The Role of SREBP-1c in Nutritional Regulation of Lipogenic Enzyme Gene Expression
2002; Elsevier BV; Volume: 277; Issue: 30 Linguagem: Inglês
10.1074/jbc.m202638200
ISSN1083-351X
AutoresAngela K. Stoeckman, Howard C. Towle,
Tópico(s)Lipid metabolism and biosynthesis
ResumoA high carbohydrate diet up-regulates the transcription of enzymes of triglyceride biosynthesis (lipogenesis) in the mammalian liver. This treatment stimulates hepatic insulin signaling, leading to transcription of sterol regulatory element-binding protein-1c (SREBP-1c). SREBP-1c has been implicated as a major factor that up-regulates lipogenic genes in response to carbohydrate feeding. However, we presented evidence for another factor, carbohydrate response factor, which is also involved in this response, and we proposed a model wherein SREBP-1c and carbohydrate response factor are independent transcription factors that act in response to insulin and glucose, respectively. In this study, we examined the contribution of SREBP-1c to the expression of lipogenic genes in glucose- and insulin-treated primary rat hepatocytes using an inducible adenovirus system. We found that SREBP-1c overexpression leads to a modest induction of fatty acid synthase, S14, and acetyl-CoA carboxylase mRNAs to 20% (fatty acid synthase), 10% (S14), and 5% (acetyl-CoA carboxylase) of the induction seen by high glucose and insulin treatment. Restoring insulin to cells overexpressing SREBP-1c did not further increase these mRNA levels. In contrast, adenovirus-expressed SREBP-1c did not induce pyruvate kinase mRNA, suggesting that induction of this gene is SREBP-1c-independent. SREBP-1c does indeed play a role in the induction of lipogenic enzyme genes in response to insulin treatment, but it is not sufficient for the induction seen when hepatocytes are treated with insulin and high glucose. A high carbohydrate diet up-regulates the transcription of enzymes of triglyceride biosynthesis (lipogenesis) in the mammalian liver. This treatment stimulates hepatic insulin signaling, leading to transcription of sterol regulatory element-binding protein-1c (SREBP-1c). SREBP-1c has been implicated as a major factor that up-regulates lipogenic genes in response to carbohydrate feeding. However, we presented evidence for another factor, carbohydrate response factor, which is also involved in this response, and we proposed a model wherein SREBP-1c and carbohydrate response factor are independent transcription factors that act in response to insulin and glucose, respectively. In this study, we examined the contribution of SREBP-1c to the expression of lipogenic genes in glucose- and insulin-treated primary rat hepatocytes using an inducible adenovirus system. We found that SREBP-1c overexpression leads to a modest induction of fatty acid synthase, S14, and acetyl-CoA carboxylase mRNAs to 20% (fatty acid synthase), 10% (S14), and 5% (acetyl-CoA carboxylase) of the induction seen by high glucose and insulin treatment. Restoring insulin to cells overexpressing SREBP-1c did not further increase these mRNA levels. In contrast, adenovirus-expressed SREBP-1c did not induce pyruvate kinase mRNA, suggesting that induction of this gene is SREBP-1c-independent. SREBP-1c does indeed play a role in the induction of lipogenic enzyme genes in response to insulin treatment, but it is not sufficient for the induction seen when hepatocytes are treated with insulin and high glucose. fatty acid synthase acetyl-CoA carboxylase sterol regulatory element-binding protein carbohydrate response element carbohydrate response factor reverse transcriptase The synthesis of triglycerides is nutritionally regulated. For example, when mammals are fed a high carbohydrate/low fat diet, the expression of genes involved in triglyceride formation (lipogenesis) is induced. This induction occurs primarily at the transcriptional level in the liver and adipose tissue, the major sites of lipogenesis. The induced lipogenic mRNAs include pyruvate kinase, a glycolytic enzyme; fatty acid synthase (FAS)1 and acetyl-CoA carboxylase (ACC), central enzymes in fatty acid synthesis; and malic enzyme, an enzyme involved in the production of NADPH (for review, see Refs. 1Girard J. Ferre P. Foufelle F. Annu. Rev. Nutr. 1997; 17: 