The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in Anti-HER2 Antibody-induced G1 Cell Cycle Arrest and Tumor Growth Inhibition
2003; Elsevier BV; Volume: 278; Issue: 26 Linguagem: Inglês
10.1074/jbc.m300848200
ISSN1083-351X
AutoresXiao-Feng Le, François-Xavier Claret, Amy Lammayot, Ling Tian, Deepa Deshpande, Ruth LaPushin, Ana M. Tari, Robert C. Bast,
Tópico(s)Advanced Breast Cancer Therapies
ResumoCyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E·CDK2 complex and plays a major role in controlling cell cycle and cell growth. Our group and others have reported that anti-HER2 monoclonal antibodies exert inhibitory effects on HER2-overexpressing breast cancers through G1 cell cycle arrest associated with induction of p27Kip1 and reduction of CDK2. The role of p27Kip1 in anti-HER2 antibody-induced cell cycle arrest and growth inhibition is, however, still uncertain. Here we have provided several lines of evidence supporting a critical role for p27Kip1 in the anti-HER2 antibody-induced G1 cell cycle arrest and tumor growth inhibition. Induction of p27Kip1 and G1 growth arrest by anti-HER2 antibody, murine 4D5, or humanized trastuzumab (Herceptin®) are concentration-dependent, time-dependent, irreversible, and long-lasting. The magnitude of G1 cell cycle arrest induced by trastuzumab or 4D5 is well correlated with the level of p27Kip1 protein induced. Up-regulation of p27Kip1 and G1 growth arrest could no longer be removed with as little as 14 h of treatment with trastuzumab. Anti-HER2 antibody-induced p27Kip1 protein, G1 arrest, and growth inhibition persist at least 5 days after a single treatment. The magnitude of growth inhibition of breast cancer cells induced by anti-HER2 antibody closely parallels the level of p27Kip1 induced. Induced expression of exogenous p27Kip1 results in a p27Kip1 level-dependent G1 cell cycle arrest and growth inhibition similar to that obtained with anti-HER2 antibodies. Reducing p27Kip1 expression using p27Kip1 small interfering RNA blocks anti-HER2 antibody-induced p27Kip1 up-regulation and G1 arrest. Treatment with anti-HER2 antibody significantly increases the half-life of p27Kip1 protein. Inhibition of ubiquitin-proteasome pathway, but not inhibition of calpain and caspase activities, up-regulates p27Kip1 protein to a degree comparable with that obtained with anti-HER2 antibodies. We have further demonstrated that anti-HER2 antibody significantly decreases threonine phosphorylation of p27Kip1 protein at position 187 (Thr-187) and increases serine phosphorylation of p27Kip1 protein at position 10 (Ser-10). Expression of S10A and T187A mutant p27Kip1 protein increases the fraction of cells in G1 and reduces a further antibody-induced G1 arrest. Consequently, p27Kip1 plays an important role in the anti-HER2 antibody-induced G1 cell cycle arrest and tumor growth inhibition through post-translational regulation. Regulation of the phosphorylation of p27Kip1 protein is one of the post-translational mechanisms by which anti-HER2 antibody upregulates the protein. Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E·CDK2 complex and plays a major role in controlling cell cycle and cell growth. Our group and others have reported that anti-HER2 monoclonal antibodies exert inhibitory effects on HER2-overexpressing breast cancers through G1 cell cycle arrest associated with induction of p27Kip1 and reduction of CDK2. The role of p27Kip1 in anti-HER2 antibody-induced cell cycle arrest and growth inhibition is, however, still uncertain. Here we have provided several lines of evidence supporting a critical role for p27Kip1 in the anti-HER2 antibody-induced G1 cell cycle arrest and tumor growth inhibition. Induction of p27Kip1 and G1 growth arrest by anti-HER2 antibody, murine 4D5, or humanized