Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

The Insulin-like Growth Factor-binding Protein 1 Gene Is a Primary Target of Peroxisome Proliferator-activated Receptors

2006; Elsevier BV; Volume: 281; Issue: 51 Linguagem: Inglês

10.1074/jbc.m605623200

ISSN

1083-351X

Autores

Tatjana Degenhardt, Merja Matilainen, Karl‐Heinz Herzig, Thomas W. Dunlop, Carsten Carlberg,

Tópico(s)

Metabolism, Diabetes, and Cancer

Resumo

Insulin-like growth factor-binding protein 1 (IGFBP-1) is a biomarker for metabolic and hyperproliferative diseases. At the same time, the nuclear receptors peroxisome proliferator-activated receptors (PPARs) are known for their critical role in the development of both the metabolic syndrome and various cancers. Here we demonstrate, in human hepatocellular carcinoma cells and in normal mouse liver, that IGFBP-1 mRNA expression is under the primary control of PPAR ligands. We applied an improved in silico screening approach for PPAR response elements (PPREs) and identified five candidate PPREs located within 10 kb of the transcription start site (TSS) of the IGFBP-1 gene. Chromatin immunoprecipitation assays showed that, in living cells, the genomic region containing the most proximal PPRE, at position -1200 (relative to the TSS), preferentially associates with multiple PPAR subtypes and various other components of the transcriptional apparatus, which include their heterodimerizing partner, retinoid X receptor, as well as phosphorylated RNA polymerase II, co-repressor, co-activator, and mediator proteins. Moreover, further chromatin immunoprecipitation assays demonstrated that the TSS regions of the IGFBP-1 gene and those of the related IGFBP-2, -5, and -6, but not of IGFBP-3 and -4 genes, bind PPARs as well. We also show that these additional PPAR binding genes contain a number of candidate PPREs and that their mRNA levels respond quickly to the presence of PPAR ligands, indicating that they are also primary PPAR target genes. Insulin-like growth factor-binding protein 1 (IGFBP-1) is a biomarker for metabolic and hyperproliferative diseases. At the same time, the nuclear receptors peroxisome proliferator-activated receptors (PPARs) are known for their critical role in the development of both the metabolic syndrome and various cancers. Here we demonstrate, in human hepatocellular carcinoma cells and in normal mouse liver, that IGFBP-1 mRNA expression is under the primary control of PPAR ligands. We applied an improved in silico screening approach for PPAR response elements (PPREs) and identified five candidate PPREs located within 10 kb of the transcription start site (TSS) of the IGFBP-1 gene. Chromatin immunoprecipitation assays showed that, in living cells, the genomic region containing the most proximal PPRE, at position -1200 (relative to the TSS), preferentially associates with multiple PPAR subtypes and various other components of the transcriptional apparatus, which include their heterodimerizing partner, retinoid X receptor, as well as phosphorylated RNA polymerase II, co-repressor, co-activator, and mediator proteins. Moreover, further chromatin immunoprecipitation assays demonstrated that the TSS regions of the IGFBP-1 gene and those of the related IGFBP-2, -5, and -6, but not of IGFBP-3 and -4 genes, bind PPARs as well. We also show that these additional PPAR binding genes contain a number of candidate PPREs and that their mRNA levels respond quickly to the presence of PPAR ligands, indicating that they are also primary PPAR target genes. Lipid level dysregulation is a characteristic common to some of the most prevalent medical disorders, including obesity, cardiovascular disease, and type 2 diabetes (1Berger J.P. Akiyama T.E. Meinke P.T. Trends Pharmacol. Sci. 2005; 26: 244-251Abstract Full Text Full Text PDF PubMed Scopus (592) Google Scholar). Nuclear receptor transcription factors may have important roles to play in these diseases, because many of them have lipophilic compounds as ligands, including fatty acids and their metabolic derivatives (2Chawla A. Repa J.J. Evans R.M. Mangelsdorf D.J. Science. 