Glucocorticoids Induce Osteocyte Apoptosis by Blocking Focal Adhesion Kinase-mediated Survival
2007; Elsevier BV; Volume: 282; Issue: 33 Linguagem: Inglês
10.1074/jbc.m611435200
ISSN1083-351X
AutoresLilian I. Plotkin, Stavros C. Manolagas, Teresita Bellido,
Tópico(s)NF-κB Signaling Pathways
ResumoBone fragility induced by chronic glucocorticoid excess is due, at least in part, to induction of osteocyte apoptosis through direct actions on these cells. However, the molecular mechanism by which glucocorticoids shorten osteocyte life span has remained heretofore unknown. We report that apoptosis of osteocytic MLO-Y4 cells induced by the synthetic glucocorticoid dexamethasone is abolished by the glucocorticoid receptor antagonist RU486, but not by inhibition of protein or RNA synthesis. Dexamethasone-induced apoptosis is preceded by a decrease in the number of cytoplasmic processes, an indicator of cell detachment. In addition, the focal adhesion kinase FAK prevents dexamethasone-induced apoptosis, whereas the FAK-related kinase Pyk2 increases the basal levels of apoptosis. Dexamethasone-induced apoptosis is also prevented in cells expressing kinase-deficient or phosphorylation-defective (Y402F) dominant negative mutants of Pyk2. Consistent with the requirement of tyrosine 402, dexamethasone induces rapid Pyk2 phosphorylation in this residue. Moreover, knocking down Pyk2 expression abolishes apoptosis and cell detachment induced by dexamethasone, and transfection with human Pyk2 rescues both responses. Furthermore, induction of apoptosis as well as cell detachment by dexamethasone is abolished by inhibiting the activity of JNK, a recognized downstream target of Pyk2 activation. These results demonstrate that glucocorticoids promote osteocyte apoptosis via a receptor-mediated mechanism that does not require gene transcription and that is mediated by rapid activation of Pyk2 and JNK, followed by inside-out signaling that leads to cell detachment-induced apoptosis or anoikis. Bone fragility induced by chronic glucocorticoid excess is due, at least in part, to induction of osteocyte apoptosis through direct actions on these cells. However, the molecular mechanism by which glucocorticoids shorten osteocyte life span has remained heretofore unknown. We report that apoptosis of osteocytic MLO-Y4 cells induced by the synthetic glucocorticoid dexamethasone is abolished by the glucocorticoid receptor antagonist RU486, but not by inhibition of protein or RNA synthesis. Dexamethasone-induced apoptosis is preceded by a decrease in the number of cytoplasmic processes, an indicator of cell detachment. In addition, the focal adhesion kinase FAK prevents dexamethasone-induced apoptosis, whereas the FAK-related kinase Pyk2 increases the basal levels of apoptosis. Dexamethasone-induced apoptosis is also prevented in cells expressing kinase-deficient or phosphorylation-defective (Y402F) dominant negative mutants of Pyk2. Consistent with the requirement of tyrosine 402, dexamethasone induces rapid Pyk2 phosphorylation in this residue. Moreover, knocking down Pyk2 expression abolishes apoptosis and cell detachment induced by dexamethasone, and transfection with human Pyk2 rescues both responses. Furthermore, induction of apoptosis as well as cell detachment by dexamethasone is abolished by inhibiting the activity of JNK, a recognized downstream target of Pyk2 activation. These results demonstrate that glucocorticoids promote osteocyte apoptosis via a receptor-mediated mechanism that does not require gene transcription and that is mediated by rapid activation of Pyk2 and JNK, followed by inside-out signaling that leads to cell detachment-induced apoptosis or