325-352Crossref PubMed Scopus (306) Google Scholar and 2Towle H.C. J. Biol. Chem. 1995; 270: 23235-23238Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). There are two signaling pathways that contribute to lipogenic enzyme induction following a high carbohydrate meal. First, elevated post-prandial blood glucose levels lead to increased insulin secretion by β-cells in the pancreas. This insulin signal is then capable of triggering multiple cascades, leading to increased gene expression in liver or adipose tissue. Second, increased glucose metabolism generates a signal independent of the elevated insulin levels, although the intracellular pathway remains to be elucidated (3Vaulont S. Vasseur-Cognet M. Kahn A. J. Biol. Chem. 2000; 275: 31555-31558Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar). It is difficult to determine the respective roles of these two pathways in the whole animal where both hormonal levels and substrate availability fluctuate following a meal. For this reason, cultured primary hepatocytes have proven useful in mimicking the lipogenic response seen in a fed animal by treatment with controlled levels of the two signals, glucose and insulin (4Decaux J.-F. Antoine B. Kahn A. J. Biol. Chem. 1989; 264: 11584-11590Abstract Full Text PDF PubMed Google Scholar). Neither of these signals by itself is sufficient to model the dietary response seen in the animal. For example, in the cases of the S14 gene product and acetyl-CoA carboxylase, insulin treatment alone is capable of a moderate induction of expression in primary hepatocytes, but the addition of high glucose leads to further elevation of expression (5Koo S.-H. Dutcher A.K. Towle H.C. J. Biol. Chem. 2001; 276: 9437-9445Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 6O'Callaghan B.L. Koo S.-H., Wu, Y. Freake H.C. Towle H.C. J. Biol. Chem. 2001; 276: 16033-16039Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). The basic/helix-loop-helix/leucine zipper transcription factor sterol regulatory element-binding protein-1c (SREBP-1c) has emerged as a major factor involved in the insulin regulation of lipogenic enzyme expression (for review, see Refs. 7Brown M.S. Goldstein J.L. Cell. 1997; 89: 331-340Abstract Full Text Full Text PDF PubMed Scopus (3029) Google Scholar, 8Horton J.D. Shimomura I. Curr. Opin. Lipidol. 1999; 10: 143-150Crossref PubMed Scopus (275) Google Scholar, 9Osborne T.F. J. Biol. Chem. 2000; 275: 32379-32382Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar). The mRNA for this transcription factor is induced in primary hepatocytes in response to insulin treatment (10Kim J.B. Sarraf P. Wright M. Yao K.M. Mueller E. Solanes G. Lowell B.B. Spiegelman B.M. J. Clin. Invest. 1998; 101: 1-9Crossref PubMed Scopus (614) Google Scholar, 11Foretz M. Guichard C. Ferre P. Foufelle F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12737-12742Crossref PubMed Scopus (599) Google Scholar, 12Horton J.D. Bashmakov Y. Shimomura I. Shimano H. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5987-5992Crossref PubMed Scopus (540) Google Scholar). In addition, SREBP-1c is able to bind to the promoters of several lipogenic enzyme genes and induce their expression (13Magana M.M. Osborne T.F. J. Biol. Chem. 1996; 271: 32689-32694Abstract Full Text Full Text PDF PubMed Scopus (276) Google Scholar, 14Ericsson J. Jackson S.M. Kim J.B. Spiegelman B.M. Edwards P.A. J. Biol. Chem. 1997; 272: 7298-7305Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar, 15Tabor D.E. Kim J.B. Spiegelman B.M. Edwards P.A. J. Biol. Chem. 1998; 273: 22052-22058Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Other lines of evidence also suggest an important role for SREBP-1c in lipogenic gene expression. Notably, SREBP-1 knockout mice have an impaired ability to respond to carbohydrate feeding (16Shimano H. Yahagi N. Amemiya-Kudo M. Hasty A.H. Osuga J.-I. Tamura Y. Shionoiri F. Iizuka Y. Ohashi K. Harada K. Gotoda T. Ishihashi S. Yamada N. J. Biol. Chem. 1999; 274: 35832-35839Abstract Full Text Full Text PDF PubMed Scopus (583) Google Scholar, 17Liang G. Yang J. Horton J.D. Hammer R.E. Goldstein J.L. Brown M.S. J. Biol. Chem. 2002; 277: 9520-9528Abstract Full Text Full Text PDF PubMed Scopus (527) Google Scholar). Additionally, in transgenic mice with liver-specific overexpression of SREBP-1c, the rate of lipogenesis is increased as well as the level of lipogenic mRNAs (18Shimano H. Horton J.D. Shimomura I. Hammer R.E. Brown M.S. Goldstein J.L. J. Clin. Invest. 