Oxygen-tolerant H2 Oxidation by Membrane-bound [NiFe] Hydrogenases of Ralstonia Species
2008; Elsevier BV; Volume: 284; Issue: 1 Linguagem: Inglês
10.1074/jbc.m803676200
ISSN1083-351X
AutoresMarcus Ludwig, James A. Cracknell, Kylie A. Vincent, Fräser A. Armstrong, Oliver Lenz,
Tópico(s)Hydrogen Storage and Materials
ResumoKnallgas bacteria such as certain Ralstonia spp. are able to obtain metabolic energy by oxidizing trace levels of H2 using O2 as the terminal electron acceptor. The [NiFe] hydrogenases produced by these organisms are unusual in their ability to oxidize H2 in the presence of O2, which is a potent inactivator of most hydrogenases through attack at the active site. To probe the origin of this unusual O2 tolerance, we conducted a study on the membrane-bound hydrogenase from Ralstonia eutropha H16 and that of the closely related organism Ralstonia metallidurans CH34, which was purified using a new heterologous overproduction system. Direct electrochemical methods were used to determine apparent inhibition constants for O2 inhibition of H2 oxidation (KI(app)O2) for each enzyme. These values were at least 2 orders of magnitude higher than those of "standard" [NiFe] hydrogenases. Amino acids close to the active site were exchanged in the membrane-bound hydrogenase of R. eutropha H16 for those from standard hydrogenases to probe the role of individual residues in conferring O2 sensitivity. Michaelis constants for H2 (KMH2) were determined, and for some mutants these were increased more than 20-fold relative to the wild type. Mutations resulting in membrane-bound hydrogenase enzymes with increasedKMH2 or decreasedKI(app)O2) values were associated with impaired lithoautotrophic growth in the presence of high O2 concentrations. Knallgas bacteria such as certain Ralstonia spp. are able to obtain metabolic energy by oxidizing trace levels of H2 using O2 as the terminal electron acceptor. The [NiFe] hydrogenases produced by these organisms are unusual in their ability to oxidize H2 in the presence of O2, which is a potent inactivator of most hydrogenases through attack at the active site. To probe the origin of this unusual O2 tolerance, we conducted a study on the membrane-bound hydrogenase from Ralstonia eutropha H16 and that of the closely related organism Ralstonia metallidurans CH34, which was purified using a new heterologous overproduction system. Direct electrochemical methods were used to determine apparent inhibition constants for O2 inhibition of H2 oxidation (KI(app)O2) for each enzyme. These values were at least 2 orders of magnitude higher than those of "standard" [NiFe] hydrogenases. Amino acids close to the active site were exchanged in the membrane-bound hydrogenase of R. eutropha H16 for those from standard hydrogenases to probe the role of individual residues in conferring O2 sensitivity. Michaelis constants for H2 (KMH2) were determined, and for some mutants these were increased more than 20-fold relative to the wild type. Mutations resulting in membrane-bound hydrogenase enzymes with increasedKMH2 or decreasedKI(app)O2) values were associated with impaired lithoautotrophic growth in the presence of high O2 concentrations. Hydrogenases are active catalysts both in H2 oxidation and proton reduction (1Cammack R. Robson R. Frey M. Hydrogen as a Fuel: Learning from Nature.in: Taylor & Francis Ltd., London1997Google Scholar). Three phylogenetically distinct classes of hydrogenases are found in nature as follows: [FeFe], [NiFe], and [Fe] hydrogenases (2Shima S. Thauer R.K. Chem. Rec. 2007; 7: 37-46Crossref PubMed Scopus (245) Google Scholar, 3Fontecilla-Camps J.C. Volbeda A. Cavazza C. Nicolet Y. Chem. Rev. 2007; 107: 4273-4303Crossref PubMed Scopus (1134) Google Scholar). The basic module of a [NiFe] hydrogenase consists of two subunits, a large subunit that contains the Ni-Fe active site, and a small, electron-transferring subunit that accommodates three Fe-S clusters (4Volbeda A. Charon M.H. Piras C. Hatchikian E.C. Frey M. Fontecilla-Camps J.C. Nature. 