anoikis. Glucocorticoids, produced and released by the adrenal glands in response to stress, regulate numerous physiological processes in a wide range of tissues (1Necela B.M. Cidlowski J.A. Proc. Am. Thorac. Soc. 2004; 1: 239-246Crossref PubMed Scopus (159) Google Scholar, 2Rhen T. Cidlowski J.A. N. Engl. J. Med. 2005; 353: 1711-1723Crossref PubMed Scopus (2179) Google Scholar). Among many other effects, these hormones exert profound immunosuppressive and anti-inflammatory actions and induce apoptosis of many cell types, including T lymphocytes and monocytes. Because of these properties, glucocorticoids are extensively used for the treatment of immune and inflammatory conditions, the management of organ transplantation, and as components of chemotherapy regimens for hematological cancers. However, long-term use of glucocorticoids is associated with severe adverse side effects manifested in several organs. In particular, prolonged use of these drugs leads to a dramatic loss of bone mineral and strength, similar to endogenous elevation of glucocorticoids (3Newell-Price J. Bertagna X. Grossman A.B. Nieman L.K. Lancet. 2006; 367: 1605-1617Abstract Full Text Full Text PDF PubMed Scopus (1009) Google Scholar, 4Weinstein R.S. Rev. Endocr. Metab. Disord. 2001; 2: 65-73Crossref PubMed Scopus (157) Google Scholar, 5Van Staa T.P. Calcif. Tissue Int. 2006; 79: 129-137Crossref PubMed Scopus (210) Google Scholar, 6Mazziotti G. Angeli A. Bilezikian J.P. Canalis E. Giustina A. Trends Endocrinol. Metab. 2006; 17: 144-149Abstract Full Text Full Text PDF PubMed Scopus (289) Google Scholar). Evidence accumulated during the past few years has indicated that increased prevalence of apoptosis of osteocytes (and osteoblasts) is associated with the glucocorticoid-induced bone fragility syndrome (7Weinstein R.S. Jilka R.L. Parfitt A.M. Manolagas S.C. J. Clin. Investig. 1998; 102: 274-282Crossref PubMed Scopus (1379) Google Scholar, 8O'Brien C.A. Jia D. Plotkin L.I. Bellido T. Powers C.C. Stewart S.A. Manolagas S.C. Weinstein R.S. Endocrinology. 2004; 145: 1835-1841Crossref PubMed Scopus (624) Google Scholar, 9Gohel A. McCarthy M.B. Gronowicz G. Endocrinology. 1999; 140: 5339-5347Crossref PubMed Scopus (183) Google Scholar). This pro-apoptotic effect results from direct actions of the steroids on cells of the osteoblastic lineage. Indeed, the pro-apoptotic effect of glucocorticoids is readily demonstrable in cultured osteocytes and osteoblasts (10Jilka R.L. Weinstein R.S. Bellido T. Roberson P. Parfitt A.M. Manolagas S.C. J. Clin. Investig. 1999; 104: 439-446Crossref PubMed Scopus (886) Google Scholar, 11Plotkin L.I. Weinstein R.S. Parfitt A.M. Roberson P.K. Manolagas S.C. Bellido T. J. Clin. Investig. 1999; 104: 1363-1374Crossref PubMed Scopus (775) Google Scholar). Furthermore, transgenic mice overexpressing 11β-hydroxysteroid dehydrogenase type 2, an enzyme that inactivates glucocorticoids, in osteocytes and osteoblasts are protected from glucocorticoid-induced bone fragility (8O'Brien C.A. Jia D. Plotkin L.I. Bellido T. Powers C.C. Stewart S.A. Manolagas S.C. Weinstein R.S. Endocrinology. 2004; 145: 1835-1841Crossref PubMed Scopus (624) Google Scholar).The mechanism of glucocorticoid action involves binding to the glucocorticoid receptor (GR), 2The abbreviations used are: GR, glucocorticoid receptor; ROS, reactive oxygen species; ERKs, extracellular signal regulated kinases; Pyk2, proline-rich tyrosine kinase 2; FAK, focal adhesion kinase; JNK, c-Jun N-terminal kinase; GFP, green fluorescent protein; nGFP, GFP targeted to the nucleus; nRFP, RFP targeted to the nucleus; WT, wild type; K-, kinase deficient; PI3K,phosphatidylinositol 3-kinase; BAPTA-AM, 