1997; 99: 846-854Crossref PubMed Scopus (688) Google Scholar, 19Shimomura I. Shimano H. Korn B.S. Bashmakov Y. Horton J.D. J. Biol. Chem. 1998; 273: 35299-35306Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar). We have recently provided evidence that the glucose induction is mediated through a transcription factor distinct from SREBP-1c. This factor is designated carbohydrate response factor (ChoRF) as it is able to bind to DNA sequences called carbohydrate response elements (ChoREs), but not to mutant ChoREs that are not glucose-responsive (20Koo S.-H. Towle H.C. J. Biol. Chem. 2000; 275: 5200-5207Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). The ChoRF complex that forms on ChoREs is not supershifted with antibodies to SREBP-1c, nor is it competed with oligonucleotides containing a known SREBP-1c binding element (5Koo S.-H. Dutcher A.K. Towle H.C. J. Biol. Chem. 2001; 276: 9437-9445Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). These results led us to propose a model in which SREBP-1c and ChoRF both have a role in the dietary induction of lipogenic gene expression. However, the molecular nature of ChoRF is not yet characterized; hence, its role in lipogenic enzyme induction remains unproven. In this study, we have explored the contribution of SREBP-1c to the expression of lipogenic enzyme genes in glucose- and insulin-treated primary rat hepatocytes. For this purpose, we adopted an inducible adenovirus system to control the expression levels of SREBP-1c in hepatocytes. We report that SREBP-1c plays an important role as a downstream regulator of insulin signaling in the induction of lipogenic enzyme genes, but that its expression alone is not sufficient for the induction seen with high glucose and insulin treatment in hepatocytes. These results support our previous model that both glucose metabolism leading to ChoRF activation and insulin signaling resulting in an increase in nuclear SREBP-1c levels play important roles in the carbohydrate stimulation of lipogenic gene expression. Male Harlan Sprague-Dawley rats (180–300 g) were fed ad libitum with normal chow and kept on a 12-h light/dark cycle. All animals were handled in accordance with experimental protocols approved by the University of Minnesota Institutional Committee on the Care and Use of Animals. Rats were anesthetized by intraperitoneal injection of 0.15 ml of Nembutal (Abbott Laboratories, North Chicago, IL)/100 g of body weight. Primary hepatocytes were isolated by the collagenase perfusion method and plated in 60-mm Primaria plates at a cell density of 3.6 × 106 cells/plate as described previously (21Kaytor E.N. Shih H.-M. Towle H.C. J. Biol. Chem. 1997; 272: 7525-7531Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). After a 3-h attachment period, cells were infected with adenovirus for 2 h in Williams' E medium containing 23 mm HEPES, 0.01 μm dexamethasone, 2 mm glutamine, 50 units/ml penicillin, 50 μg/ml streptomycin, 26 mm sodium bicarbonate, and 5.5 mm glucose. Cells were then cultured in the same medium with or without doxycycline (Sigma) and with an overlay of 0.5 mg/ml Matrigel (Collaborative Biomedical Products, Bedford, MA) for ∼15 h. After this overnight treatment, 5.5 mm (low) or 27.5 mm (high) glucose medium with or without doxycycline and with or without 0.1 unit/ml insulin was added. The inducible adenovirus was prepared according to the method of Becker et al. (22Becker T.C. Noel R.J. Coats W.S. Gomez-Foix A.M. Alam T. Gerard R.D. Newgard C.B. Methods Cell Biol. 1994; 43: 161-189Crossref PubMed Scopus (562) Google Scholar). The constructs pBH-Tet-VP16 and pac-TRE-CMV were provided by Dr. Chris Newgard (University of Texas Southwestern Medical Center, Dallas, TX) (23Trinh K. de Vargas L.M. Moss L.G. Newgard C.B. Diabetes. 1999; 48 Suppl. 