2001; 294: 1866-1870Crossref PubMed Scopus (1677) Google Scholar), which appear to be important in either the normal functioning or a role in the disease process affecting the metabolic pathways. For example, native and oxidized polyunsaturated fatty acids as well as arachidonic acid derivatives, such as prostaglandins and prostacyclins, selectively bind the nuclear receptors peroxisome proliferator-activated receptors (PPARs) 3The abbreviations used are: PPAR, peroxisome proliferator-activated receptor; FBS, fetal bovine serum; ChIP, chromatin immunoprecipitation; CPT 1, carnitine palmitoyl transferase I; DR1, direct repeat spaced by one nucleotide; GW501516, 2-methyl-4-((4-methyl-2-(4-trifluoromethylphenyl)-1,3-thiazol-5-yl)methylsulfanyl)phenoxyacetic acid; GW7647, 2-(4-(2-(1-cyclohexanebutyl-3-cyclohexylureido)ethyl)phenylthio)-2-methylpropionic acid; IGF, insulin-like growth factor; IGFBP, IGF-binding protein; NCoR, nuclear co-repressor; PGC-1α, PPARγ co-activator 1α; pPol II, phosphorylated RNA polymerase II; PPRE, PPAR response element; RE, response element; rosiglitazone, 5-((4-(2-(methyl-2-pyridinylamino)ethoxy)phenyl)methyl)-2,4-thiazolidinedione; RXR, retinoid X receptor; TRAP220, thyroid hormone receptor-associated protein 220; TSS, transcription start site; VDR, vitamin D receptor. 3The abbreviations used are: PPAR, peroxisome proliferator-activated receptor; FBS, fetal bovine serum; ChIP, chromatin immunoprecipitation; CPT 1, carnitine palmitoyl transferase I; DR1, direct repeat spaced by one nucleotide; GW501516, 2-methyl-4-((4-methyl-2-(4-trifluoromethylphenyl)-1,3-thiazol-5-yl)methylsulfanyl)phenoxyacetic acid; GW7647, 2-(4-(2-(1-cyclohexanebutyl-3-cyclohexylureido)ethyl)phenylthio)-2-methylpropionic acid; IGF, insulin-like growth factor; IGFBP, IGF-binding protein; NCoR, nuclear co-repressor; PGC-1α, PPARγ co-activator 1α; pPol II, phosphorylated RNA polymerase II; PPRE, PPAR response element; RE, response element; rosiglitazone, 5-((4-(2-(methyl-2-pyridinylamino)ethoxy)phenyl)methyl)-2,4-thiazolidinedione; RXR, retinoid X receptor; TRAP220, thyroid hormone receptor-associated protein 220; TSS, transcription start site; VDR, vitamin D receptor. α, γ, and β/δ and stimulate their transcriptional activity (3Desvergne B. Michalik L. Wahli W. Mol. Endocrinol. 2004; 18: 1321-1332Crossref PubMed Scopus (184) Google Scholar). PPARs are prominent players in the metabolic syndrome, because they are important regulators of lipid storage and catabolism (4Willson T.M. Brown P.J. Sternbach D.D. Henke B.R. J. Med. Chem. 2000; 43: 527-550Crossref PubMed Scopus (1689) Google Scholar). However, PPARs also regulate cellular growth and differentiation and therefore have as well an impact on hyperproliferative diseases, such as cancer (5Michalik L. Desvergne B. Wahli W. Nat. Rev. Cancer. 2004; 4: 61-70Crossref PubMed Scopus (507) Google Scholar). PPARγ is the best characterized member of the subfamily due to its prominent role in the regulation of differentiation of cell types with active lipid metabolism, such as adipocytes and macrophage foam cells (6Walczak R. Tontonoz P. J. Lipid Res. 2002; 43: 177-186Abstract Full Text Full Text PDF PubMed Google Scholar, 7Rosen E.D. Spiegelman B.M. J. Biol. Chem. 2001; 276: 37731-37734Abstract Full Text Full Text PDF PubMed Scopus (1071) Google Scholar). The importance of this receptor in lipid homeostasis and energy balance is accentuated by the widespread use of synthetic PPARγ ligands, such as the thiazolidinediones rosiglitazone, troglitazone, and pioglitazone, as anti-diabetic drugs (8Lee C.H. Olson P. Evans R.M. Endocrinology. 