trastuzumab (Herceptin®) are concentration-dependent, time-dependent, irreversible, and long-lasting. The magnitude of G1 cell cycle arrest induced by trastuzumab or 4D5 is well correlated with the level of p27Kip1 protein induced. Up-regulation of p27Kip1 and G1 growth arrest could no longer be removed with as little as 14 h of treatment with trastuzumab. Anti-HER2 antibody-induced p27Kip1 protein, G1 arrest, and growth inhibition persist at least 5 days after a single treatment. The magnitude of growth inhibition of breast cancer cells induced by anti-HER2 antibody closely parallels the level of p27Kip1 induced. Induced expression of exogenous p27Kip1 results in a p27Kip1 level-dependent G1 cell cycle arrest and growth inhibition similar to that obtained with anti-HER2 antibodies. Reducing p27Kip1 expression using p27Kip1 small interfering RNA blocks anti-HER2 antibody-induced p27Kip1 up-regulation and G1 arrest. Treatment with anti-HER2 antibody significantly increases the half-life of p27Kip1 protein. Inhibition of ubiquitin-proteasome pathway, but not inhibition of calpain and caspase activities, up-regulates p27Kip1 protein to a degree comparable with that obtained with anti-HER2 antibodies. We have further demonstrated that anti-HER2 antibody significantly decreases threonine phosphorylation of p27Kip1 protein at position 187 (Thr-187) and increases serine phosphorylation of p27Kip1 protein at position 10 (Ser-10). Expression of S10A and T187A mutant p27Kip1 protein increases the fraction of cells in G1 and reduces a further antibody-induced G1 arrest. Consequently, p27Kip1 plays an important role in the anti-HER2 antibody-induced G1 cell cycle arrest and tumor growth inhibition through post-translational regulation. Regulation of the phosphorylation of p27Kip1 protein is one of the post-translational mechanisms by which anti-HER2 antibody upregulates the protein. HER2 (human epidermal growth factor receptor 2; also known as c-neu or ErbB-2) is a key member in the epidermal growth factor receptor family (1Harari D. Yarden Y. Oncogene. 2000; 19: 6102-6114Google Scholar, 2Stern D.F. Breast Cancer Res. 2000; 2: 176-183Google Scholar, 3Yarden Y. Sliwkowski M.X. Nat. Rev. Mol. Cell. Biol. 2001; 2: 127-137Google Scholar, 4Mendelsohn J. Baselga J. Oncogene. 2000; 19: 6550-6565Google Scholar). HER2, as a preferred heterodimer partner for other members in epidermal growth factor receptor family, plays a critical role in epidermal growth factor receptor family signaling that is linked to a variety of cellular responses to growth factors in both normal and abnormal conditions (1Harari D. Yarden Y. Oncogene. 2000; 19: 6102-6114Google Scholar, 2Stern D.F. Breast Cancer Res. 2000; 2: 176-183Google Scholar, 3Yarden Y. Sliwkowski M.X. Nat. Rev. Mol. Cell. Biol. 2001; 2: 127-137Google Scholar, 4Mendelsohn J. Baselga J. Oncogene. 2000; 19: 6550-6565Google Scholar). When HER2 is overexpressed in cells, normal signaling pathways are altered, and growth control is deregulated. HER2 is overexpressed in a number of cancers, including breast, ovarian, gastric, colon, and non-small cell lung carcinomas (4Mendelsohn J. Baselga J. Oncogene. 2000; 19: 6550-6565Google Scholar, 5Pegram M.D. Slamon D.J. Cancer Treat. Res. 2000; 103: 57-75Google Scholar). A humanized monoclonal antibody trastuzumab or Herceptin® has been developed from the murine anti-HER2 monoclonal antibody 4D5. Trastuzumab has been successfully used in clinics to treat patients with metastatic breast cancers that overexpress HER2 (4Mendelsohn J. Baselga J. Oncogene. 2000; 19: 6550-6565Google Scholar, 5Pegram M.D. Slamon D.J. Cancer Treat. Res. 2000; 103: 57-75Google Scholar). Trastuzumab treatment can produce a response rate of 10–15% as a single agent in heavily pre-treated patients with metastatic breast cancers that overexpress HER2 (6Cobleigh M. Vogel C. Tripathy D. Robert N.J. Scholl S. Fehrenbacher L. Wolter J.M. Paton V. Shak S. Lieberman G. Slamon D.J. J. Clin. Oncol. 