1,2-bis(2-aminophenoxyl)ethane-N,N,N′,N′-tetraacetic acid. 2The abbreviations used are: GR, glucocorticoid receptor; ROS, reactive oxygen species; ERKs, extracellular signal regulated kinases; Pyk2, proline-rich tyrosine kinase 2; FAK, focal adhesion kinase; JNK, c-Jun N-terminal kinase; GFP, green fluorescent protein; nGFP, GFP targeted to the nucleus; nRFP, RFP targeted to the nucleus; WT, wild type; K-, kinase deficient; PI3K,phosphatidylinositol 3-kinase; BAPTA-AM, 1,2-bis(2-aminophenoxyl)ethane-N,N,N′,N′-tetraacetic acid. conformational changes, and nuclear translocation of the ligand-bound receptor, followed by cis or trans interactions with DNA and thereby induction or repression of gene transcription (1Necela B.M. Cidlowski J.A. Proc. Am. Thorac. Soc. 2004; 1: 239-246Crossref PubMed Scopus (159) Google Scholar, 2Rhen T. Cidlowski J.A. N. Engl. J. Med. 2005; 353: 1711-1723Crossref PubMed Scopus (2179) Google Scholar). In addition, glucocorticoids exert actions independently of changes in gene transcription. Such actions include modulation of the activity of intracellular kinases like the extracellular signal-regulated kinases (ERKs), c-Jun N-terminal kinase (JNK), and proline-rich tyrosine kinase 2 (Pyk2) (12Druilhe A. Letuve S. Pretolani M. Apoptosis. 2003; 8: 481-495Crossref PubMed Scopus (135) Google Scholar, 13Limbourg F.P. Liao J.K. J. Mol. Med. 2003; 81: 168-174Crossref PubMed Scopus (67) Google Scholar, 14Chauhan D. Pandey P. Ogata A. Teoh G. Treon S. Urashima M. Kharbanda S. Anderson K.C. Oncogene. 1997; 15: 837-843Crossref PubMed Scopus (160) Google Scholar, 15Blaukat A. Ivankovic-Dikic I. Gronroos E. Dolfi F. Tokiwa G. Vuori K. Dikic I. J. Biol. Chem. 1999; 274: 14893-14901Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar, 16Tokiwa G. Dikic I. Lev S. Schlessinger J. Science. 1996; 273: 792-794Crossref PubMed Scopus (285) Google Scholar, 17Chauhan D. Hideshima T. Pandey P. Treon S. Teoh G. Raje N. Rosen S. Krett N. Husson H. Avraham S. Kharbanda S. Anderson K.C. Oncogene. 1999; 18: 6733-6740Crossref PubMed Scopus (101) Google Scholar). Pyk2, also known as related adhesion focal tyrosine kinase, cellular adhesion kinase β, or calcium-dependent tyrosine kinase (18Xiong W. Parsons J.T. J. Cell Biol. 1997; 139: 529-539Crossref PubMed Scopus (151) Google Scholar, 19Sasaki H. Nagura K. Ishino M. Tobioka H. Kotani K. Sasaki T. J. Biol. Chem. 1995; 270: 21206-21219Abstract Full Text Full Text PDF PubMed Scopus (363) Google Scholar), is a member of the focal adhesion kinase (FAK) family of nonreceptor tyrosine kinases. Although Pyk2 and FAK are highly homologous, these proteins exhibit opposite effects on cell fate. Thus, whereas FAK activation leads to cell spreading and survival (20Avraham H. Park S. Schinkmann K. Avraham S. Cell. Signal. 2000; 12: 123-133Crossref PubMed Scopus (407) Google Scholar), Pyk2 induces reorganization of the cytoskeleton, cell detachment, and apoptosis (18Xiong W. Parsons J.T. J. Cell Biol. 1997; 139: 529-539Crossref PubMed Scopus (151) Google Scholar, 20Avraham H. Park S. Schinkmann K. Avraham S. Cell. Signal. 2000; 12: 123-133Crossref PubMed Scopus (407) Google Scholar). Consistent with these lines of evidence, we have recently demonstrated that mechanical stimulation promotes osteocyte survival by activating FAK (21Plotkin L.I. Mathov I. Aguirre J.I. Parfitt A.M. Manolagas S.C. Bellido T. Am. J. Physiol. 