Portal de Periódicos da CAPES

Different Catalytically Competent Arrangements of Arachidonic Acid within the Cyclooxygenase Active Site of Prostaglandin Endoperoxide H Synthase-1 Lead to the Formation of Different Oxygenated Products

2000; Elsevier BV; Volume: 275; Issue: 12 Linguagem: Inglês

10.1074/jbc.275.12.8501

1083-351X

Elizabeth D. Thuresson, Karen M. Lakkides, William L. Smith,

Eicosanoids and Hypertension Pharmacology

Arachidonic acid is converted to prostaglandin G2 (PGG2) by the cyclooxygenase activities of prostaglandin endoperoxide H synthases (PGHSs) 1 and 2. The initial, rate-limiting step is abstraction of the 13-proS hydrogen from arachidonate which, for PGG2 formation, is followed by insertion of O2at C-11, cyclization, and a second O2 insertion at C-15. As an accompaniment to ongoing structural studies designed to determine the orientation of arachidonate in the cyclooxygenase site, we analyzed the products formed from arachidonate by (a) solubilized, partially purified ovine (o) PGHS-1; (b) membrane-associated, recombinant oPGHS-1; and (c) a membrane-associated, recombinant active site mutant (V349L oPGHS-1) and determined kinetic values for formation of each product. Native forms of oPGHS-1 produced primarily PGG2 but also several monohydroxy acids, which, in order of abundance, were 11R-hydroxy-5Z,8Z,12E,14Z-eicosatetraenoic acid (11R-HETE), 15S-hydroxy-5Z,8Z,11Z,13E-eicosatetraenoic acid (15S-HETE), and 15R-HETE. V349L oPGHS-1 formed primarily PGG2, 15S-HETE, and 15R-HETE but only trace amounts of 11R-HETE. With native enzyme, the K m values for PGG2, 11-HETE, and 15-HETE formation were each different (5.5, 12.1, and 19.4 μm, respectively); similarly, theK m values for PGG2 and 15-HETE formation by V349L oPGHS-1 were different (11 and 5 μm, respectively). These results establish that arachidonate can assume at least three catalytically productive arrangements within the cyclooxygenase site of oPGHS-1 leading to PGG2, 11R-HETE, and 15S-HETE and/or 15R-HETE, respectively. IC50 values for inhibition of formation of the individual products by the competitive inhibitor, ibuprofen, were determined and found to be the same for a given enzyme form (i.e. 175 μm for oPGHS-1 and 15 μm for V349L oPGHS-1). These latter results are most simply rationalized by a kinetic model in which arachidonate forms various catalytically competent arrangements only after entering the cyclooxygenase active site. Arachidonic acid is converted to prostaglandin G2 (PGG2) by the cyclooxygenase activities of prostaglandin endoperoxide H synthases (PGHSs) 1 and 2. The initial, rate-limiting step is abstraction of the 13-proS hydrogen from arachidonate which, for PGG2 formation, is followed by insertion of O2at C-11, cyclization, and a second O2 insertion at C-15. As an accompaniment to ongoing structural studies designed to determine the orientation of arachidonate in the cyclooxygenase site, we analyzed the products formed from arachidonate by (a) solubilized, partially purified ovine (o) PGHS-1; (b) membrane-associated, recombinant oPGHS-1; and (c) a membrane-associated, recombinant active site mutant (V349L oPGHS-1) and determined kinetic values for formation of each product. Native forms of oPGHS-1 produced primarily PGG2 but also several monohydroxy acids, which, in order of abundance, were 11R-hydroxy-5Z,8Z,12E,14Z-eicosatetraenoic acid (11R-HETE), 15S-hydroxy-5Z,8Z,11Z,13E-eicosatetraenoic acid (15S-HETE), and 15R-HETE. V349L oPGHS-1 formed primarily PGG2, 15S-HETE, and 15R-HETE but only trace amounts of 11R-HETE. With native enzyme, the K m values for PGG2, 11-HETE, and 15-HETE formation were each different (5.5, 12.1, and 19.4 μm, respectively); similarly, theK m values for PGG2 and 15-HETE formation