1999; 17: 2639-2648Google Scholar). Trastuzumab treatment produces a response rate of 25% as a single agent in first-line management of patients with HER2 positive metastatic breast cancer (7Vogel C. Cobleigh M. Tripathy D. Gutheil J.C. Harris L.N. Fehrenbacher L. Slamon D.J. Murphy M. Novotny W.F. Burchmore M. Shak S. Stewart S.J. Press M. J. Clin. Oncol. 2002; 20: 719-726Google Scholar). Trastuzumab has further been shown to enhance significantly the effectiveness of chemotherapy in patients whose tumors overexpress HER2 (4Mendelsohn J. Baselga J. Oncogene. 2000; 19: 6550-6565Google Scholar, 5Pegram M.D. Slamon D.J. Cancer Treat. Res. 2000; 103: 57-75Google Scholar). The combination of chemotherapy plus trastuzumab has a much higher rate of response than chemotherapy alone (50 versus 32%) (8Slamon D. Leyland-Jon B. Shak S. Fuchs H. Paton V. Bajamonde A. Fleming T. Eiermann W. Wolter J. Pagrem M. Baselga J. Norton L. N. Engl. J. Med. 2001; 344: 783-792Google Scholar). The combination of trastuzumab and chemotherapy also improve the time to disease progression (7.4 versus 4.6 months) and the median response duration (9.1 versus 6.1 months) when compared with chemotherapy alone (8Slamon D. Leyland-Jon B. Shak S. Fuchs H. Paton V. Bajamonde A. Fleming T. Eiermann W. Wolter J. Pagrem M. Baselga J. Norton L. N. Engl. J. Med. 2001; 344: 783-792Google Scholar). The mechanisms by which trastuzumab affects growth of cancer cells and response to chemotherapy are not well understood. One of the intracellular growth regulators that are affected by trastuzumab is cyclin-dependent kinase (CDK) 1The abbreviations used are: CDK, cyclin-dependent kinase; hIgG, human IgG1; PBS, phosphate-buffered saline; GFP, green fluorescent protein; Adp27, adenovirus-p27Kip1; SiRNA, small interfering RNA. 1The abbreviations used are: CDK, cyclin-dependent kinase; hIgG, human IgG1; PBS, phosphate-buffered saline; GFP, green fluorescent protein; Adp27, adenovirus-p27Kip1; SiRNA, small interfering RNA. inhibitor p27Kip1. p27Kip1, as one of the most important CDK inhibitors during cell cycle G1 phase, binds to the cyclin E·CDK2 complex and plays a major role in controlling cell cycle (9Sherr C.J. Roberts J.M. Genes Dev. 1999; 13: 1501-1512Google Scholar). An increase in p27Kip1 protein causes proliferating cells to exit from the cell cycle, whereas a decrease in p27Kip1 protein promotes quiescent cells to resume cell proliferation. p27Kip1 protein is primarily regulated post-transcriptionally at the level of both protein translation and protein stability, although transcriptional regulation and non-covalent sequestration may also occur (9Sherr C.J. Roberts J.M. Genes Dev. 1999; 13: 1501-1512Google Scholar, 10Philipp-Staheli J. Payne S.R. Kemp C.J. Exp. Cell Res. 2001; 264: 148-168Google Scholar, 11Hengst L. Reed S.I. Science. 1996; 271: 1861-1864Google Scholar). Among the post-transcriptional mechanisms, ubiquitin-proteasome proteolysis is a major pathway for regulation of p27Kip1 protein (12Pagano M. Tam S.W. Theodoras A.M. Beer-Romero P. Del Sal G. Chau V. Yew P.R. Draetta G.F. Rolfe M. Science. 