1: A78Google Scholar). The rat nuclear SREBP-1c cDNA fragment was obtained by PCR using primers ending inHindIII and XbaI restriction sites, respectively (forward primer, 5′-CGTAAGCTTACGACGGAGCCATGGATTGCAC-3′; reverse primer, 5′-GATCTAGATTACATGCCTCGGCTATGTGAAGG-3′). The SREBP-1c cDNA product was inserted into the multiple cloning site of pac-TRE-CMV and sequenced for PCR integrity. This construct was then co-transfected with pBH-Tet-VP16 into HEK-293 cells. The resulting recombinant adenovirus was amplified in the same cell line, and a clonal virus was titered by immunofluorescence microscopy using a 1:20 dilution of a fluorescein isothiocyanate-conjugated monoclonal antibody specific for the penton group antigen of adenovirus (Biodesign, Saco, ME). Total cellular RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. Concentrations of RNA were measured spectrophotometrically at A260. Some RT-PCR reactions were performed using the One-Step RT-PCR kit (Qiagen, Valencia, CA) using 250 ng of total RNA. SREBP-1c primers were used at 22 cycles with an annealing temperature of 53 °C. The RT-PCR products were analyzed by 1% agarose gel electrophoresis, and band intensities were compared by imaging of ethidium bromide staining. For transcript quantification purposes, the LightCyclerTMsystem (Roche Molecular Biochemicals) was used. This system amplifies and detects PCR products in the same tube. The RT-PCR reactions were set up in microcapillary tubes using 100 ng of RNA, primers listed in Table I, and the LightCycler RNA amplification kit SYBR Green I (Roche Molecular Biochemicals). The four-step PCR cycle included a denaturing step at 95 °C for 0.1 s, an annealing step at 53 °C for 10 s, an extension step at 72 °C for the time listed in TableI, and a data/fluorescence acquisition step at a temperature just below the product melting temperature (see TableI) for 3 s. Fluorescence values were acquired at this temperature to exclude low melting primer dimers from the measurement.Table IPCR primersGeneRef.Sequence1-aU, upstream; D, downstream.Melting temperatureExtension time1-bExtension time is based on the calculation of product size (in bp)/25.Acquisition temperature°Cs°CAcetyl-CoA carboxylase(6O'Callaghan B.L. Koo S.-H., Wu, Y. Freake H.C. Towle H.C. J. Biol. Chem. 2001; 276: 16033-16039Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar)U: AGGGCAAAGGGACTGGTGTTCAGAT D: GCCAACGGAGATGGTTCATCCATTA841282Fatty acid synthaseNewU: TGCAACTGTGCGTTAGCCACC D: TGTTTCAGGGGAGAAGAGACC892886GlucokinaseNewU: GGAGACTTTCTCTCCTTAGAC D: ATTGGCGGTCTTCATAGTAGC881884Pyruvate kinase(44Kaytor E.N. Qian J. Towle H.C. Olson L.K. Mol. Cell. Biochem. 2000; 210: 13-21Crossref PubMed Google Scholar)U: GATGAAATTCTAGAAG D: GCTTCGTCAGCACGATG911986Ribosomal protein L32(6O'Callaghan B.L. Koo S.-H., Wu, Y. Freake H.C. Towle H.C. J. Biol. Chem. 2001; 276: 16033-16039Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar)U: AAACTGGCGGAAACCCAGAG D: GCAGCACTTCCAGCTCCTTG87785S14NewU: CAGGAGGTGACGCAGAAATAC D: GTGAGGTAAATACAGCGTCCC901785SREBP-1cNewU: ACGACGGAGCCATGGATTGCAC D: CCGGAAGGCAGGCTTGAGTACC9118881-a U, upstream; D, downstream.1-b Extension time is based on the calculation of product size (in bp)/25. Open table in a new tab To compare transcript expression levels between RNA isolated from hepatocytes treated with different conditions, a dilution series of total RNA from hepatocytes treated with high glucose and insulin was made and assayed in each LightCycler run as a standard curve. The LightCycler software was used to compare amplification in the experimental samples during the log-linear phase to this standard curve. Thus, results from experimental samples were expressed as a percentage of the high glucose with insulin RNA sample. Results from all transcripts were normalized to a control transcript coding for the large ribosomal subunit protein RPL32. Nuclear extracts were prepared using a modification of the procedure described previously (24Azzout-Marniche D. Becard D. Guichard C. Foretz M. Ferre P. Foufelle F. Biochem. J. 2000; 350: 389-393Crossref PubMed Scopus (235) Google Scholar). Briefly, seven 100-mm plates of cultured hepatocytes were scraped in PBS, combined, and pelleted at 1000 ×g for 3 min. The cell pellet was resuspended in 2 ml of lysis buffer (10 mm Tris/HCl, 0.3 m sucrose, 10 mm NaCl, 3 mm MgCl2, 0.5% Nonidet P40, 50 μg/ml calpain inhibitor I (Roche), 1 mm PMSF (Sigma), 2 μg/ml aprotinin (Sigma), and 10 μg/ml leupeptin (Sigma)). The mixture was homogenized on ice using