2005; 289 (-C643): C633Crossref PubMed Scopus (218) Google Scholar). We now report that glucocorticoids promote osteocyte apoptosis by activating Pyk2 and JNK, hence opposing FAK-induced survival. These changes lead to cell detachment-induced apoptosis (anoikis). This action of glucocorticoids is exerted via a receptor-mediated mechanism, but it is independent of new gene transcription.EXPERIMENTAL PROCEDURESMaterials—The synthetic glucocorticoid dexamethasone, etoposide, cycloheximide, actinomycin D, RU486, SB203580, wortmannin, EGTA, and gadolinium chloride were purchased from Sigma; SP600125 and nifedipine from EMD Biosciences, Inc. (San Diego, CA); Asp-Glu-Val-Asp-aldehyde (DEVD) and thapsigargin from Biomol Research Labs, Inc. (Plymouth Meeting, PA); PD98059 from New England Biolabs (Beverly, MA); PP1 from BioSource International (Camarillo, CA); [3H]leucine or [3H]uridine from Amersham Biosciences; and BAPTA-AM and phalloidin-Alexa Fluor 555 from Molecular Probes (Carlsbad, CA).DNA Constructs and Transient Transfections—pCDNA3, yellow fluorescent protein (YFP)-DEVD caspase3 sensor and green fluorescent protein (GFP) were purchased from Clontech. The plasmids encoding nuclear targeted GFP (nGFP) and red fluorescent protein (nRFP) were previously described (11Plotkin L.I. Weinstein R.S. Parfitt A.M. Roberson P.K. Manolagas S.C. Bellido T. J. Clin. Investig. 1999; 104: 1363-1374Crossref PubMed Scopus (775) Google Scholar, 22Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell. 2001; 104: 719-730Abstract Full Text Full Text PDF PubMed Google Scholar). Human wild type (WT) FAK was provided by S. Aruffo (Bristol-Myers Squibb Pharmaceutical Research Institute, Princeton, NJ) (23Chan P.Y. Kanner S.B. Whitney G. Aruffo A. J. Biol. Chem. 1994; 269: 20567-20574Abstract Full Text PDF PubMed Google Scholar). Murine WT, kinase-deficient (K-), and autophosphorylation deficient (Y402F) Pyk2 mutants were provided by W-C. Xiong (University of Alabama, Birmingham, AL) (18Xiong W. Parsons J.T. J. Cell Biol. 1997; 139: 529-539Crossref PubMed Scopus (151) Google Scholar). Human WT and K- Pyk2 mutant fused to GFP (Pyk2-GFP) were provided by D. Sancho (Universidad Autónoma de Madrid, Madrid, Spain) (24Sancho D. Nieto M. Llano M. Rodriguez-Fernandez J.L. Tejedor R. Avraham S. Cabanas C. Lopez-Botet M. Sanchez-Madrid F. J. Cell Biol. 2000; 149: 1249-1262Crossref PubMed Scopus (71) Google Scholar). Dominant negative and constitutively active MEK were provided by N. Ahn (University of Colorado, Boulder, CO (25Mansour S.J. Matten W.T. Hermann A.S. Candia J.M. Rong S. Fukasawa K. Vande Woude G.F. Ahn N.G. Science. 1994; 265: 966-970Crossref PubMed Scopus (1254) Google Scholar)). Wild type and dominant negative JNK were provided by E. R. Levin (University of California at Irvine, Long Beach, CA) (26Pedram A. Razandi M. Levin E.R. J. Biol. Chem. 1998; 273: 26722-26728Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 27Pedram A. Razandi M. Levin E.R. Endocrinology. 2001; 142: 1578-1586Crossref PubMed Scopus (81) Google Scholar) and ΔMEKK1, by N. R. Bhat (Medical University of South Carolina, Charleston, SC) (28Pawate S. Bhat N.R. Antioxid. Redox. Signal. 2006; 8: 903-909Crossref PubMed Scopus (50) Google Scholar). All the constructs used in this study have been shown to produce functional proteins. Cells were transiently transfected with a total amount of DNA of 0.1 μg/cm2 using Lipofectamine Plus (Invitrogen) as previously described (22Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell. 2001; 104: 719-730Abstract Full Text Full Text PDF PubMed Google Scholar, 29Plotkin L.I. Manolagas S.C. Bellido T. J. Biol. Chem. 2002; 277: 8648-8657Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar). The efficiency of transfection was ∼60%.Cell Culture—Wild type MLO-Y4 osteocytic cells derived from murine long bones and MLO-Y4 cells stably transfected with nGFP were cultured as previously described (11Plotkin L.I. Weinstein R.S. Parfitt A.M. Roberson P.K. Manolagas S.C. Bellido T. J. Clin. Investig. 