by V349L oPGHS-1 were different (11 and 5 μm, respectively). These results establish that arachidonate can assume at least three catalytically productive arrangements within the cyclooxygenase site of oPGHS-1 leading to PGG2, 11R-HETE, and 15S-HETE and/or 15R-HETE, respectively. IC50 values for inhibition of formation of the individual products by the competitive inhibitor, ibuprofen, were determined and found to be the same for a given enzyme form (i.e. 175 μm for oPGHS-1 and 15 μm for V349L oPGHS-1). These latter results are most simply rationalized by a kinetic model in which arachidonate forms various catalytically competent arrangements only after entering the cyclooxygenase active site. prostaglandin endoperoxide H synthase ovine PGHS-1 17-hydroxy-(5Z,8Z,10E)-heptadecatrienoic acid 11-hydroxy-(5Z,8Z,12E,13Z)-eicosatetraenoic acid 11-hydroperoxy-(5Z,8Z,12E,13Z)-eicosatetraenoic acid 15-hydroxy-(5Z,8Z,11Z,13E)-eicosatetraenoic acid high performance liquid chromatography reverse phase high performance liquid chromatography cyclooxygenase-1 cyclooxygenase-2 prostaglandin Prostaglandin endoperoxide H synthases 1 and 2 (PGHS-1 and -2)1 catalyze the conversion of arachidonic acid and O2 to PGH 2: the committed step in the formation of prostanoids (prostaglandins, thromboxane A2 (see Refs. 1.Smith W.L. Marnett L.J. DeWitt D.L. Pharmacol. Ther. 1991; 49: 153-179Crossref PubMed Scopus (387) Google Scholar, 2.Smith W.L. DeWitt D.L. Adv. Immunol. 1996; 62: 167-215Crossref PubMed Google Scholar, 3.Smith W.L. Garavito R.M. DeWitt D.L. J. Biol. Chem. 1996; 271: 33157-33160Abstract Full Text Full Text PDF PubMed Scopus (1849) Google Scholar, 4.Marnett L.J. Rowlinson S.W. Goodwin D.C. Kalgutkar A.S. Lanzo C.A. J. Biol. Chem. 1999; 274: 22903-22906Abstract Full Text Full Text PDF PubMed Scopus (463) Google Scholar, 5.DeWitt D.L. Mol. Pharmacol. 1999; 55: 625-631PubMed Google Scholar, 6.Smith, W. L., Garavito, R. M., and DeWitt, D. L. (2000) Annu. Rev. Biochem., in pressGoogle Scholar)). PGHS-1 (or COX-1) is often referred to as the constitutive enzyme whereas PGHS-2 (COX-2) is known as the inducible isoform (7.Raz A. Wyche A. Jiyi F. Seibert K. Needleman P. Adv. Prostaglandin Thromboxane Leukotriene Res. 1990; 20: 22-27PubMed Google Scholar, 8.Jones D.A. Carlton D.P. McIntyre T.M. Zimmerman G.A. Prescott S.M. J. Biol. Chem. 1993; 268: 9049-9054Abstract Full Text PDF PubMed Google Scholar, 9.Hulkower K.I. Wertheimer S.J. Levin W. Coffey J.W. Anderson C.M. Chen T. DeWitt D. Crowl M. Hope W.C. Morgan D.W. Arthritis Rheum. 1994; 37: 653-661Crossref PubMed Scopus (117) Google Scholar, 10.Matijevic-Aleksic N. Sanduja S.K. Wang L.H. Wu K.K. Biochim. Biophys. Acta. 1995; 1269: 167-175Crossref PubMed Scopus (30) Google Scholar, 11.Foegh M.L. Watkins W.D. Prostaglandins in Clinical Practice. Raven Press, New York1989: 131-140Google Scholar, 12.Evett G.E. Xie W. Chipman J.G. Robertson D.L. Simmons D.L. Arch. Biochem. Biophys. 1993; 306: 169-177Crossref PubMed Scopus (120) Google Scholar, 13.Kujubu D.A. Fletcher B.S. Varnum B.C. Lim R.W. Herschman H.R. J. Biol. Chem. 1991; 266: 12866-12872Abstract Full Text PDF PubMed Google Scholar, 14.Xie W. Herschman H.R. J. Biol. Chem. 1995; 270: 27622-27628Abstract Full Text Full Text PDF PubMed Scopus (296) Google Scholar, 15.Xie W. Herschman H.R. J. Biol. Chem. 1996; 271: 31742-31748Abstract Full Text Full Text PDF PubMed Scopus (222) Google Scholar). Apart from their important biological roles and their functions as targets of nonsteroidal anti-inflammatory drugs (4.Marnett L.J. Rowlinson S.W. Goodwin D.C. Kalgutkar A.S. Lanzo C.A. J. Biol. Chem. 1999; 274: 22903-22906Abstract Full Text Full Text PDF PubMed Scopus (463) Google Scholar, 5.DeWitt D.L. Mol. Pharmacol. 