a Teflon-on-glass homogenizer attached to a mechanical rotor set at 2800 rpm (Glas-Col, Terre Haute, IN). The homogenization was done in three sets of 20 strokes/set. Nuclei were pelleted by a 10-min centrifugation (500 × g) at 4 °C and washed once in the same buffer. The nuclear pellet was resuspended in 1 ml of hypertonic buffer (10 mm HEPES, pH 7.4, 0.42 m NaCl, 1.5 mm MgCl2, 2.5% glycerol, 1 mmEDTA, 1 mm EGTA, 1 mm dithiothreitol, and the same protease inhibitors listed in the lysis buffer). After 30 min on ice, the nuclear extract was obtained by centrifugation at 100,000 × g for 30 min at 4 °C. Protein content was determined spectrophotometrically using Bio-Rad protein assay reagent with bovine serum albumin as a standard. Protein from hepatocyte nuclear extracts (3 or 23 μg) was boiled in 0.2 m Tris/HCl, pH 6.8, 10% glycerol, 2% SDS, 100 mm dithiothreitol, 0.05% bromphenol blue and separated by SDS-PAGE on a 12% gel after a 5% stacking gel. Also loaded on the gel was a protein ladder (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) that is immunoreactive to the secondary antibody, allowing visualization of the ladder on the film. Proteins were electrotransferred onto an Immobilon-P PVDF 0.45-μm filter (Millipore, Bedford, MA). The filter was blocked in 50 mm Tris/HCl, pH 8.0, 80 mm NaCl, 2 mm CaCl2, 5% w/w dry milk, and 0.4% Nonidet P40; SREBP-1c was detected with a mouse monoclonal antibody (IgG-2A4) raised against amino acids 301–407 of human SREBP-1. IgGs were generated by a hybridoma cell line (ATCC, Manassas, VA) and purified from Dulbecco's modified Eagle's medium by a Protein A-Sepharose column. The primary antibody was used at a concentration of 4 μg/ml. Signals were detected using an ECL Western-blot detection kit (Amersham Biosciences) and anti-mouse horseradish peroxidase-conjugated IgG (Santa Cruz Biotechnology, Inc.) as the secondary antibody. To assess the contribution of SREBP-1c to lipogenic gene expression, we used an inducible recombinant adenovirus engineered to express the nuclear form of SREBP-1c. In this system, the recombinant adenoviral construct contains coding sequences for two proteins: the tet-activator protein and the nuclear form of SREBP-1c (23Trinh K. de Vargas L.M. Moss L.G. Newgard C.B. Diabetes. 1999; 48 Suppl. 1: A78Google Scholar). The inducer, doxycycline (a tetracycline analog), activates the constitutively expressed tet-activator protein that then binds to promoter sequences upstream of the adenoviral SREBP-1c gene to increase its expression. Endogenous SREBP-1c is synthesized as a 125-kDa precursor protein that is anchored in the endoplasmic reticulum membrane. Processing by two proteases occurs in the Golgi and generates the active form that is translocated to the nucleus (25Brown M.S. Goldstein J.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11041-11048Crossref PubMed Scopus (1110) Google Scholar). It is unclear whether insulin levels influence the processing of the precursor form of SREBP-1c (24Azzout-Marniche D. Becard D. Guichard C. Foretz M. Ferre P. Foufelle F. Biochem. J. 2000; 350: 389-393Crossref PubMed Scopus (235) Google Scholar). Therefore, we chose to express the amino-terminal portion of the SREBP-1c protein that would be directly targeted to the nucleus (26Nagoshi E. Imamoto N. Sato R. Yoneda Y. Mol. Biol. Cell. 1999; 10: 2221-2233Crossref PubMed Scopus (103) Google Scholar). Primary rat hepatocytes were transduced with adenovirus for 2 h at a dosage designed to infect >80% of cells (as compared with a β-galactosidase-containing virus of similar titer). When a higher dosage of virus was administered, there was no increase in SREBP-1c expression and toxic effects to the cells were observed. Hepatocytes were treated with fasting levels (5.5 mm) of glucose without insulin but with differing concentrations of the doxycycline inducer for 40 h. RNA was then isolated and subjected to RT-PCR using primers for the nuclear portion of the SREBP-1c mRNA. PCR products were visualized by ethidium bromide staining on an agarose gel (Fig. 1A). A dose-dependent increase in SREBP-1c mRNA accumulation was observed with these doxycycline concentrations. The range of SREBP-1c expression from no doxycycline treatment to treatment with 250 ng/ml doxycycline