1995; 269: 682-685Google Scholar). Phosphorylation of p27Kip1 protein on threonine 187 (Thr-187) by CDK2 prepares p27Kip1 protein for binding to ubiquitin ligase SCFSkp2 that leads to 26 S proteasome degradation (13Vlach J. Hennecke S. Amati B. EMBO J. 1997; 16: 5334-5344Google Scholar, 14Harper J.W. Curr. Biol. 2001; 11: R431-R-435Google Scholar, 15DeSalle L.M. Pagano M. FEBS Lett. 2001; 490: 179-189Google Scholar). In contrast to the phosphorylation of Thr-187, the phosphorylation of p27Kip1 protein on serine 10 (Ser-10) by human kinase interacting stathmin stabilizes p27Kip1 protein in G1 (16Ishida N. Kitagawa M. Hatakeyama S. Nakayama K. J. Biol. Chem. 2000; 275: 25146-25154Google Scholar, 17Boehm M. Yoshimoto T. Crook M.F. Nallamshetty S. True A. Nabel G.J. Nabel E.G. EMBO J. 2002; 21: 3390-3401Google Scholar). p27Kip1 protein has been reported to interact with c-Jun co-activator Jab1 (also known as CSN5), and this interaction causes nuclear export of the p27Kip1 protein (18Tomoda K. Kubota Y. Kato J. Nature. 1999; 398: 160-165Google Scholar) and modulates c-Jun-dependent transcription (19Chopra S. Fernandez D. Mattos S. Lam E.W. Mann D.J. J. Biol. Chem. 2002; 277: 32413-32416Google Scholar). Because of the major impact of p27Kip1 in controlling cell cycle, the role of p27Kip1 protein in human carcinogenesis has been indicated in a number of studies. Low expression of p27Kip1 protein is associated with excessive cell proliferation and has been linked to many types of human tumors including breast cancer (10Philipp-Staheli J. Payne S.R. Kemp C.J. Exp. Cell Res. 2001; 264: 148-168Google Scholar). Low expression of p27Kip1 protein is found to correlate reversibly with HER2 overexpression via HER2-facilitated p27Kip1 degradation (20Yang H.Y. Zhou B.P. Hung M.C. Lee M.H. J. Biol. Chem. 2000; 275: 24735-24739Google Scholar). Low levels of p27Kip1 protein correlates well with higher grade neoplasms and poor survival rates (10Philipp-Staheli J. Payne S.R. Kemp C.J. Exp. Cell Res. 2001; 264: 148-168Google Scholar). A striking correlation between the expression of tumor suppressor PTEN and the level of p27Kip1 protein is observed in thyroid carcinoma (21Bruni P. Boccia A. Baldassarre G. Trapasso F. Santoro M. Chiappetta G. Fusco A. Viglietto G. Oncogene. 2000; 19: 3146-5315Google Scholar). By down-regulating p27Kip1 protein via proteasomal degradation, oncogenic fusion protein Bcr-Abl forces fibroblasts and hematopoietic cells to divide under inappropriate conditions (22Jonuleit T. van der Kuip H. Miething C. Michels H. Hallek M. Duyster J. Aulitzky W.E. Blood. 2000; 96: 1933-193Y9Google Scholar). Furthermore, targeted disruption of the p27Kip1 gene increases body size of mice, leads to striking enlargement of multiple organs and development of pituitary tumors (23Nakayama K. Ishida N. Shirane M. Inomata A. Inoue T. Shishido N. Horii I. Loh D.Y. Nakayama K. Cell. 1996; 85: 707-720Google Scholar, 24Fero M.L. Rivkin M. Tasch M. Porter P. Carow C.E. Firpo E. Polyak K. Tsai L.H. Broudy V. Perlmutter R.M. Kaushansky K. Roberts J.M. Cell. 1996; 85: 733-744Google Scholar). In the pre-clinical setting, our group and others (25Le X.-F. McWatters A. Wiener J. Mills G.B. Bast Jr., R.C. Clin. Cancer Res. 2000; 6: 260-270Google Scholar, 26Neve R.M. Sutterluty H. Pullen N. Lane H.A. Daly J.M. Krek W. Hynes N.E. Oncogene. 2000; 19: 1647-5166Google Scholar, 27Pietras R.J. Poen J.C. Gallardo D. Wongvipat P.N. Lee H.J. Slamon D.J. Cancer Res. 1999; 59: 1347-1355Google Scholar, 28Ye D.W. Fan Z. Mendelsohn J. Oncogene. 1999; 18: 731-738Google Scholar, 29Sliwkowski M.X. Lofgren J.A. Lewis G.D. Hotaling T.E. Fendly B.M. Fox J.A. Semin. Oncol. 1999; 26: 60-70Google Scholar, 30Lane H.A. Beuvink I. Motoyama A.B. Daly J.M. Neve R.M. Hynes N.E. Mol. Cell. Biol. 2000; 20: 3210-3223Google Scholar, 31Yakes F.M. Chinratanalab W. Ritter C.A. King W. Seelig S. Arteaga C.L. Cancer Res. 2002; 62: 4132-4141Google Scholar) have demonstrated that anti-HER2 monoclonal antibodies exert inhibitory effects on HER2-overexpressing breast cancer through induction of G1 cell cycle arrest associated with induction of p27Kip1 and reduction of CDK2. However, the role of p27Kip1 in anti-HER2 antibody-induced G1 cell cycle arrest and growth inhibition