1999; 55: 625-631PubMed Google Scholar), PGHSs are of considerable interest in the context of the structural biology and enzymology of membrane proteins. These enzymes are homodimeric (∼72 kDa/subunit), heme-containing, glycoproteins with two catalytic sites; moreover, PGHSs represent a prototype of a new class of integral membrane proteins that appear to be anchored to one leaflet of the lipid bilayer through the hydrophobic surfaces of amphipathic helices and not through more typical transmembrane domains (3.Smith W.L. Garavito R.M. DeWitt D.L. J. Biol. Chem. 1996; 271: 33157-33160Abstract Full Text Full Text PDF PubMed Scopus (1849) Google Scholar, 16.Wendt K.U. Poralla K. Schulz G.E. Science. 1997; 277: 1811-1815Crossref PubMed Scopus (372) Google Scholar, 17.Li Y. Smith T. Grabski S. DeWitt D.L. J. Biol. Chem. 1998; 273: 29830-29837Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 18.Spencer A.G. Thuresson E.D. Otto J.C. Song I. Smith T. DeWitt D.L. Garavito R.M. Smith W.L. J. Biol. Chem. 1999; 274: 32936-32942Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). PGHSs catalyze two separate reactions: a cyclooxygenase (bis-oxygenase) reaction in which arachidonate is converted to PGG2 and a peroxidase reaction in which PGG2undergoes a two-electron reduction to PGH2. PGHS-1 and PGHS-2 have similar cyclooxygenase turnover numbers (∼3500 mol of arachidonate/min/mol of dimer; Refs. 19.Kulmacz R.J. Pendleton R.B. Lands W.E.M. J. Biol. Chem. 1994; 269: 5527-5536Abstract Full Text PDF PubMed Google Scholar, 20.Gierse J.K. Hauser S.D. Creely D.P. Koboldt C. Rangwala S.H. Isakson P.C. Seibert K. Biochem. J. 1995; 305: 479-484Crossref PubMed Scopus (380) Google Scholar, 21.Barnett J. Chow J. Ives D. Chiou M. Mackenzie R. Osen E. Nguyen B. Tsing S. Bach C. Freire J. Chan H. Sigal E. Ramesha C. Biochim. Biophys. Acta. 1994; 1209: 130-139Crossref PubMed Scopus (305) Google Scholar) and K mvalues for arachidonate (∼5 μm; Refs. 20.Gierse J.K. Hauser S.D. Creely D.P. Koboldt C. Rangwala S.H. Isakson P.C. Seibert K. Biochem. J. 1995; 305: 479-484Crossref PubMed Scopus (380) Google Scholar, 21.Barnett J. Chow J. Ives D. Chiou M. Mackenzie R. Osen E. Nguyen B. Tsing S. Bach C. Freire J. Chan H. Sigal E. Ramesha C. Biochim. Biophys. Acta. 1994; 1209: 130-139Crossref PubMed Scopus (305) Google Scholar, 22.Meade E.A. Smith W.L. DeWitt D.L. J. Biol. Chem. 1993; 268: 6610-6614Abstract Full Text PDF PubMed Google Scholar, 23.Laneuville O.I. Breuer D.K. Xu N. Huang Z.H. Gage D.A. Watson J.T. Lagarde M. DeWitt D.L. Smith W.L. J. Biol. Chem. 1995; 270: 19330-19336Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar) and for O2 (∼5 μm; Refs. 24.Lands W.E.M. Sauter J. Stone G.W. Prost. Med. 1978; 1: 117-120Abstract Full Text PDF PubMed Scopus (43) Google Scholar and 25.Juranek I. Suzuki H. Yamamoto S. Biochim. Biophys. Acta. 1999; 1436: 509-518Crossref PubMed Scopus (37) Google Scholar) and exhibit similar fatty acid substrate specificities (23.Laneuville O.I. Breuer D.K. Xu N. Huang Z.H. Gage D.A. Watson J.T. Lagarde M. DeWitt D.L. Smith W.L. J. Biol. Chem. 1995; 270: 19330-19336Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar). The cyclooxygenase reaction begins with a rate-limiting abstraction of the 13-proS hydrogen from arachidonate to yield an arachidonyl radical (26.Hamberg M. Samuelsson B. J. Biol. Chem. 1967; 242: 5336-5343Abstract Full Text PDF PubMed Google Scholar, 27.Tsai A. Kulmacz R.J. Palmer G. J. Biol. Chem. 1995; 270: 10503-10508Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar). This is followed by sequential oxygen additions at C-11 and C-15 to yield the prostaglandin endoperoxide PGG2. Nonsteroidal anti-inflammatory drugs compete directly with arachidonate for binding to the cyclooxygenase site and inhibit cyclooxygenase activity, but have little or no effect on peroxidase catalysis (28.Mizuno K. Yamamoto S. Lands W.E.M. Prostaglandins. 