was ∼8-fold. In the absence of inducer, SREBP-1c expression from the adenovirus was elevated compared with the basal level present in hepatocytes maintained without insulin. Next, we wanted to find the doxycycline concentration that approximates the physiological level of endogenous SREBP-1c mRNA expression in hepatocytes treated with insulin. To do this, RNA from hepatocytes treated with 5.5 mm glucose and insulin for 40 h was subjected to RT-PCR along with the RNAs for the dose-response curve. The products on the gel were quantified by densitometric analysis. Based on this analysis, 25 ng/ml doxycycline was identified as the appropriate inducer concentration to give an exogenous mRNA level comparable with that observed following insulin induction of endogenous SREBP-1c mRNA (data not shown). To examine the time course of adenovirus-directed SREBP-1c expression, virus-treated hepatocytes were cultured in 100 ng/ml doxycycline (a high point on the dose-response curve) and 5.5 mm glucose without insulin and harvested for RNA at different time points. Virus-encoded mRNA begins to accumulate between 8 and 18 h with a maximal accumulation at 40 h after viral infection (Fig.1B). This high level of exogenous SREBP-1c expression was maintained for an additional 25 h. The 40-h time point was used in subsequent experiments. To demonstrate that the adenovirus-encoded nuclear SREBP-1c protein was appropriately translocated and accumulated in the nucleus, an immunoblot was performed (Fig. 2). In nuclear extracts of virus-transduced hepatocytes, a dose-dependent increase in the amount of SREBP-1c protein was observed in response to doxycycline treatment. However, efforts to detect the endogenous nuclear product were unsuccessful. Therefore, the adenoviral mRNA resulted in a significantly greater accumulation of protein compared with endogenous mRNA. Presumably, this is because of the fact that all of the virus-produced protein is directly targeted to the nucleus, whereas the endogenous mRNA is first translated into a precursor protein that must be proteolytically cleaved to generate the nuclear form. Instead of selecting a doxycycline concentration to approximate the amount of endogenous protein in response to insulin, we chose to look at the contribution of SREBP-1c to lipogenic gene induction by comparing expression levels at different doses of inducer. As described above, SREBP-1c has been identified as a major factor controlling lipogenic gene expression in response to nutritional stimuli. However, we have presented evidence for the involvement of an additional transcription factor (5Koo S.-H. Dutcher A.K. Towle H.C. J. Biol. Chem. 2001; 276: 9437-9445Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). To determine the relative contribution of SREBP-1c to the dietary induction of lipogenic genes, primary rat hepatocytes were infected with the adenovirus expression vector and then cultured in fasting levels of glucose without insulin, but with varying concentrations of doxycycline. In this experiment, adenovirus expression was established using 0, 25, or 250 ng/ml doxycycline to give a range of SREBP-1c expression. After 40 h of culture, RNA was isolated and subjected to real-time RT-PCR. RNA levels for lipogenic enzyme genes in cells exposed to exogenous SREBP-1c were compared with the levels from noninfected hepatocytes treated with fasting and high glucose (27.5 mm) levels with or without insulin. The first lipogenic mRNA examined was that for fatty acid synthase. FAS mRNA has been previously shown to be induced by insulin (27Paulauskis J.D. Sul H.S. J. Biol. Chem. 1989; 264: 574-577Abstract Full Text PDF PubMed Google Scholar,28Prip-Buus C. Perdereau D. Foufelle F. Maury J. Ferre P. Girard J. Eur. J. Biochem. 1995; 230: 309-315Crossref PubMed Scopus (88) Google Scholar). This effect is mediated at least in part by tandem SREBP-1c binding sites centered at −65 in the FAS promoter (29Magana M.M. Koo S.