is still uncertain. Here we have provided several lines of evidence to support a critical role for p27Kip1 in the anti-HER2 antibody-induced G1 cell cycle arrest and tumor growth. We have further shown that regulation of the phosphorylation of p27Kip1 protein is one of the post-translational mechanisms by which anti-HER2 antibody up-regulates the protein. Cell Culture—Two human breast cancer cell lines, SKBr3 and BT474, were obtained from the American Type Culture Collection (ATCC, Manassas, VA). SKBr3 cells were grown in complete medium containing RPMI 1640 medium (Invitrogen) supplemented with 10% fetal bovine serum (Sigma), 2 mm l-glutamine, 100 units/ml of penicillin, and 100 μg/ml streptomycin in humidified air with 5% CO2 at 37 °C. BT474 cells were grown in complete medium containing Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum, 2 mm l-glutamine, 100 units/ml of penicillin, and 100 μg/ml streptomycin. For all experiments, cells were detached with 0.25% trypsin-0.02% EDTA. For cell culture, 2–6 × 105 exponentially growing cells were plated into 100-mm tissue culture dishes or 3 × 103 into 96-well plates in complete medium. After culture overnight in complete medium, cells were treated with antibodies at different concentrations as indicated in each figure legend in complete medium at 37 °C for the indicated time intervals. Reagents—Antibodies reactive with phospho-Thr-187 p27Kip1, phospho-Ser-10 p27Kip1, and Jab1 were purchased from Zymed Laboratories Inc. (South San Francisco, CA). An antibody to p27Kip1 was purchased from BD Biosciences. An antibody to c-Myc was obtained from Upstate Biotechnology, Inc. (Lake Placid, NY). A monoclonal antibody to β-actin was purchased from Sigma. Anti-HER2 murine monoclonal antibody 4D5 and humanized monoclonal antibody trastuzumab (Herceptin®) were kindly provided by Genentech (South San Francisco, CA). Human IgG1 (hIgG) purified from plasma of patients with myelomas was obtained from Calbiochem and dialyzed against sterile cold PBS to eliminate sodium azide. Hybridoma cells specific for MOPC21, which was obtained from the ATCC, Manassas, VA was used to produce ascites fluid, and the immunoglobin was purified as reported previously (25Le X.-F. McWatters A. Wiener J. Mills G.B. Bast Jr., R.C. Clin. Cancer Res. 2000; 6: 260-270Google Scholar). A Tet-Off gene expression system was purchased from Clontech. Cycloheximide was purchased from Sigma. Wild-type p27Kip1 and its mutants (S10A and T187A) in pcDNA3.0 vector were kindly provided by Dr. K. Nakayama (Departments of Molecular and Cellular Biology and Molecular Genetics, Medical Institute of Bioregulation, Kyushu University, Fukuoka, Japan). A membrane-bound GFP expression vector pEGFP-F was purchased from Clontech. Calpain inhibitor PD151746, a broad-caspase inhibitor II, and MG132 were obtained from Calbiochem. Anchorage-dependent Growth—Two different methods have been used to assess the anchorage-dependent growth in this study. The first one was a 96-well microplate crystal violet mitogenic assay that was modified from previous reports (25Le X.-F. McWatters A. Wiener J. Mills G.B. Bast Jr., R.C. Clin. Cancer Res. 2000; 6: 260-270Google Scholar, 32Pegram M.D. Finn R.S. Arzoo K. Beryt M. Pietras R.J. Slamon D.J. Oncogene. 