1995; 373: 580-587Crossref PubMed Scopus (1387) Google Scholar, 5Albracht S.P. Biochim. Biophys. Acta. 1994; 1188: 167-204Crossref PubMed Scopus (446) Google Scholar, 6Surerus K.K. Chen M. van der Zwaan J.W. Rusnak F.M. Kolk M. Duin E.C. Albracht S.P. Mu¨nck E. Biochemistry. 1994; 33: 4980-4993Crossref PubMed Scopus (88) Google Scholar). The Ni is coordinated to the protein via four thiol groups from cysteine residues, two of which are bridging ligands to the Fe, which additionally coordinates two CN- and one CO (7Volbeda A. Garcin E. Piras C. de Lacey A.L. Fernandez V.M. Hatchikian E.C. Frey M. Fontecilla-Camps J.C. J. Am. Chem. Soc. 1996; 118: 12989-12996Crossref Scopus (588) Google Scholar, 8Pierik A.J. Roseboom W. Happe R.P. Bagley K.A. Albracht S.P. J. Biol. Chem. 1999; 274: 3331-3337Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar). The structure of the active site of the "standard" O2-sensitive [NiFe] hydrogenase from Desulfovibrio gigas is shown in Fig. 1A. A crucial feature of hydrogenases is their sensitivity to O2. Although the [NiFe] hydrogenases are generally more robust toward O2 damage than the [FeFe] enzymes (9Vincent K.A. Parkin A. Lenz O. Albracht S.P. Fontecilla-Camps J.C. Cammack R. Friedrich B. Armstrong F.A. J. Am. Chem. Soc. 2005; 127: 18179-18189Crossref PubMed Scopus (190) Google Scholar, 10Vincent K.A. Parkin A. Armstrong F.A. Chem. Rev. 2007; 107: 4366-4413Crossref PubMed Scopus (621) Google Scholar), the vast majority of [NiFe] hydrogenases act under anaerobic conditions in vivo, and their activity is normally subject to reversible inactivation by O2. Dioxygen is a π-acceptor ligand like H2 and CO and is expected to enter the active site easily. However, it subsequently behaves as an oxidizing agent, leading to inactive "resting" states. EPR studies on a set of standard [NiFe] hydrogenases, such as those isolated from Allochromatium vinosum, D. gigas, Desulfovibrio vulgaris Miyazaki F, and Desulfovibrio fructosovorans, have identified distinct Ni(III) features associated with two inactive states, known as Ni-A ("Unready") and Ni-B ("Ready"), and these are also associated with subtly distinct ν(CO) and ν(CN) frequencies in IR spectra (11Cammack R. Fernandez V.M. Schneider K. Biochimie (Paris). 1986; 68: 85-91Crossref PubMed Scopus (60) Google Scholar, 12Bleijlevens B. van Broekhuizen F.A. De Lacey A.L. Roseboom W. Fernandez V.M. Albracht S.P. J. Biol. Inorg. Chem. 2004; 9: 743-752Crossref PubMed Scopus (102) Google Scholar). In conjunction with crystallographic studies on the D. gigas enzyme, for example, it has been established that Ni-B incorporates a hydroxide ligand into the bridging position between Ni and Fe, whereas further electron density in the active site of Ni-A suggests a bridging peroxide ligand or an O atom bonded to cysteinyl S; both ligands are released through reductive activation under H2 (13Fernandez V.M. Hatchikian E.C. Cammack R. Biochim. Biophys. Acta. 1985; 832: 69-79Crossref Scopus (180) Google Scholar, 14Ogata H. Hirota S. Nakahara A. Komori H. Shibata N. Kato T. Kano K. Higuchi Y. Structure (Lond.). 2005; 13: 1635-1642Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar, 15Volbeda A. Martin L. Cavazza C. Matho M. Faber B.W. Roseboom W. Albracht S.P. Garcin E. Rousset M. Fontecilla-Camps J.C. J. Biol. Inorg. Chem. 2005; 10: 239-249Crossref PubMed Scopus (286) Google Scholar). The ready state of the enzyme is also formed under anaerobic oxidative conditions (10Vincent K.A. Parkin A. Armstrong F.A. Chem. Rev. 2007; 107: 4366-4413Crossref PubMed Scopus (621) Google Scholar, 11Cammack R. Fernandez V.M. Schneider K. Biochimie (Paris). 