2003; 144: 2201-2207Crossref PubMed Scopus (722) Google Scholar). In rodents a large number of significantly inducible PPAR target genes have been identified (9Yamazaki K. Kuromitsu J. Tanaka I. Biochem. Biophys. Res. Commun. 2002; 290: 1114-1122Crossref PubMed Scopus (103) Google Scholar, 10Frederiksen K.S. Wulff E.M. Sauerberg P. Mogensen J.P. Jeppesen L. Fleckner J. J. Lipid Res. 2004; 45: 592-601Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar), whereas in human cell lines only a few genes are activated more than 2-fold by PPAR ligands (11Vanden Heuvel J.P. Kreder D. Belda B. Hannon D.B. Nugent C.A. Burns K.A. Taylor M.J. Toxicol. Appl. Pharmacol. 2003; 188: 185-198Crossref PubMed Scopus (40) Google Scholar). An essential prerequisite for the direct modulation of transcription by PPAR ligands is the location of at least one activated PPAR protein close to the transcription start site (TSS) of the respective primary PPAR target gene. This is commonly achieved through the specific binding of PPARs to a PPAR response element (PPRE) (12Kersten S. Desvergne B. Wahli W. Nature. 2000; 405: 421-424Crossref PubMed Scopus (1654) Google Scholar). In detail, the DNA-binding domain of PPARs contact the major groove of a double-stranded hexameric DNA sequence with the optimal AGGTCA core binding sequence. PPARs bind to DNA as heterodimers with the nuclear receptor retinoid X receptor (RXR) (13Kliewer S.A. Umesono K. Noonan D.J. Heyman R.A. Evans R.M. Nature. 1992; 358: 771-774Crossref PubMed Scopus (1516) Google Scholar). PPREs are therefore formed by two hexameric core binding motifs in a direct repeat orientation with an optimal spacing of one nucleotide (DR1), where PPAR occupies the 5′ motif (14Jpenberg A. Jeannin E. Wahli W. Desvergne B. J. Biol. Chem. 1997; 272: 20108-20117Abstract Full Text Full Text PDF PubMed Scopus (282) Google Scholar). In the absence of ligand, co-repressor proteins, such as nuclear co-repressor (NCoR), link DNA-bound nuclear receptors to enzymes with histone deacetylase activity that cause chromatin condensation (15Krogsdam A.M. Nielsen C.A. Neve S. Holst D. Helledie T. Thomsen B. Bendixen C. Mandrup S. Kristiansen K. Biochem. J. 2002; 363: 157-165Crossref PubMed Scopus (82) Google Scholar). Binding of a ligand with agonistic properties to the nuclear receptors causes a conformational change within their ligand-binding domain that results in the replacement of co-repressors by co-activator proteins, such as receptor-associated co-activator 3 (16Molnar F. Matilainen M. Carlberg C. J. Biol. Chem. 2005; 280: 26543-26556Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar) or PPARγ co-activator 1α (PGC-1α) (17Vega R.B. Huss J.M. Kelly D.P. Mol. Cell Biol. 2000; 20: 1868-1876Crossref PubMed Scopus (930) Google Scholar). These co-activators link ligand-activated nuclear receptors to enzymes displaying histone acetyltransferase activity that cause chromatin relaxation and thereby reverse the action of unliganded nuclear receptors. In a subsequent step, ligand-activated nuclear receptors exchange rapidly co-activator proteins for components of mediator complexes, such as thyroid hormone receptor-associated protein (TRAP)220/Med1 (18Yuan C.-X. Ito M. Fondell J.D. Fu Z.-Y. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 7939-7944Crossref PubMed Scopus (389) Google Scholar), which act as a bridge from the activated nuclear receptors to the basal transcriptional machinery. In this way ligand-activated nuclear receptors execute two tasks, the modification of chromatin and the regulation of transcription. IGFBPs are a family of proteins that are multifunctional, having insulin-like growth factor (IGF)-independent actions as well as regulation of IGFs activity (19Firth S.M. Baxter R.C. Endocr. Rev. 2002; 23: 824-854Crossref PubMed Scopus (1431) Google Scholar). The primary endocrine roles of IGFBP-1 appear to be the inhibition of the availability of IGFs as well as their hypoglycemic effect (20Lewitt M.S. Diabetes Res. Clin. Pract. 1994; 23: 3-15Abstract Full Text PDF PubMed Scopus (53) Google Scholar, 21Mortensen D.L. Won W.B. Siu J. Reifsnyder D. Gironella M. Etcheverry T. Clark R.G. Endocrinology. 1997; 138: 2073-2080Crossref PubMed Scopus (27) Google Scholar). In addition, hepatic IGFBP-1 may play a paracrine role as a survival factor independently of IGFs, reducing the level of pro-apoptotic signals in liver (22Leu J.I. Crissey M.A. Taub R. J. Clin. Invest. 2003; 111: 129-139Crossref PubMed Scopus (108) Google Scholar). Recently, it was found that in the absence of insulin IGFBP-1 protein levels were induced 1.6-fold after the application of PPARγ ligands (23Seto-Young D. Paliou M. Schlosser J. Avtanski D. Park A. Patel P. Holcomb K. Chang P. Poretsky L. J. Clin. Endocrinol. Metab. 2005; 90: 6099-6105Crossref PubMed Scopus (96) Google Scholar). The importance of nuclear receptors in the regulation of this gene is further supported by the fact that we have shown it to be a primary target of 1α, 25-dihydroxyvitamin D3 and its nuclear receptor, the vitamin D receptor (VDR) (24Matilainen M. Malinen M. Saavalainen K. Carlberg C. Nucleic Acids Res. 2005; 33: 5521-5532Crossref PubMed Scopus (84) Google Scholar). In addition, an up-regulation of the IGFBP-1 gene by troglitazone could also be mediated by another nuclear receptor, the pregnane X receptor (25Hilding A. Hall K. Skogsberg J. Ehrenborg E. Lewitt M.S. Biochem. Biophys. Res. Commun. 2003; 303: 693-699Crossref PubMed Scopus (14) Google Scholar). In this study, we demonstrate that the IGFBP-1 gene is a primary PPAR target in HepG2 human hepatocellular carcinoma cells as well as in normal mouse liver. We applied an improved in silico screening approach for DR1-type response elements (REs) and identified five candidate PPREs within 10 kb of the IGFBP-1 gene TSS. Chromatin immunoprecipitation (ChIP) assays showed that in living cells only the genomic region containing the most proximal PPRE (at position -1200) associated with PPARs as well as with their nuclear partners RXR, phosphorylated RNA polymerase II (pPol II), NCoR, receptor-associated co-activator 3, PGC-1α, and TRAP220. A second PPRE (at position -9400) showed also an association with PPARs and RXR. ChIP assays demonstrated that the PPARs are located on TSS regions of the IGFBP-1 gene and those of the related genes IGFBP-2, -5, and -6 but not on those of the genes IGFBP-3 and -4. The genes IGFBP-2, -5, and -6 each contain a number of candidate PPREs and responded in HepG2 and HEK293 human embryonal kidney cells to PPAR ligands. This suggests that they are also primary PPAR target genes. Cell Culture and in Vivo Experiments—The human hepatocellular liver carcinoma cell line HepG2 and the human embryonal kidney cell line HEK293 were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS), 2 mm l-glutamine, 0.1 mg/ml streptomycin, and 100 units/ml penicillin in a humidified 95% air/5% CO2 incubator. Before use, FBS was stripped of lipophilic compounds, such as endogenous nuclear receptor ligands, by stirring it with 5% activated charcoal (Sigma-Aldrich) for 3 h at room temperature. Charcoal was then removed by centrifugation and sterile filtration. Prior to mRNA or chromatin extraction, cells were grown overnight in phenol red-free