1999; 104: 1363-1374Crossref PubMed Scopus (775) Google Scholar, 30Kato Y. Windle J.J. Koop B.A. Mundy G.R. Bonewald L.F. J. Bone Miner. Res. 1997; 12: 2014-2023Crossref PubMed Scopus (420) Google Scholar).Inhibition of RNA or Protein Synthesis—MLO-Y4 cells were incubated with 1 μCi/ml [3H]leucine or [3H]uridine for 2.5 h, followed by addition of 1 μm cycloheximide or 2 μm actinomycin D. After 7.5 h, cells were scraped off the plates, protein and RNA were precipitated with ice-cold 5% trichloroacetic acid, and radioactivity was quantified. Protein concentration was determined using a detergent compatible Bio-Rad kit. [3H]Leucine or [3H]uridine incorporation was expressed as counts/min/μg of protein.Quantification of Apoptotic Cells—Apoptosis was induced in semi-confluent cultures (less than 75% confluence) by treatment with the glucocorticoid dexamethasone (1 μm) or with etoposide (50 μm) for the indicated times. Cells were incubated for 2.5 h with cycloheximide or actinomycin D, or for 30 min with inhibitors or Ca2+ modulators, before addition of the pro-apoptotic agents. Apoptosis was assessed by trypan blue uptake or by enumerating MLO-Y4 cells expressing nGFP or nRFP exhibiting chromatin condensation and nuclear fragmentation under a fluorescence microscope, as previously reported (11Plotkin L.I. Weinstein R.S. Parfitt A.M. Roberson P.K. Manolagas S.C. Bellido T. J. Clin. Investig. 1999; 104: 1363-1374Crossref PubMed Scopus (775) Google Scholar). Apoptosis was also quantified by measuring caspase 3 activation in cells transiently transfected with a plasmid encoding a caspase 3 sensor fusion protein along with nRFP, as previously reported (31Plotkin L.I. Manolagas S.C. Bellido T. Bone. 2006; 39: 443-452Crossref PubMed Scopus (138) Google Scholar, 32Almeida M. Han L. Bellido T. Manolagas S.C. Kousteni S. J. Biol. Chem. 2005; 280: 41342-41351Abstract Full Text Full Text PDF PubMed Scopus (354) Google Scholar, 33Liu Y. Porta A. Peng X. Gengaro K. Cunningham E.B. Li H. Dominguez L.A. Bellido T. Christakos S. J. Bone Miner. Res. 2004; 19: 479-490Crossref PubMed Scopus (129) Google Scholar). The caspase 3 sensor consists of enhanced YFP fused to the amino acid sequence cleaved by caspase 3 (DEVD), and also contains a dominant N-terminal nuclear export signal and a C-terminal nuclear localization signal. In living cells in which caspase 3 is inactive, the nuclear export sequence prevails and the fluorescent protein localizes in the cytoplasm. In apoptotic cells, the active caspase 3 cleaves off the protein at the DEVD sequence, removing the nuclear export sequence resulting in nuclear localization of the fluorescent caspase 3 sensor. The percentage of cells with increased caspase 3 activity was determined by analyzing under a fluorescence microscope the subcellular localization of the caspase 3 sensor. At least 250 cells from fields selected by systematic random sampling for each experimental condition were examined in all apoptosis assays.Quantification of Cell Detachment—The effect of dexamethasone or etoposide on cell detachment was quantified by enumerating the number of cytoplasmic processes of MLO-Y4 cells expressing GFP. Cells were classified in two groups: those having 3 or less (≤3) and those having more than 3 cytoplasmic processes. Data are expressed as percentage of cells with ≤3 cytoplasmic processes.H&E and Actin Staining—MLO-Y4 cells were stained with hematoxylin and eosin (H&E) following standard procedures. Cells then were dehydrated, mounted using Eukitt mounting medium (Electron Microscopy sciences, Washington, PA), and visualized by phase microscopy. For actin filament visualization, cells were fixed in neutral buffered formalin for 10 min, followed by permeabilization with 0.1% Triton X-100 for 5 min, and incubation with 1% bovine serum albumin in phosphate-buffered saline for 30 min to block unspecific staining. Actin filaments were stained with 5 units/ml phalloidin-Alexa Fluor 555 in phosphate-buffered saline containing 0.1% bovine serum albumin for 20 min, as previously described (34Carter C.A. Bellido T. J. Cell. Physiol. 