1986; 68: 85-91Crossref PubMed Scopus (60) Google Scholar, 12Bleijlevens B. van Broekhuizen F.A. De Lacey A.L. Roseboom W. Fernandez V.M. Albracht S.P. J. Biol. Inorg. Chem. 2004; 9: 743-752Crossref PubMed Scopus (102) Google Scholar, 16Jones A.K. Lamle S.E. Pershad H.R. Vincent K.A. Albracht S.P. Armstrong F.A. J. Am. Chem. Soc. 2003; 125: 8505-8514Crossref PubMed Scopus (150) Google Scholar). In contrast to standard hydrogenases, a few [NiFe] hydrogenases, especially those synthesized by Knallgas bacteria, catalyze aerobic H2 oxidation using O2 as the terminal oxidant (9Vincent K.A. Parkin A. Lenz O. Albracht S.P. Fontecilla-Camps J.C. Cammack R. Friedrich B. Armstrong F.A. J. Am. Chem. Soc. 2005; 127: 18179-18189Crossref PubMed Scopus (190) Google Scholar). In the light of the above comments, this situation is seemingly paradoxical. Furthermore, there are intense efforts to produce organisms and synthetic catalysts that cycle H2 without interference from O2. We define hydrogenases that exhibit catalytic activity in the presence of O2 as being "O2 tolerant" (10Vincent K.A. Parkin A. Armstrong F.A. Chem. Rev. 2007; 107: 4366-4413Crossref PubMed Scopus (621) Google Scholar). The [NiFe] hydrogenases expressed by chemolithoautotrophic Ralstonia species fall into this special category (17Burgdorf T. Lenz O. Buhrke T. van der Linden E. Jones A.K. Albracht S.P. Friedrich B. J. Mol. Microbiol. Biotechnol. 2005; 10: 181-196Crossref PubMed Scopus (179) Google Scholar). For example, electrochemical experiments have shown that although the membrane-bound hydrogenase (MBH) 5The abbreviations used are: MBH, membrane-bound hydrogenase; PFV, protein film voltammetry; Re, R. eutropha; RH, H2-sensing, regulatory hydrogenase; Rm, R. metallidurans; SH, NAD-reducing hydrogenase; SHE, standard hydrogen electrode. enzymes from Ralstonia eutropha H16 (Re H16) and Ralstonia metallidurans (Rm CH34) react rapidly and reversibly with O2, substantial H2 oxidation activity remains even in air (9Vincent K.A. Parkin A. Lenz O. Albracht S.P. Fontecilla-Camps J.C. Cammack R. Friedrich B. Armstrong F.A. J. Am. Chem. Soc. 2005; 127: 18179-18189Crossref PubMed Scopus (190) Google Scholar, 18Cracknell J.A. Vincent K.A. Ludwig M. Lenz O. Friedrich B. Armstrong F.A. J. Am. Chem. Soc. 2008; 130: 424-425Crossref PubMed Scopus (48) Google Scholar). A practical demonstration of this O2 tolerance was provided by the construction of an H2 fuel cell employing Rm CH34 MBH as the anode catalyst and laccase (a multicopper oxidase catalyzing the clean four-electron reduction of O2 to water) at the cathode. With this device it was possible to produce sufficient electricity from a quiescent atmosphere of just 3% H2 in air to power a wristwatch for over 24 h (19Vincent K.A. Cracknell J.A. Clark J.R. Ludwig M. Lenz O. Friedrich B. Armstrong F.A. Chem. Commun. (Camb.). 2006; 48: 5033-5035Crossref Scopus (118) Google Scholar). No crystal structure has yet been obtained for any O2-tolerant hydrogenase. IR spectroscopic experiments suggest that Re H16 MBH has the same coordination arrangement of CO and CN- ligands at the active site as the standard O2-sensitive [NiFe] hydrogenases (20Vincent K.A. Cracknell J.A. Lenz O. Zebger I. Friedrich B. Armstrong F.A. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 16951-16954Crossref PubMed Scopus (233) Google Scholar). 