1997; 15: 537-547Google Scholar). Briefly, 3 × 103 of SKBr3 cells were plated into 96-well tissue culture plates in triplicate. The cells were treated with anti-HER2 antibody (trastuzumab or 4D5) or control reagent (hIgG for trastuzumab; MOPC21 for 4D5). After incubation for 3 days, the cells were washed with PBS, fixed in 1% glutaraldehyde in PBS, and stained with 0.5% crystal violet (Sigma) in methanol. The dye was eluted with Sorenson's buffer (0.9% sodium citrate, 0.02 n HCl, and 45% ethanol), and the eluted dye was measured by a microplater reader Vmax (Molecular Devices, Sunnyvalle, CA) at wavelength 540 nm. A second method, a low density long-term assay, was performed in 100-mm cell culture dishes. Low cell density (BT474 cells at 1 × 105; SKBr3 cells at 1.5 × 104) was used when plating the cells. After overnight incubation, the cells were treated with single dose of anti-HER2 antibody (trastuzumab or 4D5) or control reagent (hIgG for trastuzumab; MOPC21 for 4D5) in complete medium for up to 1 week. No medium was changed during the assay. Cells on day 3–7 after treatment were then harvested for enumeration of cells with a Coulter counter (Coulter Electronics LTD, Miami, FL), p27Kip1 protein detection by Western blotting, and cell cycle analysis by flow cytometry. Anchorage-independent Growth—To determine the anchorage-independent cell growth of SKBr3 cells, a colony-forming assay in soft agar was used as reported in our previous studies (25Le X.-F. McWatters A. Wiener J. Mills G.B. Bast Jr., R.C. Clin. Cancer Res. 2000; 6: 260-270Google Scholar). Cell Cycle Analysis—Cell cycle distribution was analyzed by flow cytometry. Cells were trypsinized, washed once with PBS, and fixed overnight in 70% ethanol. Fixed cells were centrifuged at 300 × g for 10 min and washed with PBS. Cell pellets were re-suspended in PBS containing 50 μg/ml of RNase A and 50 μg/ml propidium iodide and incubated for 20 min at 37 °C with gentle shaking. Stained cells were filtered through nylon mesh (41 μm) and analyzed on a Coulter flow cytometer XL-MCL (Coulter Corporation, Miami, FL) for relative DNA content based on red fluorescence levels. Doublets and cell debris were excluded from the DNA histograms. The percentages of sub-G1 cell population were determined based on relative DNA content. The percentages of cells in different cell cycle compartments were determined using the MULTICYCLE software program (Phoenix Flow Systems, San Diego, CA). Preparation of Total Cell Lysate and Western Immunoblot Analysis— The procedures for preparation of total protein and Western immunoblot analysis were performed as described previously (25Le X.-F. McWatters A. Wiener J. Mills G.B. Bast Jr., R.C. Clin. Cancer Res. 2000; 6: 260-270Google Scholar). Construction and Preparation of Inducible Adenovirus-p27Kip1 (Adp27)—A recombinant adenovirus vector expressing a doxycycline-regulated (Tet-Off) form of p27Kip1 has been constructed according to the manufacturer's recommendations (Clontech). Briefly, the human full-length p27Kip1 cDNA (obtained originally from PCR and verified by DNA sequencing) was cloned into pTRE-Shuttle2 vector. Recombinant adenoviral DNA containing myc-p27Kip1 (Ad-myc-p27Kip1) was created through ligating pTRE-Shuttle2-myc-p27Kip1 to Adeno-X viral DNA (Clontech). Large-scale production of high-titer Ad-myc-p27Kip1 was performed by growing human embryonic kidney 293 cells on improved minimum Eagle's medium supplemented with 10% Tet-free fetal bovine serum (Clontech), 4 mm l-glutamine, 100 units/ml penicillin G sodium, 100 μg/ml streptomycin. The virus was purified twice using cesium-chloride density gradient centrifugation. The viral vector was then dialyzed for 8 h at 4 °C against a buffer containing 10 mm Tris-HCl (pH 7.5), 1 mm MgCl2, and 10% glycerol and was stored at –80 °C. Infection with Adp27—2 × 105 of SKBr3 cells were seeded in 100-mm cell culture dishes and incubated at 37 °C overnight. Cells were then coinfected with a 1:1 ratio of an adeno-X Tet-Off regulatory virus (Clontech) and Ad-myc-p27Kip1 virus (created as described above) at different multiplicities of infection (m.o.i.) or at an m.o.i. of 20. The cells were cultured with 10% Tet-free fetal bovine serum in presence (+) of absence (–) of doxycycline (1 μg/ml). When