DMEM supplemented with 5% charcoal-stripped FBS to reach a density of 50-60% confluency. Cells were then treated with either solvent (Me2SO, 0.1% final concentration) or 100 nm of the PPARα agonist GW7647, 100 nm of the PPARγ agonist rosiglitazone or 100 nm of the PPARβ/δ agonist GW501516. GW7647 and GW501516 were purchased from Alexis Biochemicals (San Diego, CA), whereas rosiglitazone was kindly provided by Dr. Mogens Madsen (Leo Pharma, Ballerup, Denmark). The ligands were dissolved in Me2SO. 8-Week-old male BALB/c × DAB2 mice (National Laboratory Animal Center, Kuopio, Finland) were housed in stainless steel metabolic cages under controlled temperature (21-23 °C) and light conditions (lights on 7 a.m. to 7 p.m.). Mice had free access to water and diet ad libitum (Altromin, Lage, Germany) for 14 days prior to initiation of treatment. All experiments were approved by the Committee for the Welfare of Laboratory Animals at the University of Kuopio and conducted in accordance with the guidelines of the European Community Council directives 86/609/EEC. GW501516 was administered in saline by intraperitoneal injection (1 μg/g body weight). After 3 and 6 h the animals were sacrificed, and their livers were removed and shock frozen in liquid nitrogen. RNA Extraction and Real-time Quantitative PCR—Total RNA was extracted using the Mini RNA Isolation II kit (Zymo Research, HiSS Diagnostics, Freiburg, Germany). For tissues, the samples were pre-homogenized in lysing matrix A tubes (Bio 101, Vista, CA) using a Fast Prep FP120 machine (Savant Instruments, Holbrook, NY). Samples were processed twice for 40 s at setting 6.0 with a 10-min cooling interval on ice. Afterward, the samples were cooled on ice for 10 min, spun down for 1 min at 2000 rpm in a bench-top centrifuge, and 600 μl of the cleared supernatant was transferred to the Mini RNA isolation kit columns for RNA extraction. The RNA was subsequently purified and eluted according to the manufacturer's instructions (Zymo Research). From all RNA sources, cDNA synthesis was performed for 1 h at 37°C using 1 μg of total RNA as a template, 100 pmol of oligo(dT18) primer, and 40 units of reverse transcriptase (Fermentas, Vilnius, Lithuania) in a 40-μl volume. Real-time quantitative PCR was performed in an IQ-cycler (Bio-Rad) using the dye Sybr Green I (Molecular Probes, Leiden, The Netherlands). Per reaction, 4 μl of the 1:10 dilution of the above cDNA, 1 unit of Hot Start Taq polymerase (Fermentas), and 3 mm MgCl2 were used, and the PCR cycling conditions were: 45 cycles of 30 s at 95 °C, 30 s at 62 °C, and 40 s at 72 °C. The sequences of the gene-specific primer pairs for the human and mouse IGFBP genes, the reference gene carnitine palmitoyl transferase 1 (CPT 1), and the internal control gene acidic riboprotein P0 (ARP0, Arbp in mouse) are listed in supplemental Tables S1 and S2. PCR product quality was monitored using post-PCR melt curve analysis. The -fold inductions (Figs. 1 and 6, C-E) were calculated using 2-(ΔΔCt), where ΔΔCt is the ΔCt(PPAR ligand)-ΔCtMe2SO), ΔCt is Ct(IGFBPn or CPT 1) - Ct(ARP0), and Ct is the cycle at which the threshold is crossed. Relative mRNA expression levels (Fig. 6, A and B) were calculated using 2-(ΔCt).FIGURE 6Expression profiling of the IGFBP gene family. Real-time quantitative PCR was used to determine the basal mRNA expression of the three PPAR genes and the six IGFBP genes, relative to the control gene ARP0, in HepG2 and HEK293 cells (A) and in mouse liver (B). A logarithmic scale is employed on the y-axis to better present the data. In the same two cell lines and in the mouse liver the inducibility of the genes IGFBP-2 to -6 was tested. The established PPAR target gene CPT 1 served as a positive control. HepG2 and