6M. Saggu, I. Zebger, M. Ludwig, O. Lenz, B. Friedrich, P. Hildebrandt, and F. Lendzian, submitted for publication. An amino acid sequence comparison reveals that Re H16 MBH shares only ∼40% identity with standard [NiFe] hydrogenases. However, the amino acids closest to the Re H16 MBH Ni-Fe active site are identical to those in the O2-sensitive periplasmic hydrogenase from D. gigas, for which a structure has been determined (4Volbeda A. Charon M.H. Piras C. Hatchikian E.C. Frey M. Fontecilla-Camps J.C. Nature. 1995; 373: 580-587Crossref PubMed Scopus (1387) Google Scholar). The nearest nonconserved residues to the active site are (according to D. gigas hydrogenase numbering) tyrosine 70 and valine 71, which correspond to glycine 80 and cysteine 81 in Re H16 MBH (Fig. 1B). To probe whether these specific residues confer O2 tolerance, a series of exchanges via site-directed mutagenesis was introduced into the Re H16 MBH. Experiments on the H2-sensing hydrogenases (RH) from Re H16 and Rhodobacter capsulatus (21Buhrke T. Lenz O. Krauss N. Friedrich B. J. Biol. Chem. 2005; 280: 23791-23796Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar, 22Duche O. Elsen S. Cournac L. Colbeau A. FEBS J. 2005; 272: 3899-3908Crossref PubMed Scopus (71) Google Scholar) have provided evidence that O2 tolerance arises from the bulky residues isoleucine and phenylalanine restricting access of O2 through a narrow gas channel to the active site. In Re H16 MBH, the corresponding residues are valine 77 and leucine 125. To probe whether introducing bulky residues into the MBH further enhances the O2 tolerance of the enzyme, the residues found in the sensory hydrogenases were introduced into Re H16 MBH by genetic engineering. The effects of these mutations were investigated in terms of cell growth characteristics and the catalytic properties of the isolated enzymes. The isolated enzymes were studied electrochemically using the suite of techniques known as protein film voltammetry (PFV), which has proved to be very useful in studying hydrogenases from various organisms (9Vincent K.A. Parkin A. Lenz O. Albracht S.P. Fontecilla-Camps J.C. Cammack R. Friedrich B. Armstrong F.A. J. Am. Chem. Soc. 2005; 127: 18179-18189Crossref PubMed Scopus (190) Google Scholar, 10Vincent K.A. Parkin A. Armstrong F.A. Chem. Rev. 2007; 107: 4366-4413Crossref PubMed Scopus (621) Google Scholar, 20Vincent K.A. Cracknell J.A. Lenz O. Zebger I. Friedrich B. Armstrong F.A. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 16951-16954Crossref PubMed Scopus (233) Google Scholar, 23Vincent K.A. Belsey N.A. Lubitz W. Armstrong F.A. J. Am. Chem. Soc. 2006; 128: 7448-7449Crossref PubMed Scopus (54) Google Scholar, 24Láger C. Dementin S. Bertrand P. Rousset M. Guigliarelli B. J. Am. Chem. Soc. 2004; 126: 12162-12172Crossref PubMed Scopus (134) Google Scholar). The enzyme is adsorbed onto an electrode as a sub-monolayer film such that the electrode replaces physiological electron donors and acceptors. Catalytic currents report directly on enzyme activity under conditions of controlled potential (driving force). Using PFV, activity can be measured even under aerobic conditions (18Cracknell J.A. Vincent K.A. Ludwig M. Lenz O. Friedrich B. Armstrong F.A. J. Am. Chem. Soc. 2008; 130: 424-425Crossref PubMed Scopus (48) Google Scholar), in which soluble electron donors would be oxidized by O2. Strains and Plasmids—The bacterial strains and plasmids and the primers used in this study are listed in Table 1 and Table 2, respectively. Escherichia coli JM109 (25Yanisch-Perron C. Vieira J. Messing J. Gene (Amst.). 1985; 33: 103-119Crossref PubMed Scopus (11465) Google Scholar) was used as host in standard cloning procedures, and E. coli S17-1 (26Simon R. Priefert U. Pu¨hler A. Bio/Technology. 