1999; 178: 320-332Crossref PubMed Scopus (10) Google Scholar). Cells were visualized by confocal microscopy.Small Interfering RNA—The expression of murine Pyk2 or the irrelevant protein lamin A/C was silenced by treating for 3 h MLO-Y4 cells with 280 nm of the corresponding small interfering RNA (Custom SMARTpool, Dharmacon Research Inc., Lafayette, CO). Two days after silencing, Pyk2 expression was recovered by transfection with human Pyk2-GFP or with GFP as negative control. The pro-apoptotic agents were added 2 days after transfection and apoptosis and cell detachment were quantified after 6 h.Western Blot Analysis—Protein lysates from MLO-Y4 cells were prepared as previously reported (11Plotkin L.I. Weinstein R.S. Parfitt A.M. Roberson P.K. Manolagas S.C. Bellido T. J. Clin. Investig. 1999; 104: 1363-1374Crossref PubMed Scopus (775) Google Scholar). Proteins were separated on 10% SDS-polyacrylamide gels and electrotransferred to polyvinylidene difluoride membranes. Immunoblottings were performed using a rabbit anti-phosphorylated Pyk2 antibody (BioSource, Camarillo, CA) or rabbit anti-Pyk2 antibody that recognizes both the human and murine protein (Upstate, Charlottesville, VA). Human GFP-Pyk2 expression was detected using a mouse monoclonal anti-GFP antibody (Santa Cruz Biotechnology, Santa Cruz, CA). β-Actin was detected using a mouse monoclonal antibody (Sigma). After incubation with primary antibodies, blots were exposed to anti-rabbit or anti-mouse antibody conjugated with horseradish peroxidase (Santa Cruz Biotechnology, Santa Cruz, CA) and developed using a chemiluminescence substrate (Pierce). The intensity of the bands was quantified using the Versadoc Imaging system (Bio-Rad).Real Time PCR—Total RNA was obtained using Ultraspec RNA isolation reagent (Biotecx Laboratories, Houston, TX). Reverse transcription was performed using the High Capacity cDNA Archive Kit. Primers and probes for the housekeeping gene ChoB (probe, 5′-TCCAGAGCAGGATCC-3′, forward primer, CCCAGGATGGCGACGAT and reverse primer, CCGAATGCTGTAATGGCGTAT) (Assay-by-Design service) and TaqMan Gene Expression Assay for murine Pyk2 (Mm00552840_m1) were used. The PCR was performed using 20 μl of Gene Expression Assay Mix TaqMan Universal Master Mix containing 80 ng of each cDNA template in triplicates, using an ABI 7300 Real Time PCR system. The -fold change in expression was calculated using the ΔΔCt comparative threshold cycle method. All the reagents were from Applied Biosystems.Image Acquisition—Fluorescent images were collected on an Axiovert 200 inverted microscope or an Axioplan 2 microscope (Carl Zeiss Light Microscopy, Gottingen, Germany) with a LD A-Plan, ×32/0.40 lens and a low light camera (Polaroid DMC Ie, Polaroid Corp., Cambridge, MA), using filter sets for GFP, YFP, or RFP, and the Image-Pro Plus acquisition software (Media Cybernetics, Silver Spring, MD). Confocal images were obtained with an Axiovert LSM410 inverted confocal microscope (Zeiss LSM410) using the 568-nm line of an Argon-Krypton laser and a 590-nm long pass emission filter.Statistical Analysis—Data were analyzed by one-way analysis of variance, and the Student-Newman-Keuls method was used to estimate the level of significance of differences between means.RESULTSGlucocorticoid-induced Apoptosis Does Not Require New Gene Transcription and It Is Mediated by the GR—We and others have previously demonstrated that glucocorticoids induce apoptosis of osteocytic MLO-Y4 cells (11Plotkin L.I. Weinstein R.S. Parfitt A.M. Roberson P.K. Manolagas S.C. Bellido T. J. Clin. Investig. 