1982; 23: 743-757PubMed Google Scholar, 29.Rome L.H. Lands W.E.M. Proc. Natl. Acad. Sci. U. S. A. 1975; 72: 4863-4865Crossref PubMed Scopus (262) Google Scholar, 30.Marshall P.J. Kulmacz R.J. Arch. Biochem. Biophys. 1988; 266: 162-170Crossref PubMed Scopus (52) Google Scholar). PGHSs exhibit some lipoxygenase activity producing small amounts of 11-hydroxy-8Z,12E,14Z-eicosatrienoic acid and 15-hydroxy-8Z,11Z,13E-eicosatrienoic acid from 8,11,14-eicosatrienoic acid (26.Hamberg M. Samuelsson B. J. Biol. Chem. 1967; 242: 5336-5343Abstract Full Text PDF PubMed Google Scholar) and the corresponding 11- and 15-HETEs from arachidonic acid (31.Hecker M. Ullrich V. Fischer C. Meese C.O. Eur. J. Biochem. 1987; 169: 113-123Crossref PubMed Scopus (55) Google Scholar, 32.Xiao G. Tsai A.L. Palmer G. Boyar W.C. Marshall P.J. Kulmacz R.J. Biochemistry. 1997; 36: 1836-1845Crossref PubMed Scopus (111) Google Scholar). Aspirin-acetylated PGHS-2, which has no cyclooxygenase activity, synthesizes 15R-HETE (32.Xiao G. Tsai A.L. Palmer G. Boyar W.C. Marshall P.J. Kulmacz R.J. Biochemistry. 1997; 36: 1836-1845Crossref PubMed Scopus (111) Google Scholar, 33.Lecomte M. Laneuville O. Ji C. DeWitt D.L. Smith W.L. J. Biol. Chem. 1994; 269: 13207-13215Abstract Full Text PDF PubMed Google Scholar). Studies comparing native and aspirin-acetylated PGHS-2 have raised the possibility that arachidonate can bind in distinct orientations in the PGHS-2 active site to produce either PGG2 plus 11R-HETE or 15R-HETE (32.Xiao G. Tsai A.L. Palmer G. Boyar W.C. Marshall P.J. Kulmacz R.J. Biochemistry. 1997; 36: 1836-1845Crossref PubMed Scopus (111) Google Scholar). We have examined the products formed from arachidonate by native ovine (o) PGHS-1 and a cyclooxygenase active site mutant, V349L oPGHS-1, and have determined the kinetics for the formation of each individual product. We have also determined the IC50 values for the inhibition of formation of each product by ibuprofen. Collectively, our results indicate that arachidonate can be bound in the cyclooxygenase active site of oPGHS-1 in at least three different, catalytically competent arrangements that lead to PGG2, 11R-HETE, and 15-HETE, respectively, and that these three arrangements of arachidonate occur subsequent to its entry into the cyclooxygenase active site. Arachidonic acid was purchased from Cayman Chemical Co. (Ann Arbor, MI). [1-14C]Arachidonic acid (40–60 mCi/mmol) was purchased from NEN Life Science Products. Flurbiprofen was from Sigma. Restriction enzymes and Dulbecco's modified Eagle's medium were purchased from Life Technologies, Inc. Calf serum and fetal bovine serum were purchased from HyClone. Primary antibodies used for Western blotting were raised in rabbits against purified oPGHS-1 and purified as an IgG fraction (18.Spencer A.G. Thuresson E.D. Otto J.C. Song I. Smith T. DeWitt D.L. Garavito R.M. Smith W.L. J. Biol. Chem. 1999; 274: 32936-32942Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 34.Otto J.C. Smith W.L. J. Biol. Chem. 1994; 269: 19868-19875Abstract Full Text PDF PubMed Google Scholar, 35.Spencer A.G. Woods J.W. Arakawa T. Singer I.I. Smith W.L. J. Biol. Chem. 1998; 273: 9886-9893Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar); goat anti-rabbit IgG horseradish peroxidase conjugate was purchased from Bio-Rad. C10E7 detergent used for solubilization of oPGHS-1 was from Anatrace, Inc. Oligonucleotides used as primers for mutagenesis were prepared by the Michigan State University Macromolecular Structure and Sequencing Facility. All other reagents were from common commercial sources. V349L oPGHS-1 was prepared starting with