Site-directed Mutagenesis of Yeast eEF1A
1998; Elsevier BV; Volume: 273; Issue: 44 Linguagem: Inglês
10.1074/jbc.273.44.28752
ISSN1083-351X
AutoresJens Cavallius, William C. Merrick,
Tópico(s)Chemical Synthesis and Analysis
ResumoSite-directed mutants of eEF1A (formerly eEF-1α) were generated using a modification of a highly versatile yeast shuttle vector (Cavallius, J., Popkie, A. P., and Merrick, W. C. (1997) Biochim. Biophys. Acta 1350, 345–358). The nucleotide specificity sequence NKMD (residues number 153–156) was targeted for mutagenesis, and the following mutants were obtained: N153D (DKMD), N153T (TKMD), D156N (NKMN), D156W (NKMW), and the double mutant N153T,D156E (TKNE). All of the yeast strains containing the mutant eEF1As as the sole source of eEF1A were viable except for the N153D mutant.Most of the purified mutant eEF1As had specific activities in the poly(U)-directed synthesis of polyphenylalanine similar to wild type, although with a K m for GTP increased by 1–2 orders of magnitude. The mutants showed a reduced rate of GTP hydrolysis, and most displayed misincorporation rates greater than wild type. The mutant NKMW eEF1A showed unusual properties. The yeast strain was temperature sensitive for growth, although the purified protein was not. Second, this form of eEF1A was 10-fold more accurate in protein synthesis, and its rate of GTP hydrolysis was about 20% of wild type. In total, the wild-type protein contains the most optimal nucleotide specificity sequence, NKMD, and even subtle changes in this sequence have drastic consequences on eEF1A function in vitro or yeast viability. Site-directed mutants of eEF1A (formerly eEF-1α) were generated using a modification of a highly versatile yeast shuttle vector (Cavallius, J., Popkie, A. P., and Merrick, W. C. (1997) Biochim. Biophys. Acta 1350, 345–358). The nucleotide specificity sequence NKMD (residues number 153–156) was targeted for mutagenesis, and the following mutants were obtained: N153D (DKMD), N153T (TKMD), D156N (NKMN), D156W (NKMW), and the double mutant N153T,D156E (TKNE). All of the yeast strains containing the mutant eEF1As as the sole source of eEF1A were viable except for the N153D mutant. Most of the purified mutant eEF1As had specific activities in the poly(U)-directed synthesis of polyphenylalanine similar to wild type, although with a K m for GTP increased by 1–2 orders of magnitude. The mutants showed a reduced rate of GTP hydrolysis, and most displayed misincorporation rates greater than wild type. The mutant NKMW eEF1A showed unusual properties. The yeast strain was temperature sensitive for growth, although the purified protein was not. Second, this form of eEF1A was 10-fold more accurate in protein synthesis, and its rate of GTP hydrolysis was about 20% of wild type. In total, the wild-type protein contains the most optimal nucleotide specificity sequence, NKMD, and even subtle changes in this sequence have drastic consequences on eEF1A function in vitro or yeast viability. eukaryotic elongation factor 1A elongation factor 2 xanthosine triphosphate 5′-guanylyl imidodiphosphate dithiothreitol 5-fluoro-orotic acid. Eukaryotic elongation factor 1A (eEF1A)1 binds aminoacyl-tRNAs in a GTP-dependent manner and positions the bound aminoacyl-tRNA in the A site of the ribosome. After or concomitant with the proper recognition of codon and anticodon, GTP is hydrolyzed, and eEF1A·GDP is released from the ribosome allowing for peptide bond formation with the peptidyl-tRNA in the ribosomal P site. Besides being involved in the synthesis of every peptide bond, eEF1A is an exceptionally abundant protein comprising 1–3% of the