HEK293 cells were stimulated for 2, 4, and 6 h with 100 nm GW7647 (α), 100 nm rosiglitazone (γ), or 100 nm GW501516 (β/δ). Mice were injected intraperitoneally with 1 mg/kg (of body weight) GW501516 and livers were taken after 3- and 6-h exposures. Data points (A and B) and columns (C-E) represent the means of at least three independent treatments, and the bars represent standard deviations (in A and B they were too small to be displayed). Dashed lines indicate the threshold of 2-fold up- or down-regulation. Two-tailed Student's t tests were performed to determine the significance of the mRNA induction by PPAR agonists in reference to solvent controls (*, p < 0.05; **, p < 0.01; and ***, p < 0.001). ND, non-detectable.View Large Image Figure ViewerDownload Hi-res image Download (PPT) DNA Constructs—Full-length cDNAs for human PPARα (26Sher T. Yi H.-F. McBride O.W. Gonzalez F.J. Biochemistry. 1993; 32: 5598-5604Crossref PubMed Scopus (447) Google Scholar), human PPARβ/δ (27Schmidt A. Endo N. Rutledge S.J. Vogel R. Shinar D. Rodan G.A. Mol. Endocrinol. 1992; 6: 1634-1641Crossref PubMed Scopus (366) Google Scholar), human PPARγ (28Tontonoz P. Hu E. Spiegelman B.M. Cell. 1994; 79: 1147-1156Abstract Full Text PDF PubMed Scopus (3098) Google Scholar), and human RXRα (29Mangelsdorf D.J. Ong E.S. Dyck J.A. Evans R.M. Nature. 1990; 345: 224-229Crossref PubMed Scopus (1256) Google Scholar) were subcloned into the T7/SV40 promoter-driven pSG5 expression vector (Stratagene, La Jolla, CA). The same constructs were used for both T7 RNA polymerase-driven in vitro transcription/translation of the respective cDNAs and for viral promoter-driven overexpression in mammalian cells. Promoter regions of the IGFBP-1 gene (-9536 to -9253 and -1468 to -1002) and of the CPT 1 gene (-306 to -64) were cloned by PCR from human genomic DNA and were fused with the thymidine kinase promoter driving the firefly luciferase reporter gene. Point mutations to the PPREs within the promoter constructs were generated using the QuikChange sitedirected mutagenesis kit (Stratagene) according to the manufacturer's instructions. In REs 1 and 2 of the IGFBP-1 gene each sixth position was changed from A to G, whereas in the CPT 1 gene the seventh position of the PPRE was mutated from A to T. All constructs were verified by sequencing. Gel-shift Assays—In vitro translated PPAR subtype and RXRα proteins were generated by coupled in vitro transcription/translation using their respective pSG5-based full-length cDNA expression constructs and rabbit reticulocyte lysate as recommended by the supplier (Promega, Madison, WI). Protein batches were quantified by test-translations in the presence of [35S]methionine. Gel-shift assays were performed with 10 ng of the appropriate in vitro translated proteins. The proteins were incubated for 15 min in a total volume of 20 μl of binding buffer (150 mm KCl, 1 mm dithiothreitol, 25 ng/ml herring sperm DNA, 5% glycerol, 10 mm Hepes, pH 7.9). Constant amounts (1 ng) of 32P-labeled double-stranded oligonucleotides (50,000 cpm) containing one copy of the respective REs (Table 1 and supplemental Table S3) were then added, and incubation was continued for 20 min at room temperature. Protein-DNA complexes were resolved by electrophoresis through 8% non-denaturing polyacrylamide gels (mono- to bisacrylamide ratio 19:1) in 0.5× TBE (45 mm Tris, 45 mm boric acid, 1 mm EDTA, pH 8.3) for 90 min at 200 V and quantified on a FLA-3000 reader (Fuji, Tokyo, Japan) using ScienceLab99 software (Fuji).TABLE 1Candidate PPREs of the human IGFBP-1 geneResponse elementLocationaRelative to the TSS.SequenceClass variationPPARαPPARγPPARβ/δRE1−9446CAAGTTCAAAGTTTA1 × I, 2 × II2 × I, 1 × II2 × I, 1 × IIRE2−1178CCAGGTCAAAGTCAC2 × I, 2 × II4 × I1 × I, 3 × IIRE3+3601CAGGGTGAAAGGGAC1 × I, 2 × II3 × I3 × IIRE4+7059CAGGTCCAAAGGGCA3 × II2 × I, 1 × II1 × I, 2 × IIRE5+8574TTAGGGGAAAGGGAA1 × I, 2 × II3 × I1 × I, 2 × IIa Relative to the TSS. Open table in a new tab ChIP Assays—Nuclear proteins were cross-linked to genomic DNA by adding formaldehyde for 10 min directly to the medium to a final concentration of 1% at room temperature. Cross-linking was stopped by adding glycine to a final concentration of 0.125 m and incubating for 5 min at room temperature on a rocking platform. The medium was removed, and the cells were washed twice with ice-cold phosphate-buffered saline (140 mm NaCl, 2.7 mm KCl, 1.5 mm KH2PO4, 8.1 mm Na2HPO4·2H2O). The cells were collected by scraping into ice-cold phosphate-buffered saline containing Complete™ protease inhibitor mixture (Roche Diagnostics, Mannheim, Germany). After centrifugation the cell pellets were resuspended in lysis buffer (1% SDS, 10 mm EDTA, protease inhibitors, 50 mm Tris-HCl, pH 8.1), and the lysates were sonicated to result in DNA fragments of 300-1000 bp in length. Cellular debris was removed by centrifugation, and the lysates were diluted 1:10 in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm NaCl, protease inhibitors, 16.7 mm Tris-HCl, pH 8.1). The samples were centrifuged, and the recovered chromatin solutions were incubated with 5 μl of indicated antibodies and 20 μl of sonicated salmon sperm (0.1 mg/ml) to remove unspecific background overnight at 4 °C with rotation. The antibodies against PPARα (sc-9000), PPARγ (sc-7196), PPARβ/δ (sc-7197), RXRα (sc-553), NCoR (sc-8994), RAC-3 (sc-7216), PGC-1α (sc-13067), TRAP220 (sc-5334), phosphorylated RNA polymerase II (pPol II, sc-13583), and control IgGs (sc-2027) were obtained from Santa Cruz Biotechnology (Heidelberg, Germany). The immunocomplexes were collected with 60 μl of protein A-agarose slurry (Upstate Biotechnology, Lake Placid, NY) for 1 h at 4°C with rotation. The beads were pelleted by centrifugation for 1 min at 4 °C at 100 × g and washed sequentially for 5 min by rotation with 1 ml of the following buffers: low salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 150 mm NaCl, 20 mm Tris-HCl, pH 8.1), high salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 500 mm NaCl, 20 mm Tris-HCl, pH 8.1), and LiCl wash buffer (0.25 mm LiCl, 1% Nonidet P-40, 1% sodium deoxycholate, 1 mm EDTA, 10 mm Tris-HCl, pH 8.1). Finally, the beads were washed twice with 1 ml of TE buffer (1 mm EDTA, 10 mm Tris-HCl, pH 8.0). The immunocomplexes were then eluted by adding 250 μl of elution buffer (1% SDS, 100 mm NaHCO3) and incubated for 15 min at room temperature with rotation. After centrifugation, the supernatant was collected, and the elution was repeated. The supernatants were combined, and the cross-linking was reversed by adding NaCl to a final concentration of 200 mm and incubated overnight at 65 °C. The remaining proteins were digested by adding proteinase K (final concentration, 40 μg/ml) and incubation for 1 h at 45°C. Genomic DNA fragments were recovered by phenol-chloroform extraction, followed by a salt-ethanol precipitation and subsequent resuspension in sterile H2O. PCR of Chromatin Templates—For each of the five candidate RE-containing genomic regions and the control region of the IGFBP-1 gene as well as for the TSS of all six IGFBP genes, specific primer pairs were designed (Table 2), optimized, and controlled by running PCR reactions with 25 ng of genomic DNA (input) as a template. When running immunoprecipitated DNA (output) as a template, the following PCR profile was used: preincubation for 5 min at 95 °C, 50 cycles of 30 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C and one final incubation for 10 min at 72 °C. The PCR products were separated by electrophoresis through 2% agarose gels. Gel images were scanned on a FLA3000 reader using ScienceLab99 software.TABLE 2Genomic PCR primersRegion (gene)LocationaRelative to the TSS.Primer sequences (5′-3′)1 (IGFBP-1)−9536 to −9253GAGCTGATGCTATTAGAAGCAGGAAGATGAGGGAAAGTTGAGAAC2 (IGFBP-1)−1197 to −1002GATCCACCGTTATAGCCTCTGCACCATCTTTGCCTCCCATTC3 (IGFBP-1)+3498 to +3691CACAGGAGACATCAGGAGAAGGTGGATCTGGCTCAATACAAC4 (IGFBP-1)+6997 to +7370CTCTTCTAGTATGCTGAGGCTCCAGGGAACATGTGTGGGAATTG5 (IGFBP-1)+8341 to +8690CTACTCATTGACTGAAGTGCTCAGATGGTGTTTGTTTACATGControl (IGFBP-1)−8869 to −8377CAATTAGGAACTGCCCTCATGGACGTTATCATGTTTGCAGATTCTSS (IGFBP-1)−100 to +153GAACACTCAGCTCCTAGCGTGCTGACATCTCCAGGCGCGAGTSS (IGFBP-2)−62 to +117GAAGGGAGTGGTCTCCAAAAGCACTCTCGGCAGCATGCTGTSS (IGFBP-3)−129 to +92GAGCAGCACCAGCAGAGTCCAGGGATGGGGCGACAGTACTSS (IGFBP-4)−41 to +118CACCTCTGGGAAGGCGCTGGTTAGCAGGCGTGCCGGAGTSS (IGFBP-5)−32 to +92GTTCTACGCGAAGTCCGGAGCTCCTTGGCATCCTTGCCTGTSS (IGFBP-6)−159 to +18CTGGAAAGGGAGAGGGAAAGCAGAGCAGTCGCAGCGCAGa Relative to the TSS. Open table in a new tab Transfection and Luciferase Reporter Gene Assays—HepG2 cells were seeded into 6-well plates (105 cells/ml) and grown overnight in phenol red-free DMEM supplemented with 5% charcoal-stripped FBS. Polyethyleneimine transfections were performed by incubating a reporter plasmid and the expression vector for human PPARα, PPARγ, or PPARβ/δ (each 1 μg) with 50 μl of 150 mm NaCl for 15 min at room temperature. Simultaneously, 10 μg of polyethyleneimine (Sigma-Aldrich) in 50 μl of 150 mm NaCl was incubated for 15 min at room temperature. The two solutions were then combined and incubated for additional 15 min at room temperature. After dilution with 900 μl of phenol red-free DMEM, the mixture was added to the cells. 500 μl of phenol red-free DMEM, supplemented with 15% charcoal-stripped FBS, and the ligands were added 4 h after transfection. The cells were lysed 16 h later using reporter gene lysis buffer (Roche Diagnostics). The constant light signal luciferase reporter gene assay was performed as recommended by the supplier (Canberra-Packard, Groningen, The Netherlands). Luciferase activities were normalized with respect to protein concentration, and induction factors were calculated as the ratio of luciferase activity of ligand-stimulated cells to that of solvent controls. IGFBP-1 Is a Primary PPAR Target Gene—RNA was extracted from HepG2 cells treated for 2, 4, and 6 h with 100 nm each of either the PPARα agonist GW7647, or the PPARγ agonist rosiglitazone or the PPARβ/δ agonist GW501516. These early time points were chosen to detect primary effects of the PPAR ligands. The relative -fold induction of the mRNA amounts of the IGFBP-1 gene and of the known PPAR target gene CPT 1 were determined by real-time quantitative PCR (Fig. 1A). Interestingly, all three PPAR subtype-specific ligands were found to stimulate significantly IGFBP-1 mRNA expression. After 4 h the maximal mRNA induction factors were 2.1- to 2.9-fold. For the reference gene CPT 1 comparable stimulations of 1.6- to 2.8-fold were measured, but these maxima were reached 2 h later than with the IGFBP-1 gene. With the chosen ligand concentrations the pregnane X receptor was not activated (data not shown), and therefore we can exclude pregnane X receptor-dependent effects of rosiglitazone (25Hilding A. Hall K. Skogsberg J. Ehrenborg E. Lewitt M.S. Biochem. Biophys. Res. Commun. 2003; 303: 693-699Crossref PubMed Scopus (14) Google Scholar). The most responsive PPAR ligand, GW501516, was chosen for an in vivo experiment, in which 1 mg/kg body weight of the compound was injected intraperitoneally into mice (Fig. 1B). Livers were taken 3 and 6 h after ligand application

Referência(s)