applicable, doxycycline was re-added every 48 h. After 48–72 h, cells were harvested for enumeration with a Coulter counter, Western blot analysis, and cell cycle analysis. Small Interfering RNA (SiRNA)—To silence p27Kip1 gene expression, a single transfection of SiRNA duplex was performed using Oligofectamine reagent (Invitrogen) according to the manufacturer's protocol. Two double-stranded RNAs with 21-mers and d(TT) overhang were selected for the ability to silence p27Kip1 expression. p27Kip1 SiRNA 1 corresponds to nucleotides 217 to 238 of the human p27Kip1 coding region (AAGTACGAGTGGCAAGAGGTG). p27Kip1 SiRNA 2 corresponds to nucleotides 139 to 160 of the human p27Kip1 coding region (AAGCACTGCAGAGACATGGAA). The SiRNAs were synthesized at high-peformance purity by Qiagen-Xeragon (Germantown, MD). A non-related control SiRNA, which targeted DNA sequence AATTCTCCGAACGTGTCACGT with no significant match in the complete human genome, was purchased from Qiagen-Xeragon that had been purified under similar condition (catalog number 80-11310). p27Kip1 Mutants and GFP Co-transfection—SKBr3 cells grown in 60-mm dishes were transfected with the 3.2 μg of appropriate expression plasmids (wild-type p27Kip1, S10A p27Kip1, or T187A p27Kip1) plus 0.8 μg of pEGFP-F vector using 7 μl of LipofectAMINE-2000 (Invitrogen) according to manufacturer's instructions. Cells were trypsinized and re-seeded in two identical dishes after 24 h of transfection. One dish was treated with anti-HER2 antibody 4D5, and the other was treated with diluent. After incubation for another 24 h, cells were collected and subjected to cell cycle analysis or used to prepare protein. For cell cycle analysis, cells were first fixed in 0.25% paraformaldehyde for 1.5 h on ice and then stained with PI solution as described above. Only the GFP-positive population was gated, and its cell cycle distribution was assessed. The GFP positive rate in empty vector pcDNA3.0 was used to normalize other plasmids' different transfection efficiency. Statistical Analysis—The two-tailed Student's t test was used to compare two different groups. Values with p < 0.05 were considered significant. Anti-HER2 Antibody Induces a Concentration-dependent Accumulation of p27Kip1 Protein and a Corresponding Concentration-dependent G1Cell Cycle Arrest—In previous studies, we have shown that the anti-HER2 antibody ID5 induced G1 cell cycle arrest through inhibition of CDK2 and induction of p27Kip1 (25Le X.-F. McWatters A. Wiener J. Mills G.B. Bast Jr., R.C. Clin. Cancer Res. 2000; 6: 260-270Google Scholar). In this study, we have employed the clinically approved anti-HER2 antibody trastuzumab and its mouse precursor 4D5. Two breast cancer cell lines that overexpress HER2 protein, SKBr3 and BT474, were used in our experiments. SKBr3 cells were treated for 24 h with anti-HER2 antibody 4D5 at different concentrations or control mouse antibody MOPC21 at 10 μg/ml. Cells were then divided into two portions: one for cell cycle analysis and the other for total protein extraction and Western immunoblot analysis. As shown in Fig. 1A, 4D5 induced a dramatic and concentration-dependent increase in the fraction of cells in G1 phase of the cell cycle. This G1 arrest was associated with a dramatic and concentration-dependent decrease of cells in S phase. The decrease of cells in G2/M phase was also concentration-dependent but less impressive. The control antibody MOPC21, as expected, did not cause G1 arrest (Fig. 1A). Importantly, G1 arrest induced by 4D5 correlated closely with the induction of p27Kip1 in the same dose-dependent manner (Fig. 1B). No p27Kip1 induction was observed in cells treated with control antibody MOPC21 (Fig. 1B), which correlated well with no G1 arrest observed in Fig. 1A. These results were further