soluble protein in most eukaryotic cells. Elongation factor 1A amino acid sequences have been inferred from more than 100 different organisms including bacteria, archaebacteria, plants, and animals. The relatively slow rate of change of the sequence of EF1A as it evolved into eEF1A has made it an excellent sequence for determining phylogenetic trees. In large measure, it would seem that the overall tertiary structure has probably been maintained given the 33% identity and 56% similarity of Escherichia coli EF1A (formerly EF-Tu) with human eEF1A, and a discussion of the evolution of the EF1A into the eEF1A sequence has been published (1Cavallius J. Merrick W.C. Dickey B.F. Birnbaumer L. Handbook of Experimental Pharmacology. 108/I. Springer-Verlag, Berlin1993: 115-130Google Scholar). Beyond its role in protein synthesis, eEF1A has also been of interest as a member of the G protein family, as the only crystal structures known are for EF1A (2Kjeldgaard M. Nyborg J. J. Mol. Biol. 1992; 223: 721-742Crossref PubMed Scopus (249) Google Scholar), EF2 (formerly EF-G) (3Czworkowski J. Wang J. Steitz T.A. Moore P.B. EMBO J. 1994; 13: 3661-3668Crossref PubMed Scopus (362) Google Scholar), Ras (4McCormick F. Clark B.F.C. la Cour T.F.M. Kjeldgaard M. Norskov-Lauritsen L. Nyborg J. Science. 1985; 230: 78-82Crossref PubMed Scopus (141) Google Scholar), and transducin (5Lambright D.G. Noel J.P. Hamm H.E. Sigler P.B. Nature. 1994; 369: 621-628Crossref PubMed Scopus (532) Google Scholar). Crystals, but no structure, have been reported for archaebacterial EF1A (6Zagari A. Sica F. Scarano G. Vitagliano L. Bocchini V. J. Mol. Biol. 1994; 242: 175-177Crossref PubMed Scopus (11) Google Scholar). The very high homology between EF1A and eEF1A has allowed us to use the available crystal structures for EF1A to model the changes we have made in the yeast eEF1A mutants. Many attempts have been made to mutate GTP utilizing proteins to make them use XTP (7Sweet D.J. Gerace L. J. Cell Biol. 1996; 133: 971-983Crossref PubMed Scopus (49) Google Scholar, 8Jones S. Litt R.J. Richardson C.J. Segev N. J. Cell Biol. 1995; 130: 1051-1061Crossref PubMed Scopus (63) Google Scholar, 9Maier T. Lottspeich F. Bock A. Eur. J. Biochem. 1995; 230: 133-138Crossref PubMed Scopus (126) Google Scholar, 10Kang C. Sun N. Honzatko R.B. Fromm H.J. J. Biol. Chem. 1994; 269: 24046-24049Abstract Full Text PDF PubMed Google Scholar), including the prokaryotic counterpart to eEF1A, EF1A (11Hwang Y.W. Miller D.L. J. Biol. Chem. 1987; 262: 13081-13085Abstract Full Text PDF PubMed Google Scholar, 12Weijland A. Parlato G. Parmeggiani A. Biochemistry. 1994; 33: 10711-10717Crossref PubMed Scopus (38) Google Scholar). To study the nucleotide specificity of eEF1A, site-directed mutagenesis has been used to alter the binding pocket for the nucleotide in domain I of eEF1A. To do this, a highly efficient chromogenic selection system on a shuttle vector was used (13Cavallius J. Popkie A.P. Merrick W.C. Biochim. Biophys. Acta. 1997; 1350: 345-358Crossref PubMed Scopus (22) Google Scholar). We have made five mutants of yeast eEF1A at asparagine 153 and aspartic acid 156, the conserved amino acids in the nucleotide specificity sequence,NKMD. Several yeast strains grow exclusively on the mutant form of eEF1A, and the NKMN mutant eEF1A, when purified, uses XTP just as well as the wild type uses GTP. Curiously, the yeast strain for the NKMW mutant was temperature-sensitive, whereas the protein itself was not. The yeast strains M214 and M213 were generous gifts from Drs. M. G. Sandbaken and M. R. Culbertson, and both had the following genotype: Mata leu2–3, 112 Dtef1::LEU2 tef2-D2 lys2–20 his4–713 met2–1 ura3–52 trp1-D1. These strains contain nonfunctional copies of both TEF1 (Translation ElongationFactor 1) and TEF2, the two genes coding for eEF1A in yeast. Strain M213 contains plasmid YCpMS29 (TEF2, URA3) and strain M214 plasmid YCpMS41 (TEF2, TRP1), each harboring a fully functional copy of TEF2 (14Sandbaken M.G. Culbertson M.R. Genetics. 