1983; 1: 784-790Crossref Scopus (5642) Google Scholar) served as a donor in conjugative transfers. Both Re H16 and Rm CH34 are wild-type strains, and strains carrying the letters HF are derivatives of Re H16.TABLE 1Bacterial strains and plasmids used in this studyStrains or plasmidsRelevant characteristic(s)Source or Ref.R. metalliduransCH34Wild typeDSM2839R. eutrophaH16Wild type; MBH+, SH+, RH+, HoxJ–DSM 428, ATCC 17699HF631pHG1–, Δnor(R2A2B2)::Φ[hoxK′-lacZ]29Lenz O. Gleiche A. Strack A. Friedrich B. J. Bacteriol. 2005; 187: 6590-6595Crossref PubMed Scopus (53) Google ScholarHF632pLO6 in HF631, H16 MBH overexpression29Lenz O. Gleiche A. Strack A. Friedrich B. J. Bacteriol. 2005; 187: 6590-6595Crossref PubMed Scopus (53) Google ScholarHF688pGE615 in HF631, CH34 MBH overexpressionThis studyHF649pGE636 in HF631, H16 hoxK-StrepTag II27Schubert T. Lenz O. Krause E. Volkmer R. Friedrich B. Mol. Microbiol. 2007; 66: 453-467Crossref PubMed Scopus (50) Google ScholarHF717pGE621 in HF631, CH34 hoxK-StrepTag IIThis studyHF676pGE610 in HF631, H16 hoxK-StrepTag II, hoxG C81AThis studyHF677pGE611 in HF631, H16 hoxK-StrepTag II, hoxG C81SThis studyHF678pGE612 in HF631, H16 hoxK-StrepTag II, hoxG C81TThis studyHF679pGE613 in HF631, H16 hoxK-StrepTag II, hoxG V771This studyHF680pGE614 in HF631, H16 hoxK-StrepTag II, hoxG L125FThis studyHF715pGE622 in HF631, H16 hoxK-StrepTag II, hoxG V77I/L125FThis studyHF754pGE639 in HF631, H16 hoxK-StrepTag II, hoxG G80YThis studyHF755pGE640 in HF631, H16 hoxK-StrepTag II, hoxG C81VThis studyHF756pGE641 in HF631, H16 hoxK-StrepTag II, hoxG G80Y/C81VThis studyHF388SH– (ΔhoxH)58Bernhard M. Schwartz E. Rietdorf J. Friedrich B. J. Bacteriol. 1996; 178: 4522-4529Crossref PubMed Google ScholarHF681Derivative of HF388, hoxG C81AThis studyHF682Derivative of HF388, hoxG C81SThis studyHF683Derivative of HF388, hoxG C81TThis studyHF738Derivative of HF388, hoxG C81VThis studyHF684Derivative of HF388, hoxG V77IThis studyHF685Derivative of HF388, hoxG L125FThis studyHF716Derivative of HF388, hoxG V77I/L125FThis studyHF739Derivative of HF388, hoxG G80YThis studyHF740Derivative of HF388, hoxG G80Y/C81VThis studyE. coliJM109F′ traD36 lacIq Δ(lacZ)M15 proA+B+/e14–(McrA–) Δ(lac-proAB) thi gyrA96 (Nalr) endA1 hsdR17(rK–mK+) relA1 supE44 recA125Yanisch-Perron C. Vieira J. Messing J. Gene (Amst.). 1985; 33: 103-119Crossref PubMed Scopus (11465) Google ScholarS17-1Tra+ recA pro thi hsdR, chr::RP4-226Simon R. Priefert U. Pu¨hler A. Bio/Technology. 1983; 1: 784-790Crossref Scopus (5642) Google ScholarPlasmidLitmus 28Apr lacZ′, ColE1 oriNew England BiolabspEDY309RK2 ori, Tcr, Mob+28Kleihues L. Lenz O. Bernhard M. Buhrke T. Friedrich B. J. Bacteriol. 2000; 182: 2716-2724Crossref PubMed Scopus (112) Google ScholarpCH78521.56-kbk SpeI-XbaI fragment carrying the Re H16 MBH operon in Litmus28 (-SacI)29Lenz O. Gleiche A. Strack A. Friedrich B. J. Bacteriol. 2005; 187: 6590-6595Crossref PubMed Scopus (53) Google ScholarpLO6MBH overexpression plasmid (pEDY309 derivative carrying the MBH operon)29Lenz O. Gleiche A. Strack A. Friedrich B. J. Bacteriol. 2005; 187: 6590-6595Crossref PubMed Scopus (53) Google ScholarpCH13518.96-kbp PstI-Ecl136II fragment carrying hoxKGZMLOQRTV in Litmus28 (-KpnI)27Schubert T. Lenz O. Krause E. Volkmer R. Friedrich B. Mol. Microbiol. 2007; 66: 453-467Crossref PubMed Scopus (50) Google ScholarpCH13539.00-kbp PstI-Ecl136II fragment carrying hoxKGZMLOQRTV with a StrepTag II coding sequence fused to the 3′ end of hoxK in Litmus28 (-KpnI)27Schubert T. Lenz O. Krause E. Volkmer R. Friedrich B. Mol. Microbiol. 2007; 66: 453-467Crossref PubMed Scopus (50) Google ScholarpGE63621.60-kbp SpeI-XbaI fragment carrying the Re H16 MBH operon with a StrepTag II coding sequence fused to the 3′ end of hoxK in pEDY30927Schubert T. Lenz O. Krause E. Volkmer R. Friedrich B. Mol. Microbiol. 2007; 66: 453-467Crossref PubMed Scopus (50) Google ScholarpLO2Kmr, sacB, RP4 oriT, ColE1 ori30Lenz O. Schwartz E. Dernedde J. Eitinger M. Friedrich B. J. Bacteriol. 