1999; 104: 1363-1374Crossref PubMed Scopus (775) Google Scholar, 29Plotkin L.I. Manolagas S.C. Bellido T. J. Biol. Chem. 2002; 277: 8648-8657Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar, 35Kogianni G. Mann V. Ebetino F. Nuttall M. Nijweide P. Simpson H. Noble B. Life Sci. 2004; 75: 2879-2895Crossref PubMed Scopus (92) Google Scholar). We have used this cell model herein to gain insight into the mechanism of the pro-apoptotic effect of glucocorticoids. We found that dexamethasone induced apoptosis even in the presence of the protein synthesis inhibitor cycloheximide or the RNA synthesis inhibitor actinomycin D (Fig. 1A); even though [3H]leucine or [3H]uridine incorporation into proteins or RNA were effectively blocked (21.4 ± 0.8 and 9.6 ± 5.1% of control cultures, respectively). The pro-apoptotic effect of etoposide on osteocytic cells, used here for comparison, was similarly unaffected by the presence of the protein or RNA synthesis inhibitors (Fig. 1A).To determine whether the GR was required for glucocorticoid-induced apoptosis in osteocytic cells, we examined the effect of dexamethasone in the presence of RU486, a GR antagonist (36Agarwal M.K. Hainque B. Moustaid N. Lazer G. FEBS Lett. 1987; 217: 221-226Crossref PubMed Scopus (45) Google Scholar). Apoptosis induced by 6 h treatment with dexamethasone was absent in cells pre-treated with RU486, whereas apoptosis induced by etoposide was not affected, demonstrating the specificity of the receptor antagonist on the glucocorticoid effect (Fig. 1B).Microscopic examination revealed a profound effect of dexamethasone on the shape of MLO-Y4 cells. Based on this observation, we set up experiments to quantify the phenomenon by evaluating the number of cytoplasmic processes, as an indicator of cell rounding and detachment. Six-h treatments with dexamethasone increased the percentage of cells with ≤3 cytoplasmic processes, and this effect was absent in cells pre-treated with RU486 (Fig. 1C), indicating that cell detachment is also mediated by the GR. Taken together, these results indicate that the pro-apoptotic effect of glucocorticoids does not require new gene transcription, is mediated by the GR, and it is associated with cell detachment.Cell Detachment Precedes Induction of Osteocyte Apoptosis by Glucocorticoids—To determine whether cell detachment preceded or followed dexamethasone-induced apoptosis, time course experiments were performed in which apoptosis and cell detachment were evaluated in the same cultures. Apoptosis induced by dexamethasone was first detected 3 h after the addition of the hormone (Fig. 2, A and B), whereas the increase in the percentage of cells exhibiting ≤3 cytoplasmic processes was detected as early as 1 h after addition of the glucocorticoid (Fig. 3A). On the other hand, etoposide-induced apoptosis was detected after 3–6 h, but cell detachment could not be seen until 24 h of treatment (Figs. 2, A and B, and 3A). Representative images of cultures treated for 6 h with the agents depicting apoptotic and morphologic changes are shown in Figs. 2 and 3A, respectively.FIGURE 2Time course of glucocorticoid-induced osteocyte apoptosis. Cells were incubated with vehicle (veh), dexamethasone (dex), or etoposide (etop) for the indicated times. Apoptosis was quantified by determining the percentage of MLO-GFP cells exhibiting nuclear fragmentation and chromatin condensation (A) or the percentage of MLO-Y4 cells in which the YFP-caspase 3 sensor (green) co-localized with nRFP (red), seen orange in the merged images (B). C, MLO-GFP cells were treated with vehicle or DEVD before addition of the pro-apoptotic agents. The percent of apoptotic cells was determined as in A. Bars represent mean ±S.D. of triplicate determinations.