1988; 120: 923-934Crossref PubMed Google Scholar). Oligonucleotides were synthesized by the Molecular Biology Core Laboratory at Case Western Reserve University on an Applied Biosystems model DNA synthesizer, deprotected, and purified by the OPC method as described by the manufacturer (Applied Biosystems). The following oligonucleotides were made for site-directed mutagenesis. The oligonucleotides N153D, N153T, D156N, D156W, and D156E (using the N153T mutant as starting sequence) were all designed to make the respective indicated amino acid changes to the nucleotide binding sequence. N153D oligonucleotide, 5′CTCAGGTAGAACAGCTGTCGTTGTTAG3′; N153T oligonucleotide, 5′TAAACTGCCTCAGGTAGAACCACTGTCGTTGTTAGTTAACAG3′; D156N oligonucleotide, 5′AAGCAGGGTAAACTGCCTCAAGTAGAACAACTGTCGTTGTTA3′; D156W oligonucleotide, 5′TAAGCAGGGTAAACTGCCTGGTGTAGAACAACTGTCGTTGTTA3′; and D156E oligonucleotide (using the N153T mutant as starting sequence), 5′GGGTAAACTGCCTAAGGTAGAACCACT3′. All the site-directed mutation oligonucleotides were constructed so that they would introduce a change in the pattern of restriction sites and yet not introduce a rare codon as defined by the codon usage tables for yeast. The change in restriction sites are as follows: for N153D, gain of aSalI site; for N153T, loss of a HincII site; and for D156N, D156W, and D156E, loss of a Tth111 I site. The entire mutagenesis procedure has been published (13Cavallius J. Popkie A.P. Merrick W.C. Biochim. Biophys. Acta. 1997; 1350: 345-358Crossref PubMed Scopus (22) Google Scholar). In short, the yeast shuttle vector PRS314-JCTEF2 (1Cavallius J. Merrick W.C. Dickey B.F. Birnbaumer L. Handbook of Experimental Pharmacology. 108/I. Springer-Verlag, Berlin1993: 115-130Google Scholar) was the starting material. The PRS314-JCTEF2 vectors all contain the wild-type eEF1A promoter in the wild-type settings in front of the coding region. All the cloning took place in XL1-Blue (Stratagene) cells. The single-stranded DNA is recovered from the PRS314-JCX phagemid (JCX indicates a generic mutant X; in a specific mutant, X will be substituted with a number), which can be secreted as single-stranded DNA in the presence of M13 helper phage VCSM13 (Stratagene). The Sculptor IVM from Amersham Pharmacia Biotech was used for mutagenesis. XL1-Blue cells were eletroporated according to Bio-Rad's Gene Pulser apparatus protocol. The mutants were identified by the desired color change of the colonies, according to the usage of the second oligonucleotide in the mutagenesis reaction (13Cavallius J. Popkie A.P. Merrick W.C. Biochim. Biophys. Acta. 1997; 1350: 345-358Crossref PubMed Scopus (22) Google Scholar). Plasmid preparations were made using the Promega Wizard Minipreps DNA purification system. Restriction digests were made as a first confirmation of the mutants. For the N153D mutant, digestion with the endonuclease SalI lacked a band compared with the wild-type digest when the digested plasmids were run on a standard agarose gel. For the mutants N153T and all three mutants at position 156 (D156N, D156E, and D156W), the identifications were performed using the restriction enzymesHincII and Tth111 I, respectively. Final sequencing of the mutants was performed using the DNA Sequenase kit version 2.0 (United States Biochemical) with [35S]dATP (Amersham). Sequencing gels were made with premixed Long Ranger (AT Biochem). LiCH3CO2-washed M213 yeast were prepared as described before (1Cavallius J. Merrick W.C. Dickey B.F. Birnbaumer L. Handbook of Experimental Pharmacology. 