1994; 176: 4385-4393Crossref PubMed Google ScholarpCH12294.54-kbp MfeI (Klenow-treated)-PstI fragment from pCH1351 in Ecl136II-PstI digested Litmus28This studypCH12374.39-kbp XbaI digested PCR fragment (with primers 638 and 639 on pCH1229) religatedThis studypCH12662.94-kbp HindIII-BsrGI digested PCR fragment (with primers 641 and 642 on Rm CH34 genomic DNA) in pCH1237This studypCH12674.40-kbp SpeI-AsiSI fragment from pCH1266 in pCH1351This studypCH12689.02-kbp SpeI-Ecl136II fragment from pCH1267 in pCH785This studypGE61521.57-kbp SpeI-XbaI fragment from pCH1268 in pEDY309This studypCH12690.62-kbp BssHII fragment from pCH1266 in Litmus28This studypCH12943.48-kbp RsrII digested PCR fragment (with primers 653 and 654 on pCH1269) religatedThis studypCH12950.41-kbp PspOMI-SalI fragment from pCH1294 in pCH1266This studypCH12964.44-kbp SpeI-AsiSI fragment from pCH1295 in pCH1351This studypCH12979.06-kbp SpeI-Ecl136II fragment from pCH1296 in pCH785This studypGE62121.60-kbp SpeI-XbaI fragment from pCH1297 in pEDY309This studypCH12340.69-kbp Acc65I-BmgBI fragment from pCH1351 in Acc65I-EcoRV-digested Litmus28This studypGE610Derivative of pGE636 (hoxG C81A, TGT→GCG)This studypGE611Derivative of pGE636 (hoxG C81S, TGT→TCG)This studypGE612Derivative of pGE636 (hoxG C81T, TGT→ACG)This studypGE613Derivative of pGE636 (hoxG V77I, GTT→ATC)This studypGE614Derivative of pGE636 (hoxG L125F, CTG→TTC)This studypGE622Derivative of pGE636 (hoxG V77I, GTT→ATC; L125F, CTG→TTC)This studypGE639Derivative of pGE636 (hoxG G80Y, GGT→TAC)This studypGE640Derivative of pGE636 (hoxG C81V, TGT→GTT)This studypGE641Derivative of pGE636 (hoxG G80Y, GGT→TAC; C81V, TGT→GTT)This study Open table in a new tab TABLE 2Oligonucleotide primers used in this studyNumberSequence638AGTCTAGAAGGAAGCTTCGTCGCGAAATGCCCTGCCTGC639GCTCTAGAAGGTGCTGTACAAGCGTCTGGCCAGCGAGCGGATATC640GCCGAAGCTTCATGAAGTACTGCTCGCTCACC641GCGCTGTACACGGGGGCTTATCTCACCTTCACCCGGCTCATC644GACAACCGGTACAGATACCGCAGATGCGTTCTACGAAC645CGCAACGCTGTTTCCACTGG646TTGTACCGGTGCGCACGCGCTTGCGTCGGTGCG647TTGTACCGGTACGCACGCGCTTGCGTCGGTGCG648TTGTACCGGTTCGCACGCGCTTGCGTCGGTGCG649ACATCCACCCAATCCAGCGC650CCCATCTGATCCGAGAGATC651CATCCACCCAATCCAGCGCATGGAAGTGATAGAAATGCACCGCATG652CGGCAGCACATAAGCCTTGG653CTCCGGTCCGTCACTTCTCGAACTGCGGGTGGCTCCAAGCAGATCTGT GGTTGGCGGGTGTGGATGCGTCGGGCTTGCGGGC654TGACGGACCGGAGGAACAAGAACATGGGTGCTTACG661TTGTACCGGTGTTCACGCGCTTGCGTCGGTGCG662CGCATCTGCGGTGTTTGTACCTACTGTCACGCGCTTGCGTCGGTG663CGCATCTGCGGTGTTTGTACCTACGTTCACGCGCTTGCGTCGGTGCGT Open table in a new tab For purification of the Re MBH variants, we used the plasmid pGE636 carrying the complete MBH operon with a hoxK gene fused with a StrepTag II sequence at its 3′ end (27Schubert T. Lenz O. Krause E. Volkmer R. Friedrich B. Mol. Microbiol. 2007; 66: 453-467Crossref PubMed Scopus (50) Google Scholar). An equivalent plasmid for overproduction of the MBH from Rm CH34 was constructed as follows. A HindIII restriction site within the coding region for the leader sequence of HoxK and a BsrGI site downstream of hoxG were introduced by inverse PCR with primers 638 and 639 using pCH1229 as a template. The 4.39-kbp amplificate was digested with XbaI and re-ligated, resulting in pCH1237. A 2.94-kbp PCR fragment, amplified with primers 640 and 641 on Rm CH34 genomic DNA, was digested with HindIII-BsrGI and inserted into pCH1237 resulting in pCH1266. Plasmid pCH1266 was cut with SpeI and AsiSI, and a 4.40-kbp fragment containing hoxKG CH34 was cloned into SpeI-AsiSI-digested pCH1351 carrying hoxKGZMLOQRTV from Re H16. This yielded plasmid pCH1267 from which a 9.02-kbp SpeI-Ecl136II fragment was subsequently transferred into pCH785 resulting in pCH1268. Finally, a 21.57-kbp SpeI-XbaI fragment from pCH1268, harboring the MBH operon with hoxKG from Rm CH34, was inserted into the broad host range vector pEDY309 (28Kleihues L. Lenz O. Bernhard M. Buhrke T. Friedrich B. J. Bacteriol. 