossref PubMed Scopus (712) Google Scholar) and ssHRPP-selectin763(0). Cells on 35-mm dishes were placed on ice, washed twice with ice-cold PBS, and subjected to Triton X-114 partitioning as described (37Kornilova E.S. Taverna D. Hoeck W. Hynes N.E. Oncogene. 1992; 7: 511-519PubMed Google Scholar) followed by a standard HRP assay (see below) performed with two phases. Amounts of HRP activity present in the upper, hydrophilic, and lower, hydrophobic, phases were used to determine the percentage of clipped chimera as a ratio of HRP activity in the upper phase to the total activity in the lysate. To normalize for inter-experimental variations, we subtracted the fraction of HRP proteolysis of tail-less ssHRPP-selectin763 chimera (typically about 25%) as background from each data set since this chimera has previously been demonstrated to be incapable of internalization and, consequently, of delivery to lysosomes instead accumulating on the plasma membrane (35Norcott J.P. Solari R. Cutler D.F. J. Cell Biol. 1996; 134: 1229-1240Crossref PubMed Scopus (52) Google Scholar). The internalization of HRP-P-selectin chimeras was assessed using a surface biotinylation strategy. H.Ep.2 cells expressing HRP-P-selectin chimeras grown in 6-well plates were rinsed with ice-cold PBS, twice with PBS supplemented with 0.7 mm CaCl2 and 0.25 mmMgSO4 (PBS2+), and then incubated with 0.5 mg/ml NHS-SS-biotin in PBS2+ for 30 min. Biotinylation was stopped by washing once with 50 mm glycine in PBS2+ and twice with PBS2+. Some of the cells were then incubated at 37 °C with prewarmed growth media containing 20 mm HEPES, pH 7.2, for different times (4, 8, and 12 min) in a water bath followed by transfer of the cells onto ice. To remove surface-exposed biotin, the cells were then treated with freshly prepared glutathione buffer (50 mm glutathione, 75 mm NaCl, 75 mm NaOH, pH 8.0, 10% fetal calf serum) three times for 15 min each. The excess glutathione was quenched with PBS2+ containing 5 mg/ml iodoacetamide. The cells were then washed twice with PBS2+, lysed in 1 ml of NDET buffer (1% Nonidet P-40, 0.4% sodium deoxycholate, 66 mm EDTA, 10 mm Tris-HCl, pH 7.4, 1 mmphenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 10 μg/ml pepstatin A). The lysates were spun for 15 min at 13,000 rpm in a microcentrifuge and 0.3% SDS was added to the resulting supernatants. Biotinylated proteins were collected by incubation with 30 μl of streptavidin-agarose at +4 °C for 2 h. Beads were then washed two times with NDET/SDS, one time with NDET/SDS containing 0.5 m NaCl, and finally one time with PBS. Samples were solubilized in 30 μl of reducing sample buffer (62.5 mm Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 5% β-mercaptoethanol, and 0.001% bromphenol blue) and analyzed by SDS-PAGE and immunoblotting as described below. For labeling with [3H]palmitic acid, the transfected cells were grown on 90-mm dishes to subconfluency, incubated in Dulbecco's modified Eagle's medium containing 5% fetal calf serum, 4 mmnon-essential amino acids, and 5 mm sodium pyruvate (FA medium) for 1 h in the CO2 incubator, and labeled in 10 ml of FA medium containing 2 mCi of [3H]palmitic acid for 6 h at 37 °C. For labeling with [35S]methionine/cysteine, the cells grown on 60-mm dishes were rinsed twice with PBS and incubated in 2 ml of methionine- and cysteine-free growth medium containing 5% fetal calf serum and 0.4 mCi of 35S Express labeling mix for 2 h at 37 °C. Labeled cells were washed with ice-cold PBS five times and solubilized in NDET buffer as described above. Lysates were preincubated with 50 μl of a 30% suspension of Pansorbin for 1 h at 4 °C and centrifuged for 15 min at 13,000 rpm. The resulting supernatants were incubated with 3 μl of polyclonal anti-HRP antibody overnight at 4 °C and then with 40 μl of Pansorbin for 1 h at 4 °C. The immunocomplexes were washed with NDET buffer as described above, released from Pansorbin by boiling for 3 min in non-reducing sample buffer (62.5 mm Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, and 0.001% bromphenol blue) and analyzed by SDS-PAGE. Proteins were separated on 8% SDS-polyacrylamide minigels (Bio-Rad) using the modified Laemmli system (36Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (212367) Google Scholar). The gels of metabolically labeled proteins were treated with 1 m sodium salicylate for 15 min, dried, exposed to x-ray film (Fuji, Japan) or to a PhosphorImager screen for weak β-emission (Fuji, Japan). In biotinylation experiments, proteins were transferred after electrophoresis onto Immobilon-P membranes that were then blocked with 5% skimmed milk in 50 mm Tris-HCl, pH 8.3, for 1 h. The blots were subsequently incubated with polyclonal anti-HRP antibody (diluted 1:1000 in TBS (20 mm Tris-HCl, pH 7.6, 50 mmNaCl)) followed by detection with 125I-protein A (1:1000). Biotinylated HRP-P-selectin chimeras were visualized and quantitated using PhosphorImager exposure and the “Molecular Analyst” software (Bio-Rad). N-Acetyl-β-d-glucosaminidase activity was determined as described (37Kornilova E.S. Taverna D. Hoeck W. Hynes N.E. Oncogene. 