108/I. Springer-Verlag, Berlin1993: 115-130Google Scholar). Aliquots of 200 μl were stored at the vapor temperature of liquid nitrogen. Just before use, cells was thawed on ice and mixed with up to 5 μg of DNA and 200 μg of salmon sperm carrier DNA (Sigma) in a maximum volume of 20 μl. The mixture was incubated for 30 min at 30 °C with agitation. Then, 1.2 ml of 40% PEG-4000, 0.1 m LiCH3CO2, 10 mm Tris-HCl, pH 7.5, and 1 mm EDTA was added and incubated for 30 min at 30 °C with agitation. Heat shock for 15 min was performed at 42 °C in a water bath. The cells were centrifuged for 5 s and washed twice with 0.5 ml of TE, pH 7.5. Finally, the cells were resuspended in 300 μl of TE, pH 7.5, and 100 μl was plated on selective supplemented minimal medium (SMM) plates (the rest was saved at 4 °C). Normally, it took 1½ to 2 days of incubation at 30 °C until transformants appeared. The strategy for in vivo analysis of altered eEF1A genes (TEF1 and TEF2) in yeast involves the use of plasmid shuffle. The strain M213 (genotype: Mata leu2–3, 112 Dtef1::LEU2 tef2-D2 lys2–20 his4–713 met2–1 ura3–52 trp1-D1 (YCpMS29 (TEF2, URA3))) served as the recipient for transformation (13Cavallius J. Popkie A.P. Merrick W.C. Biochim. Biophys. Acta. 1997; 1350: 345-358Crossref PubMed Scopus (22) Google Scholar, 14Sandbaken M.G. Culbertson M.R. Genetics. 1988; 120: 923-934Crossref PubMed Google Scholar). This strain contains nonfunctional chromosomal copies of both TEF1 and TEF2. This genotype is normally lethal due to the absence of TEF function, but viability is maintained by the presence of a yeast centromeric plasmid carrying a wild-type TEF2 gene. This strain has a growth rate identical to yeast strains with chromosomal copies of TEF2. The plasmid carrying the TEF2 gene is never lost because it is required for viability. Due to the CEN (yeast centromere sequence) and ARS (autonomously replicating sequences) elements in the PRS314 vectors, they are mitotically stable (15Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). The selectable markers TRP1 and URA3 in PRS314 and YCpMS29, respectively, have the following functions. TRP1 is a tryptophan auxotrophic marker, and URA3 is a 5-fluoro-orotic acid (5-FOA) marker used to select against URA3-containing plasmids in the final test of the mutagenesis productsin vivo. The plasmid shuffle was carried out as described earlier (13Cavallius J. Popkie A.P. Merrick W.C. Biochim. Biophys. Acta. 1997; 1350: 345-358Crossref PubMed Scopus (22) Google Scholar). In short, yeast strain M213 can be transformed with plasmid PRS314-JCTEF2 to a Trp+ phenotype. The resulting transformant will harbor two plasmids, one (YCpMS29) carrying wild-type TEF2 and URA3 and the other, PRS314-JCX, carrying mutagenized TEF2 and TRP1. In the plasmid shuffle, colonies are first screened for the Trp+ phenotype, indicating the presence of the plasmid carrying the mutagenized TEF2. If the TEF2 gene product were dominant lethal (negative), no Trp+ phenotypes would be observed. This did not occur with the mutants tested. The ability of the mutagenized TEF2 gene to support viability was then tested on 5-FOA plates. In the presence of the URA3 gene product, 5-FOA turns into a potent toxin for the cell (13Cavallius J. Popkie A.P. Merrick W.C. Biochim. Biophys. Acta. 1997; 1350: 345-358Crossref PubMed Scopus (22) Google Scholar). The M213 strain used as host in these studies