M13mp19-oPGHS-1, which contains a 2.3-kilobase pairSalI fragment encoding native ovine PGHS-1 (18.Spencer A.G. Thuresson E.D. Otto J.C. Song I. Smith T. DeWitt D.L. Garavito R.M. Smith W.L. J. Biol. Chem. 1999; 274: 32936-32942Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 34.Otto J.C. Smith W.L. J. Biol. Chem. 1994; 269: 19868-19875Abstract Full Text PDF PubMed Google Scholar), using a Bio-Rad Muta-Gene kit and the manufacturer's protocol. The oligonucleotide used for mutagenesis was 5′-1127AGAGGAGTATCTGCAGCAGCTGA1149-3′. Single-stranded phage samples were sequenced using Sequenase (version 2.0, United States Biochemical Corp.) and the protocol described by the manufacturer. The replicative form of M13mp19-oPGHS-1 containing the V349L mutation was prepared from phage cultures, digested with SalI, isolated by gel electrophoresis, and electroluted into dialysis tubing using standard protocols. The resulting 2.3-kilobase pair oPGHS-1 cDNA fragment was purified and subcloned into pSVT7, followed by digestion withPstI to verify the orientation of the insert (18.Spencer A.G. Thuresson E.D. Otto J.C. Song I. Smith T. DeWitt D.L. Garavito R.M. Smith W.L. J. Biol. Chem. 1999; 274: 32936-32942Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 34.Otto J.C. Smith W.L. J. Biol. Chem. 1994; 269: 19868-19875Abstract Full Text PDF PubMed Google Scholar, 35.Spencer A.G. Woods J.W. Arakawa T. Singer I.I. Smith W.L. J. Biol. Chem. 1998; 273: 9886-9893Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar). Plasmids used for transfection were purified by CsCl gradient ultracentrifugation, and the mutation was reconfirmed by double-stranded sequencing of the pSVT7 construct as described above. COS-1 cells (ATTC CRL-1650) were grown in Dulbecco's modified Eagle's medium containing 8% calf serum and 2% fetal bovine serum until near confluence (∼3 × 106 cells/10-cm dish) (18.Spencer A.G. Thuresson E.D. Otto J.C. Song I. Smith T. DeWitt D.L. Garavito R.M. Smith W.L. J. Biol. Chem. 1999; 274: 32936-32942Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 34.Otto J.C. Smith W.L. J. Biol. Chem. 1994; 269: 19868-19875Abstract Full Text PDF PubMed Google Scholar,35.Spencer A.G. Woods J.W. Arakawa T. Singer I.I. Smith W.L. J. Biol. Chem. 1998; 273: 9886-9893Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar). Cells were then transfected with a pSVT7 plasmid containing cDNA coding for native or V349L oPGHS-1 using the DEAE-dextran/chloroquine transfection method as reported previously (18.Spencer A.G. Thuresson E.D. Otto J.C. Song I. Smith T. DeWitt D.L. Garavito R.M. Smith W.L. J. Biol. Chem. 1999; 274: 32936-32942Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 34.Otto J.C. Smith W.L. J. Biol. Chem. 1994; 269: 19868-19875Abstract Full Text PDF PubMed Google Scholar, 35.Spencer A.G. Woods J.W. Arakawa T. Singer I.I. Smith W.L. J. Biol. Chem. 1998; 273: 9886-9893Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar). Forty hours following transfection, cells were harvested in cold phosphate-buffered saline, collected by centrifugation, and resuspended in 0.1 m Tris-HCl, pH 7.5. Sham-transfected cells were collected in an identical manner. Microsomal preparations were used for Western blotting and for cyclooxygenase and peroxidase assays. Microsomes were prepared from ovine seminal vesicles essentially as described previously (36.Picot D. Loll P.J. Garavito M. Nature. 