-H. Towle H.C. Osborne T.F. J. Biol. Chem. 2000; 275: 4726-4733Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). Indeed, hepatocytes treated with insulin alone exhibited a marked increase in FAS mRNA level in fasting glucose conditions (Fig.3A). However, when both insulin and high glucose were present in the hepatocyte medium, we observed a synergistic effect on the FAS mRNA level. Hepatocytes were transduced with the SREBP-1c adenoviral construct and maintained in fasting glucose levels without insulin. A modest increase in FAS mRNA accumulation was observed at the lowest levels of viral SREBP-1c expression. A further induction of FAS mRNA was seen in those cells treated with doxycycline to increase SREBP-1c expression. Hence, the increase in exogenous nuclear SREBP-1c levels resulted in additional FAS mRNA accumulation. However, even with the highest dose of doxycycline, equivalent to vast overexpression of SREBP-1c, the accumulation of FAS mRNA only reached ∼20% of that seen with noninfected cells treated with high glucose and insulin. These results indicate that SREBP-1c is indeed involved in the dietary induction of FAS mRNA, but that overexpression of SREBP-1c is insufficient by itself to account for the full induction observed in hepatocytes. Acetyl-CoA carboxylase, the first committed step in fatty acid synthesis, converts acetyl-CoA to malonyl-CoA. Several lines of evidence suggest a role for SREBP-1c in the regulation of ACC. In the livers of transgenic mice that overexpress SREBP-1c, there is a 2-fold increase in the mRNA levels of ACC (18Shimano H. Horton J.D. Shimomura I. Hammer R.E. Brown M.S. Goldstein J.L. J. Clin. Invest. 1997; 99: 846-854Crossref PubMed Scopus (688) Google Scholar, 19Shimomura I. Shimano H. Korn B.S. Bashmakov Y. Horton J.D. J. Biol. Chem. 1998; 273: 35299-35306Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar). Additionally, SREBP-1 knockout mice have an impaired ability to induce ACC mRNA when the animals are refed a high carbohydrate meal following a fast (16Shimano H. Yahagi N. Amemiya-Kudo M. Hasty A.H. Osuga J.-I. Tamura Y. Shionoiri F. Iizuka Y. Ohashi K. Harada K. Gotoda T. Ishihashi S. Yamada N. J. Biol. Chem. 1999; 274: 35832-35839Abstract Full Text Full Text PDF PubMed Scopus (583) Google Scholar). However, ACC mRNA does modestly accumulate following feeding in these animals, suggesting that an additional SREBP-1-independent mechanism may be involved. In cultured hepatocytes, insulin alone had very little, if any, effect on ACC mRNA levels in noninfected cells maintained in fasting levels of glucose (Fig. 3B). Glucose and insulin treatment in combination had a strong synergistic effect on ACC mRNA induction, even more striking than the effect on FAS mRNA. When cells transduced with the adenovirus vector were compared with untreated cells maintained in fasting glucose levels without insulin, there was a stepwise increase in ACC mRNA accumulation with increasing exogenous SREBP-1c expression. In this case, with the highest dose of doxycycline, the ACC mRNA level reached ∼5% of that seen with high glucose- and insulin-treated hepatocytes. As with FAS, these results suggest that SREBP-1c alone is insufficient for the full induction of ACC mRNA. S14 is a 17-kDa nuclear protein thought to be involved in the regulation of lipogenesis (30Cunningham B.A. Moncur J.T. Huntington J.T. Kinlaw W.B. Thyroid. 1998; 8: 815-825Crossref PubMed Scopus (77) Google Scholar). S14 mRNA is induced in mammalian liver following a high carbohydrate diet. Recent evidence has identified an SREBP-1c binding site at −131 in the S14promoter (31Mater M.K. Thelen A.P. Pan D.A. Jump D.B. J. Biol. Chem. 1999; 274: 32725-32732Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar). The ability of an S14 (−290 to +18) reporter construct to respond to insulin is abolished when this site is mutated (5Koo S.-H. Dutcher A.K. Towle H.C. J. Biol. Chem. 2001; 276: 9437-9445Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). S14 mRNA accumulates in cultured hepatocytes after treatment with insulin alone (Fig. 3C), but is induced further with the addition of high glucose. Similar to ACC, in low glucose conditions without insulin, S14mRNA accumulated stepwise with the increase in exogenous SREBP-1c expression. However, at the highest level of SREBP-1c expression, S14 mRNA levels reached only ∼10% of the level observed with high glucose and insulin treatment. Under fasting glucose levels without insulin, SREBP-1c expression alone is not capable of fully inducing S14, ACC, or FAS mRNA
Referência(s)