harbors the plasmid YCpMS29 carrying TEF2 and URA3. By selecting on 5-FOA medium, only colonies that have lost the YCpMS29 plasmid, and thereby lost the URA3 gene, will survive. At the same time, these colonies will only survive if they have gained a viable copy of the TEF2 gene via the transfected PRS314-JCX plasmid. This procedure allows the determination of whether the mutagenized gene can support growth of yeast in the absence of wild-type eEF1A. If no Trp+ colonies are observed (which was only the case for the N153D mutant, JC2), this means that the mutagenized TEF2 gene cannot support growth and substitute for wild-type eEF1A. Purification of eEF1A was performed according to a scheme modified from Carvalho et al. (16Carvalho J.F. Carvalho M.D. Merrick W.C. Arch. Biochem. Biophys. 1984; 234: 591-602Crossref PubMed Scopus (42) Google Scholar). After several passages on 5-FOA plates (except for the N153D, JC2, mutant), the mutant yeast strains were grown in standard YPD media to an A 600 of 2.5, concentrated by centrifugation (15 min at 4,000 × g), and stored as a cell pellet at liquid nitrogen vapor temperature until purification was started. The JC2, N153D mutant did not support growth alone, so it was passaged on SMM (17Rose M.D. Winston F. Hieter P. Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1990Google Scholar) plates and grown in SMM medium at 30 °C. All operations were carried out at 4 °C as described earlier (13Cavallius J. Popkie A.P. Merrick W.C. Biochim. Biophys. Acta. 1997; 1350: 345-358Crossref PubMed Scopus (22) Google Scholar) unless stated otherwise. In short, cell-free extracts were prepared in a glass bead blender (Biospec Products, Inc., Bartlesville, OK) with start buffer (60 mm Tris-HCl, pH 7.5, 50 mmNH4Cl, 5 mm MgCl2, 10% glycerol, 1 mm dithiothreitol (DTT), 0.1 mm EDTA, pH 8.0, 1 μl/ml aprotinin, and 0.2 mm phenylmethylsulfonyl fluoride). Cell debris was removed by centrifugation at 12,000 ×g for 20 min. The supernatant was added to DEAE-cellulose (DE52, Whatman) pre-equilibrated with buffer 1 (20 mmTris-HCl, pH 7.5, 25% glycerol, 1 mm DTT, 0.1 mm EDTA, pH 8.0, 1 μl/ml aprotinin, and 0.2 mm phenylmethylsulfonyl fluoride) with 100 mmKCl. The unbound material and the wash were added to phosphocellulose (P-11, Whatman) pre-equilibrated with buffer 1 with 100 mmKCl. The phosphocellulose slurry was washed with buffer 1 with 100 mm KCl and then made 0.5 m KCl by adding solid KCl. The released material and wash was dialyzed overnight to yield a dialyzed solution that was 50 mm with respect to KCl. The supernatant was applied to a CM-cellulose column (CM52, carboxymethyl cellulose, Whatman) pre-equilibrated with buffer 1 with 50 mm KCl. The column was eluted with a linear salt gradient (total of 10 × column volume) from 50 to 300 mm KCl in buffer 1. Purity, as checked by SDS-polyacrylamide gel electrophoresis, was found to be approximately 98%. The DKMD mutant (JC2), purified as described above, was dialyzed overnight in buffer 1 with 100 mm KCl and 1 mmMg(CH3CO2)2. The dialyzed solution was mixed for 1 h at 4 °C with GTP-agarose pre-equilibrated with buffer 1 with 100 mm KCl and 1 mmMg(CH3CO2)2. The slurry was packed into a 0.9 × 14-cm column. The run-through was collected and reapplied to the column at a flow rate of 5 ml/h. The column was washed with buffer 1 with 100 mm KCl and 1 mmMg(CH3CO2)2. The wash-through, containing the mutant JC2, DKMD, was concentrated on a phosphocellulose column pre-equilibrated with buffer 1 with 100 mm KCl. Protein was eluted from the phosphocellulose in buffer 1 with 1m KCl and dialyzed in buffer 1 to give a final salt concentration of 100 mm KCl. The wild-type eEF1A was eluted off the GTP-agarose column with buffer 1 with 1 m KCl and 1 mm Mg(CH3CO2)2 and likewise dialyzed. The in vitro assays were performed as described by Carvalho et al. (18Carvalho M.D. Carvalho J.F. Merrick W.C. Arch. Biochem. Biophys. 