1994; 367: 243-249Crossref PubMed Scopus (1150) Google Scholar, 37.Van der Ouderaa F.J. Buytenhek M. Nugteren D.H. Van Dorp D.A. Biochim. Biophys. Acta. 1977; 487: 315-331Crossref PubMed Scopus (324) Google Scholar). Microsomes were solubilized with 0.1% C10E7, centrifuged, and the supernatant loaded onto an equilibrated DEAE-cellulose column. Fractions from the DEAE-cellulose column were assayed for peroxidase activity and protein concentration. Desired fractions were pooled, concentrated, and loaded onto an equilibrated S-300 column overnight. Fractions from the DEAE and S-300 columns were used for assays with partially purified enzyme. The specific cyclooxygenase activity was 2–10 units/mg for DEAE fractions and 15–30 units/mg for S300 fractions. One unit of enzyme is defined as that amount of enzyme which will catalyze the oxygenation of 1 μmol of arachidonate/min. Forty hours following transfection, COS-1 cells were collected, sonicated, and resuspended in 0.1 m Tris-HCl, pH 7.5. Aliquots of the cell suspension (75 μg of protein) or 5 cyclooxygenase activity units of partially purified oPGHS-1 were incubated for 1 min at 37 °C with various concentrations of [1-14C]arachidonic acid with and without 200 μm flurbiprofen. Radioactive products were extracted and separated by thin layer chromatography as described previously (38.Smith W.L. Lands W.E.M. Biochemistry. 1972; 11: 3276-3282Crossref PubMed Scopus (276) Google Scholar). Products were visualized by autoradiography and quantitated by liquid scintillation counting. Negative control values from samples incubated with 200 μm flurbiprofen were subtracted from the experimental values observed for each sample in the absence of flurbiprofen. Inhibition of product formation by ibuprofen was measured similarly using different concentrations of ibuprofen in reaction mixtures containing 10 μm arachidonate. Native or V349L oPGHS-1 (75 μg of cell protein) prepared from transfected COS cells or semipurified oPGHS-1 (5 cyclooxygenase activity units) were incubated with 2–100 μm arachidonic acid for 1 min at 37 °C. The products were extracted as described above and resuspended in HPLC buffers (1/1; v/v). 15- and 11-HETEs were separated by RP-HPLC using a C18 column from Vydac (Hesperia, CA) and detected with a Waters model 600 HPLC equipped with a 990 photo diode array detector set at 234 nm. The polar component of the mobile phase was 0.1% aqueous acetic acid, and the eluting solvent was acetonitrile. The flow rate was 1 ml/min. The elution profile used was: 0–30 min, 30% acetonitrile; 30–100 min, 50% acetonitrile; 100–125 min, 75% acetonitrile; 125–130 min, 100% acetonitrile. The retention times of 15-HETE and 11-HETE were 36 and 38 min, respectively. Material obtained by RP-HPLC was esterified by treatment with excess diazomethane and subjected to chiral-phase HPLC. Diazomethane was prepared from Diazald (N-methyl-N-nitroso-p-toluenesulfonamide) (Aldrich) as described in the company's technical bulletin AL-180. Chiral-phase HPLC was performed on a Chiralcel OC column (250 × 4.6 mm) from Daicel Chemical Industries (Osaka, Japan) using hexane/2-propanol (98/2; v/v) at a flow rate of 0.5 ml/min. The retention times of the methyl esters of 15R- and 15S-HETE were 25 and 27 min, respectively. Retention times for the methyl esters of 11R- and 11S-HETE were 26 and 28 min, respectively. Cyclooxygenase assays were performed at 37 °C by monitoring the initial rate of O2 uptake using an oxygen electrode (39.Rieke C.J. Mulichak A.M. Garavito R.M. Smith W.L. J. Biol. Chem. 1999; 274: 17109-17114Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). Each standard assay mixture contained 3.0 ml of 0.1 m Tris-HCl, pH 8.0, 1 mm phenol, 85 μg of bovine hemoglobin, and 2–100 μm arachidonate. Reactions were initiated by adding approximately 250 μg of microsomal protein prepared from COS-1 cells or partially purified oPGHS-1 in a volume of 20–50 μl to the assay mixture. Peroxidase activity was measured spectrophotometrically as described previously (39.Rieke C.J. Mulichak A.M. Garavito R.M. Smith W.L. J. Biol. Chem. 1999; 274: 