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 3Glucocorticoid-induced osteocyte apoptosis is preceded by cell detachment. A, cells were incubated with vehicle (veh), dexamethasone (dex), or etoposide (etop) for the indicated times. Cell detachment was quantified in MLO-GFP cells as detailed under "Experimental Procedures." Representative images of MLO-GFP or MLO-Y4 cells stained with H&E show the morphologic changes observed after 6 h of treatment. B, actin filament reorganization was visualized in MLO-Y4 cells by confocal microcopy of cells stained with phalloidin-Alexa Fluor 555. C, MLO-GFP cells were treated with vehicle or DEVD before addition of the pro-apoptotic agents. Cell detachment was quantified as in A. Bars represent mean ±S.D. of triplicate determinations.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Retraction of osteocyte cytoplasmic processes and cell rounding induced by dexamethasone was also revealed by actin reorganization visualized by confocal microscopy of cells stained with Alexa Fluor 555-conjugated phalloidin (Fig. 3B). Indeed, the glucocorticoid-induced disruption of stress fibers and formation of peripheral actin rings as early as 1 h and these changes were maintained throughout the 24-h culture. In contrast, cells treated with etoposide only showed changes in actin filament organization after 24 h.Consistent with previous observations by us (11Plotkin L.I. Weinstein R.S. Parfitt A.M. Roberson P.K. Manolagas S.C. Bellido T. J. Clin. Investig. 1999; 104: 1363-1374Crossref PubMed Scopus (775) Google Scholar), apoptosis induced by either dexamethasone or etoposide (measured at 6 or 24 h) was inhibited by the cell permeable caspase 3 inhibitor DEVD (Fig. 2C). However, DEVD did not prevent dexamethasone-induced cell detachment at either 6 or 24 h (Fig. 3C). On the other hand, DEVD prevented etoposide-induced cell detachment at 24 h. These findings indicate that changes in cell shape precede glucocorticoid-induced cell detachment. In contrast, cell detachment induced by etoposide occurred subsequent to apoptosis induced by this agent.The Mechanism of Glucocorticoid-induced Apoptosis Involves Focal Adhesion Kinases—Cell attachment and survival depend on the formation of focal adhesions and activation of focal adhesion-associated proteins, such as FAK (37Hanks S.K. Ryzhova L. Shin N.Y. Brabek J. Front. Biosci. 2003; 8 (-D996): D982Crossref PubMed Google Scholar, 38Cary L.A. Guan J.L. Front. Biosci. 1999; 4 (-D113): D102Crossref PubMed Google Scholar). We have previously shown that phosphorylation of FAK is required for the anti-apoptotic effect of mechanical stimulation on osteocytic cells; and that osteocytic cells overexpressing FAK are resistant to the pro-apoptotic effect of dexamethasone (21Plotkin L.I. Mathov I. Aguirre J.I. Parfitt A.M. Manolagas S.C. Bellido T. Am. J. Physiol. 2005; 289 (-C643): C633Crossref PubMed Scopus (218) Google Scholar). Based on this and on evidence indicating that FAK and Pyk2 have opposite effects on cell survival (17Chauhan D. Hideshima T. Pandey P. Treon S. Teoh G. Raje N. Rosen S. Krett N. Husson H. Avraham S. Kharbanda S. Anderson K.C. Oncogene. 1999; 18: 6733-6740Crossref PubMed Scopus (101) Google Scholar, 18Xiong W. Parsons J.T. J. Cel
Referência(s)