confirmed in another HER2-overexpressing breast cell line, BT474. As shown in Fig. 1, C and D, 4D5 treatment resulted in a concentration-dependent increase in the fraction of cells in G1 and a concentration-dependent induction of p27Kip1 protein. The control antibody MOPC21 elicited no p27Kip1 protein and did not cause any G1 arrest (Fig. 1, C and D). These data demonstrate that anti-HER2 antibody induces a concentration-dependent p27Kip1 accumulation and a corresponding G1 cell cycle arrest, suggesting a role of p27Kip1 protein in anti-HER2 antibody-induced G1 arrest. Anti-HER2 Antibody Induces a Time-dependent Accumulation of p27Kip1 Protein and a Corresponding Time-dependent G1Cell Cycle Arrest—We next test whether the induction of p27Kip1 protein and G1 arrest by anti-HER2 antibody also behaves in a similarly time-dependent manner. BT474 cells were treated with the anti-HER2 antibody trastuzumab at 10 μg/ml or control hIgG for different time intervals. Cells were then divided into two portions: one for cell cycle analysis and the other for total protein extraction and Western immunoblot analysis. As shown in Fig. 2A, in BT474 cells trastuzumab induced a dramatic and time-dependent increase of cells in G1 phase within 48 h. This G1 arrest accompanied a dramatic and concentration-dependent decrease of S phase cells. In BT474 cells, the G1 arrest induced by trastuzumab peaked around 48 h. The control hIgG, as expected, did not cause any G1 arrest (Fig. 2A). Similar to the results in Fig. 1, the trastuzumab-induced G1 arrest correlated closely with the induction of p27Kip1 in the same time-dependent manner (Fig. 2B). Trastuzumab-induced p27Kip1 protein peaked at 48 h in BT474 cells (Fig. 2B), which was in agreement with the G1 cell cycle arrest observed in Fig. 2A. No p27Kip1 induction was observed in cells treated with control hIgG (Fig. 2B), which correlated well with the level of G1 arrest observed in Fig. 2A. These results were further confirmed in the 4D5-treated SKBr3 cells. As shown in Fig. 2, C and D, 4D5 treatment resulted in a time-dependent increase in the G1 fraction of cells and a time-dependent induction of p27Kip1 protein. In SKBr3 cells, both p27Kip1 level and G1 arrest induced by 4D5 peaked around 24 h. The control antibody MOPC21 elicited no p27Kip1 protein nor did it cause any G1 arrest (Fig. 2, C and D). These data demonstrate that anti-HER2 antibody induces a time-dependent p27Kip1 accumulation and a corresponding G1 cell cycle arrest, further suggesting a role of p27Kip1 protein in anti-HER2 antibody-induced G1 arrest. Anti-HER2 Antibody Induces an Irreversible Increase in p27Kip1 Protein and a Corresponding G1Cell Cycle Arrest—To determine whether anti-HER2 antibody-induced p27Kip1 protein and G1 cell cycle arrest are reversible or irreversible, BT474 cells were treated for different intervals with or without 10 μg/ml trastuzumab. At the different intervals, cells were washed with media that lacked anti-HER2 antibody and were then replenished with normal media that contained no antibody as illustrated in Fig. 3A. After 48 h, cells were harvested for measurement of p27Kip1 protein by Western immunoblot and of cell cycle distribution by flow cytometry. Our preliminary data and published data (25Le X.-F. McWatters A. Wiener J. Mills G.B. Bast Jr., R.C. Clin. Cancer Res. 2000; 6: 260-270Google Scholar) have revealed the following: 1) that anti-HER2 antibody does not induce significant p27Kip1 protein and G1 arrest within 8 h upon antibody treatment, and 2) that the earliest time interval for the anti-HER2 antibody to induce significant p27Kip1 protein and G1 arrest is around 16 h after treatment. Therefore, we have focused the time intervals between 8 and 16 h after antibody treatment. As shown in
Referência(s)