17109-17114Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). The reaction mixtures contained 0.1m Tris-HCl, pH 8.0, 0.1 mm 3,3,3′,3′- tetramethylphenylenediamine, approximately 100 μg of microsomal protein, and 1.7 μm hematin in a total volume of 3 ml. Reactions were initiated by adding 100 μl of 0.3 mmH2O2, and the absorbance at 610 nm was monitored with time. As presented below (see "Discussion"), two different kinetic schemes were developed to model mechanisms by which oPGHS-1 could produce different products with different kinetic properties. Rate and IC50 equations were derived for each scheme using the general rate equations below. v=Vmax[S]/{Km+[S]}Equation 1 v=Vmax[S]/{Km(1+[I]/KI)+[S]}Equation 2 Both schemes were developed for the formation of two separate products to illustrate the principles; however, the schemes are easily expandable to accommodate situations where there are multiple products. The relevant rate equations for Scheme 1 are given below. v(1)(no inhibitor)=k5[Etot][So]K1(Ko+[So]+[So]/K2)+[So]Equation 3 v(2)(no inhibitor)=k6[Etot][So]K2(Ko+[So]+[So]/K1+[So]Equation 4 v(1)(with inhibitor)=k5[Etot][So]/(K1+K1/K2+1)(KoK1/(K1+K1/K2+1))(1+[I]/KI)+[So]Equation 5 v(2)(with inhibitor)=k6[Etot][So]/(K2+K2/K1+1)(KoK2/(K2+K2/K1+1))(1+[I]/KI)+[So]Equation 6 IC50(1)=KI(1+[So]/Ko+[So]/K1Ko+[So]/K2Ko)Equation 7 IC50(2)=KI(1+[So]/Ko+[So]/K1Ko+[So]/K2Ko)Equation 8 IC50(1)=IC50(2)Equation 9 The relevant rate equations for Scheme 2 are given below. v(1)(no inhibitor)=k2[Etot][So]K1(1+1/Ko+[So]/KoK2)+[So]Equation 10 v(2)(no inhibitor)=k4[Etot][So]K2(1+Ko+[So]Ko/K1)+[So]Equation 11 v(1)(with inhibitor)=Equation 12 k2[Etot][So]/(1+K1/KoK2)K1(1+[I]/KI(1)+1/Ko+[I]/KI(2)Ko)1+K1/KoK2+[So] v(2)(with inhibitor)=Equation 13 k4[Etot][So]/(1+KoK2/K1)K2(1+[I]Ko/KI(1)+Ko+[I]/KI(2))1+KoK2/K1+[So] IC50(1)=1+1/Ko+[So](1/KoK2+1/K1)1/KI(1)+1/KI(2)KoEquation 14 IC50(2)=1+Ko+[So](Ko/K1+1/K2)1/KI(2)+Ko/KI(1)Equation 15 IC50(1)≠IC50(2)Equation 16 Results are expressed as the mean ± S.E. for a minimum of four experiments using different preparations of partially purified oPGHS-1 or membrane-associated native or V349L oPGHS-1. Statistical significance was determined using a two-samplet test assuming equal variances. Microsomal preparations of oPGHS-1 and V349L oPGHS-1 from COS-1 cells transfected with plasmids encoding native oPGHS-1 or V349L oPGHS-1 as well as partially purified native oPGHS-1 from seminal vesicles were used to determine overall K m values for the oxygenation of arachidonate using an oxygen electrode assay. The K m values were 3 μm both for solubilized, partially purified and for membrane-associated, recombinant native oPGHS-1; as expected, this value is in the range (2–8 μm) reported previously for recombinant and purified forms of ovine, murine, and human PGHS-1 (20.Gierse J.K. Hauser S.D. Creely D.P. Koboldt C. Rangwala S.H. Isakson P.C. Seibert K. Biochem. J. 1995; 305: 479-484Crossref PubMed Scopus (380) Google Scholar, 21.Barnett J. Chow J. Ives D. Chiou M. Mackenzie R. Osen E. Nguyen B. Tsing S. Bach C. Freire J. Chan H. Sigal E. Ramesha C. Biochim. Biophys. Acta. 1994; 1209: 130-139Crossref PubMed Scopus (305) Google Scholar, 22.Meade E.A. Smith W.L. DeWitt D.L. J. Biol. Chem. 1993; 268: 6610-6614Abstract Full Text PDF PubMed Google Scholar, 23.Laneuville O.I. Breuer D.K. Xu N. Huang Z.H. Gage D.A. Watson J.T. Lagarde M. DeWitt D.L. Smith W.L. J. Biol. Chem. 1995; 270: 19330-19336Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar, 40.Shimokawa T. Smith W.L. J. Biol. Chem. 1992; 267: 12387-12392Abstract Full Text PDF PubMed Google Scholar). TheK m for arachidonate with the V349L oPGHS-1 mutant was 7 μm. Western transfer blotting indicated that V349L oPGHS-1 was expressed in COS-1 cells