1992; 7: 511-519PubMed Google Scholar). Protein concentration was measured using the Micro BCA protein assay kit (Pierce, UK) according to the manufacturer's instructions. HRP activity in the samples was determined in triplicate as described previously (35Norcott J.P. Solari R. Cutler D.F. J. Cell Biol. 1996; 134: 1229-1240Crossref PubMed Scopus (52) Google Scholar). We have previously shown that lysosomal targeting of P-selectin is dependent on the sequence KCPL located within the membrane-proximal C1 domain. Within this motif, Pro-767 was shown to make a major contribution to its function (10Blagoveshchenskaya A.D. Norcott J.P. Cutler D.F. J. Biol. Chem. 1998; 273: 2729-2737Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). To determine whether residues other than Pro-767 contribute to the efficiency of lysosomal targeting, we have engineered mutant HRP-P-selectin chimeras with alanine substitutions of Lys-765, Cys-766, and Leu-768 (Fig. 1). We have previously introduced two assays to characterize the lysosomal targeting of HRP-P-selectin chimeras in H.Ep.2 cells as follows: assay 1, quantitation of the efficiency of targeting to a mixed population of late MVB and lysosomes (referred to below as lysosomal fractions) using subcellular fractionation to calculate the LTI, and assay 2, Triton X-114 partitioning to determine the extent of HRP released from its membrane anchor by proteolytic action (10Blagoveshchenskaya A.D. Norcott J.P. Cutler D.F. J. Biol. Chem. 1998; 273: 2729-2737Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Accordingly, H.Ep.2 cells transiently transfected with cDNAs encoding ssHRPP-selectinK765A, ssHRPP-selectinC766A, or ssHRPP-selectinL768A were grown for 2 days to allow for protein expression and then analyzed by subcellular fractionation or HRP proteolysis assay. In all experiments described, the difference between expression levels of the HRP-P-selectin chimeras, as determined by ratio of HRP activity to the total amount of protein, did not exceed 4-fold (data not shown). As measured by LTI, the efficiency of lysosomal targeting for ssHRPP-selectinK765A and ssHRPP-selectinL768Awas similar to that for ssHRPP-selectin (1.19 ± 0.06; 0.94 ± 0.06 (±S.E.) and 1, correspondingly). In contrast, ssHRPP-selectinC766A was incapable of targeting to lysosomal compartments since its LTI was barely above the basal level of tail-less ssHRPP-selectin763 or ssHRPP-selectinKCPL (Fig. 2 A and Ref. 10Blagoveshchenskaya A.D. Norcott J.P. Cutler D.F. J. Biol. Chem. 1998; 273: 2729-2737Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). These results are in agreement with the HRP proteolysis data that indicate that HRP clipping for ssHRPP-selectinK765A and ssHRPP-selectinL768A is not significantly different to that of wild type protein (14.7 ± 1.3%, 13.6 ± 1.9%, and 16 ± 1.9%, respectively), whereas substitution of Cys-766 for Ala caused a fall in the amount of degraded HRP to 5 ± 1.5% (Fig. 2 B). This decrease of LTI and HRP clipping in the latter case is not a consequence of either impaired internalization (see below) or accelerated removal of degraded HRP fragments from the cell. Indeed, following pretreatment of transfected cells with 100 μm mixture of pepstatin A and leupeptin, we detected only very small LTIs as follows: 0.12 ± 0.04 for non-treated cells and 0.28 ± 0.08 for treated cells expressing ssHRPP-selectinC766A (Fig. 4). These inhibitors have been previously shown to dramatically reduce HRP clipping of chimeras (10Blagoveshchenskaya A.D. Norcott J.P. Cutler D.F. J. Biol. Chem. 1998; 273: 2729-2737Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). ssHRPP-selectinP767A displayed both a slightly higher LTI and percentage of HRP proteolysis than did ssHRPP-selectinC766A (Fig. 2, A and B) implying that Cys-766 is the most important amino acid residue within the KCPL motif with a lesser contribution from Pro-767. Mutation of the other two amino acids, Lys-765 and Leu768, had no effects on the efficiency of lysosomal targeting.Figure 4The effect of protease inhibitors on lysosomal targeting of HRP-P-selectin chimeras. H.Ep.2 cells were transiently transfected with cDNAs encoding chimeras as indicatedbeneath each pair of bars, grown for 24 h without inhibitors, and then for 24 h in growth medium supplemented with 100 μm each of pepstatin A and leupeptin (filled bars) or without inhibitors (dotted bars). Each bar represents the mean ± S.E. of three independent determinations. Cells have then been subjected to subcellular fr
Referência(s)