1984; 234: 603-611Crossref PubMed Scopus (68) Google Scholar) and Cavallius et al.(13Cavallius J. Popkie A.P. Merrick W.C. Biochim. Biophys. Acta. 1997; 1350: 345-358Crossref PubMed Scopus (22) Google Scholar). In short, 50-μl reactions contained 20 mm Tris-HCl (pH 7.5), 10 mmMg(CH3CO2)2, 100 mmKCl, 1 mm DTT, 0.3 A 260 unit poly(U), 1 mm GTP, 2 mm phosphoenolpyruvate, 0.2 IU pyruvate kinase, 0.7 A 260 unit salt-washed ribosomes, 10 pmol of [14C]Phe-tRNA (specific activity, 479 Ci/mol), 0.8 μg of eEF2, and various amounts of purified eEF1A. For some experiments, the GTP was substituted with other nucleotides at the indicated concentration. In the assay containing [3H]Leu-tRNA, the amount of [3H]Leu-tRNA added was 10 pmol (specific activity, 179 Ci/mmol). The incubations were for 6 min at 37 °C unless indicated otherwise. [14C]Polyphenylalanine was precipitated with 10% cold trichloroacetic acid and then heated to 90 °C for 15 min, and cooled precipitates were collected by vacuum filtration onto Millipore filters (type HA). Radioactivity was determined by liquid scintillation spectrometry. Binding assays either with GTP or GDPNP (a nonhydrolyzable analogue of GTP) were performed under conditions similar to the poly(U) assay described above but with the following alterations. GTP or GDPNP was added at a concentration of 1 mm. Incubation was 10 min at 37 °C. Quantitation of [14C]Phe-tRNA bound to ribosomes was determined as retention on nitrocellulose filters (Millipore filters, type HA) (18Carvalho M.D. Carvalho J.F. Merrick W.C. Arch. Biochem. Biophys. 1984; 234: 603-611Crossref PubMed Scopus (68) Google Scholar). Use of GDPNP in this assay allowed for the determination of the number of active eEF1A molecules, as the eEF1A acts stoichiometrically, not catalytically, under these conditions. The samples were transferred to nitrocellulose and washed with wash buffer (20 mm Tris-HCl (pH 7.5), 10 mm Mg(CH3CO2)2, 100 mm KCl). The amount of [14C]Phe-tRNA retained on the filters was determined by liquid scintillation spectrometry. GTPase activity was measured as described by Merrick (19Merrick W.C. Methods Enzymol. 1979; 60: 108-123Crossref PubMed Scopus (79) Google Scholar) with the following modifications. Hydrolysis of [γ-32P]GTP was performed in a 20-μl reaction containing 25 mm Hepes, pH 7.5, 125 mm KCl, 8.5 mm MgCl2, 1 mm DTT, 6.25% glycerol, 15 pmol of eEF1A, 100 μm GTP, and, when indicated, 10 pmol of aminoacyl-tRNA (all 20 amino acids) and/or 0.7A 260 units of sucrose cushion ribosomes and/or 0.15 A 260 units of poly(U). The reaction mixture was incubated for 15 min at 37 °C and then placed on ice; the following additions were then made in order: (a) 0.5 ml of 20 mm silicotungstate in 20 mmH2SO4; (b) 1.2 ml of 1 mm K2HPO4, pH 7.0; (c) 0.5 ml of 5% ammonium molybdate in 4 mH2SO4; and (d) 0.3 ml of 5% trichloroacetic acid:acetone (1:1). After these additions, the free [γ-32P] was extracted with 2 ml of isobutanol:benzene (1:1), and the liquids were mixed by vortexing for 30 s. After centrifugation for 3 min at 1500 rpm in a Beckman model TJ-6 centrifuge at 4 °C, a 1-ml aliquot of the organic (upper) phase was removed and mixed with CytoScint from ICN. The amount of hydrolyzed [γ-32P]GTP was determined by liquid scintillation spectrometry. The target for site-directed mutagenesis was the NKMD sequence of eEF1A, known as the nucleotide