at the same level as native oPGHS-1 (data not shown) and had 65% of the cyclooxygenase activity and 100% of the peroxidase activity of native oPGHS-1 expressed in parallel transfections. As illustrated in Fig. 1, oPGHS-1 and V349L oPGHS-1 formed the same products from [1-14C]arachidonate including those products derived from PGG2 (HHTre, PGD2, PGE2, and PGF2") and the monohydroxy acids 11-hydroxy-5Z,8Z,12E, 14Z-eicosatetraenoic acid (11-HETE) and 15-hydroxy-5Z, 8Z,11Z,13E-eicosatetraenoic acid (15-HETE), which are derived from reduction of the corresponding hydroperoxides. However, V349L oPGHS-1 produced substantially larger amounts of 15-HETE and relatively less PGG2 and 11-HETE (Fig. 1) than native enzyme. With 2 μm arachidonate and 5 cyclooxygenase units of either partially purified oPGHS-1 or broken cell preparations of COS-1 cells expressing oPGHS-1, 95% of the products were derived from PGG2, 3% was 11-HETE, and 2% was 15-HETE; with 2 μm arachidonate and broken cell preparations of COS-1 cells expressing V349L oPGHS-1, 70% of the product was PGG2, <0.5% was 11-HETE, and 30% was 15-HETE. Extracts from incubation mixtures containing partially purified oPGHS-1, recombinant oPGHS-1 or recombinant V349L oPGHS-1 were incubated with different concentrations of arachidonate and then separated by RP-HPLC. 11- and 15-HETE were isolated, converted to their methyl esters, and examined by chiral HPLC. This is illustrated in Fig.2 for partially purified native oPGHS-1 incubated with 100 μm arachidonate. 11-HETE was exclusively 11R-HETE. 15-HETE was 70% 15S-HETE and 30% 15R-HETE. The ratio of 15S-HETE to 15R-HETE was the same for both purified and microsomal, recombinant oPGHS-1. Similarly, the 15-HETE fraction derived from incubation of arachidonate with V349L oPGHS-1 contained 70% 15S-HETE and 30% 15R-HETE; only trace amounts of 11-HETE were formed by V349L oPGHS-1, and the chirality of this latter product was not determined. Interestingly, the enantiomeric composition of the 15-HETE product was 65–70% 15S-HETE and 30–35% 15R-HETE at all arachidonate concentrations tested with both native and V349L oPGHS-1 (i.e. when 2, 5, 10, 20, 35, 50, or 100 μm arachidonate was used as the substrate with purified oPGHS-1; when 10 and 100 μm arachidonate was used as the substrate for membrane-associated, recombinant oPGHS-1; or when 2, 5, 10, 20, 35, 50, or 100 μm arachidonate was used as the substrate for membrane preparations of recombinant V349L oPGHS-1). We noted in the studies outlined above that there were obvious differences in the relative ratios of the monohydroxy fatty acid and PGG2-derived products at different arachidonate concentrations. Accordingly, we performed a series of measurements to determine the K m values for the formation of the different products by native oPGHS-1 (Fig.3) and V349L oPGHS-1 (Fig.4). The results are summarized in TableI. It should be noted that the amounts of enzyme (5 units for partially purified native enzyme or 75 μg of broken COS-1 cell protein for V349L oPGHS-1) used in these assays were adjusted so that <25% of the total substrate was consumed even with the lowest concentration of arachidonate tested (2 μm). Product formation was analyzed after 1-min incubations by radio thin layer chromatography and/or by RP-HPLC. The key finding of these experiments is that the K m values for the formation of PGG2, 11-HETE, and 15-HETE by native oPGHS-1 and theK m values for PGG2 and 15-HETE formation by V349L oPGHS-1 were different for each product (Table I).Figure 4Effect of arachidonic acid concentration on the formation of PGG2 and 15-HETE by V349L oPGHS-1. V349L oPGHS-1 (75 μg of protein from transfected COS-1 cells) was incubated with the indicated concentrations of arachidonate at 37 °C fo