2000; 182: 2716-2724Crossref PubMed Scopus (112) Google Scholar) resulting in pGE615. A StrepTag II sequence was fused to the 3′ end of hoxK from Rm CH34 by inverse PCR using primers 653 and 654 with pCH1269 as the template. The resulting 3.48-kbp PCR fragment was digested with RsrII and re-ligated, resulting in pCH1294. A 0.41-kbp PspOMI-SalI fragment from pCH1294 was cloned into pCH1266 resulting in pCH1295, which carries the StrepTag II sequence at the 3′ end of hoxK. A 4.44-kbp SpeI-AsiSI fragment was transferred from pCH1295 into pCH1351 yielding pCH1296. From there a 9.06-kbp SpeI-Ecl136II fragment was cloned into pCH785 resulting in pCH1297. Finally, a 21.6-kbp SpeI-XbaI fragment from pCH1297, carrying the MBH operon with CH34 hoxKStrepG, was cloned into pEDY309 resulting in pGE621. The plasmids pGE615, pGE621, and pGE636 were transferred via conjugation into Re HF631, which is devoid of megaplasmid pHG1 (29Lenz O. Gleiche A. Strack A. Friedrich B. J. Bacteriol. 2005; 187: 6590-6595Crossref PubMed Scopus (53) Google Scholar), yielding Re strains HF688 (Rm MBH), HF717 (Rm MBHStrep), and HF641 (Re MBHStrep), respectively. Amino acid exchanges in HoxG of Re H16 were constructed via PCR using the forward primer 649 and the mutagenic primers 646 (for C81A), 648 (for C81S), 647 (for C81T), and 661 (for C81V), respectively. Plasmid pCH1234, carrying a 69-kbp Acc65I-BmgBI hoxG fragment, served as the template. The resulting PCR products were inserted as 143-bp AgeI-SphI fragments into pCH1234. Also, the amplificates resulting from PCRs with primers 645, 649, and 662 (for G80Y) or 663 (for G80Y/C81V) and pCH1351 as template were introduced as a 179-bp Acc65I-MscI fragment into pCH1234. For the V77I exchange, an 88-bp Acc65I-AgeI-digested PCR fragment, generated with primers 644 and 645 and pCH1351 as the template, was transferred into pCH1234. The L125F exchange was obtained by cloning a 234-bp MscI-BamHI-digested PCR product, generated with primers 650, 651, and 652 and pCH1351 as the template, into pCH1234. A 1.80-kbp AgeI-DraIII fragment from the L125F derivative was transferred into the previously constructed V77I derivative of pCH1234 yielding a hoxG mutant fragment encoding a V77I/L125F exchange. From all pCH1234 derivatives carrying the hoxG mutations, a 0.68-kbp Acc65I-BstZ17I fragment was transferred into pCH1351 and pCH1353. From the pCH1351 derivatives 4.82-kbp SalI-PstI fragments were cloned into pLO2, yielding plasmids that were used for introduction of the mutations into Re HF388 by double homologous recombination as described previously (30Lenz O. Schwartz E. Dernedde J. Eitinger M. Friedrich B. J. Bacteriol. 1994; 176: 4385-4393Crossref PubMed Google Scholar). The resulting strains HF681-HF740 are listed in Table 1. From the pCH1353 derivatives, 9.06-kbp SpeI-Ecl136II fragments were transferred into pCH785 and, from there, as 21.60-kbp SpeI-XbaI fragments into pEDY309. The resulting plasmids pGE610-614, pGE622, and pGE639-641 were transferred into Re HF631 by conjugation. This allowed the overproduction and purification of the MBH variants via a StrepTag II fused to the C terminus of the small subunit HoxK. All PCR amplificates were verified by sequencing. Media and Growth Conditions—Ralstonia strains were grown in Luria broth medium containing 0.25% (w/v) sodium chloride (LSLB) or in mineral salts medium. Synthetic media for heterotrophic growth of Re H16 and Rm CH34 contained 0.4% fructose (FN medium) or 0.2% fructose and 0.2% glycerol (FGN medium) (31Schwartz E. Gerischer U. Friedrich B. J. Bacteriol. 1998; 180: 3197-3204Crossref PubMed Google Scholar). Lithoautotrophic and mixotrophic (H2-supplemented heterotrophic) cultures were grown in mineral salts medium without any carbon source or in FGN medium, respectively, under an atmosphere of H2, CO2, and O2 (8:1:1, v/v), unless otherwise indicated. Cell cultures were grown for 48 h at 120 rpm and 30 °C until they reached an OD436 of ∼10, when cultivated heterotrophically, or ∼20, when cultivated lithoautotrophically. Cells were harvested by centrifugation (5 000 × g at 4 °C for 20 min), washed with phosphate buffer (Na2HPO4·12H2O (90 g liter-1) and KH2PO4 (15 g liter-1)), and re-centrifuged. The resulting cell pellet was frozen in liquid N2 and stored at -80 °C. Sucrose-resistant segregants of originally sacB-harboring strains were selected on LSLB plates containing 15% (w/v) sucrose (30Lenz O. Schwartz E. Dernedde J. Eitinger M. Friedrich B. J. Bacteriol. 1994; 176: 4385-4393Crossref PubMed Google Scholar). Strains of E. coli were grown in LB medium (32Miller J.H. Experiments in Molecular Genetics.in: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1972Google Scholar). Solid media contained 1.5% (w/v) agar. The following antibiotics were used: kanamycin (350 μgml-1) and tetracycline (15 μgml-1) for Re, and kanamycin (25 μgml-1), tetracycline (15 μgml-1), and ampicillin (100 μgml-1) for E. coli. MBH Purification—Cell pellets were resuspended in resuspension buffer (100 mm Tris/HCl, pH 8.0, 150 mm NaCl), 4 ml per 1 g of cells (wet weight), containing protease inhibitor mixture (Complete EDTA-free protease inhibitor mixture, Roche Applied Science) and DNase I. The cell suspension was subsequently disrupted in a French pressure cell (Constant Cell Disruption Systems or SLM Aminco). The resulting crude extract was treated by sonication (2 min, level 2.5, 75%, Branson Sonifier), and the membrane and soluble fractions were separated by ultracentrifugation (100,000 × g at 4 °C for 60 min). The brownish membranes were removed, homogenized in an appropriate volume of washing buffer (resuspension buffer + 1 mm EDTA), and ultracentrifuged again (100,000 × g at 4 °C for 30 min). For MBH purification, the membrane proteins were solubilized by adding washing buffer containing Triton X-114 at a final concentration of 2% w/v and subsequently stirring on ice for 1.5 h. After ultracentrifugation (100,000 × g, 4 °C, 20 min), the supernatant, containing the solubilized membranes, was loaded on Strep-Tactin Superflow columns (IBA, Go¨ttingen, Germany; 1-ml bed volume for up to 25 ml of solubilized membrane extract). The columns were washed with 12 column volumes of washing buffer, and proteins were eluted with 6× 0.5 ml of elution buffer (washing buffer + 5 mm desthiobiotin). MBH-containing fractions were pooled and concentrated using a centrifugal filter device (Amicon Ultra-15 (PL-30), Millipore). The buffer was changed twice by adding 10 ml of storage buffer (50 mm Tris/HCl, pH 8.0, 50 mm NaCl, 1 mm EDTA, 20% glycerol) and subsequent recentrifugation. Aliquots of the resulting concentrate were frozen in liquid N2 and stored at -80 °C. Protein concentrations were determined by the Bradford method (33Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (216428) Google Scholar) using bovine serum albumin as standard. The purity of the samples was estimated by visual inspection of SDS-polyacrylamide gels stained by Coomassie Brilliant Blue G-250 (34Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207227) Google Scholar). Western immunoblot analysis was performed according to a standard protocol (35Towbin H. Staehelin T. Gordon J. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 4350-4354Crossref PubMed Scopus (44923) Google Scholar) with anti-HoxK serum (1:5000) and anti-HoxG serum (1:10
Referência(s)