specificity sequence. Fig. 1 A shows how in EF1A the hydrogen bonding pattern can account for the observed specificity of EF1A for GTP (2Kjeldgaard M. Nyborg J. J. Mol. Biol. 1992; 223: 721-742Crossref PubMed Scopus (249) Google Scholar). Given the 50% sequence identity of eEF1A to EF1A in the GTP binding domain, domain 1, we have assumed that a similar hydrogen bonding pattern exists in eEF1A. As with the binding of ATP, there are other hydrogen bonds or salt bridges with the ribose and phosphate moieties, but these are not shown as they do not contribute to nucleotide specificity. The numerous hydrogen bond possibilities likely account for the fact that the K d for GTP in G proteins (GTP-binding proteins associated with signal transduction) is often about 1 μm, whereas that for ATP-utilizing proteins is in the 50–500 μm range. A proof of the hydrogen bonding pattern was tested by Hwang and Miller (11Hwang Y.W. Miller D.L. J. Biol. Chem. 1987; 262: 13081-13085Abstract Full Text PDF PubMed Google Scholar) who changed the NKXD sequence to NKXN. As illustrated in Fig. 1 B, this allows for the same network of hydrogen bonds but with the nucleotide XTP, not GTP. In their studies, the EF1A NKXN mutant had the same affinity for XTP as the wild-type protein did for GTP. However, the NKXN mutant of EF1A was unable to support the growth of E. coli as the sole source of the elongation factor. We have decided to try a similar experiment in eukaryotic cells to see if it was possible to isolate and purify mutant eEF1A proteins. As a number of investigators have been unable to express eEF1A in soluble form in E. coli, we chose to use the yeast protein and purify the expressed proteins from yeast. In addition, we have attempted to alter the nucleotide specificity of the eEF1A based upon the observation of some differences in the NKXD nucleotide specificity sequence that have been reported for a number of proteins that utilize GTP (24Dever T.E. Glynias M.J. Merrick W.C. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 1814-1818Crossref PubMed Scopus (467) Google Scholar). These changes are indicated in Table I. The wild-type NKXD and the mutant NKXN sequences were discussed above. The NKXW sequence is found in two enzymes, phosphoenolpyruvate carboxykinase and GTP:AMP phosphotransferase. Both of these proteins will use ITP as well as GTP. The TKXE sequence is found in the enzyme guanyltransferase. Here, one could imagine that because the glutamic acid residue is one methylene group longer than aspartic acid, a compensatory shortening would have to occur at the position normally occupied by asparagine. In this instance, the threonine residue provides the hydroxyl group, and this group is one methylene group closer to the main chain. Thus, one would expect to maintain the GTP specificity, although the possible loss of one or more of the hydrogen bonds labeled G, F, or H in Fig. 1 A might result in a slight increase in the K d or K m for GTP. Finally, it was thought that the substitution of an aspartic acid in place of the asparagine would weaken the binding for GTP and perhaps even allow a hydrogen bond between the aspartic acid and the 6-amino group of ATP. Thus, these substitutions were made in yeast eEF1A, and the yeast strains were analyzed for growth on nonselective media, where both the wild-type and mutant eEF1A would be expressed, and on selective media (5-FOA), where the mutant eEF1A would be the sole source of the eEF1A.Table IAnticipated nucleotide specificityAmino acid sequenceExpected nucleotide specificityStrain nameNKMD1-aThis is the wild-type eEF1A sequence (25).GTPWild typeNKXN1-bBy analogy to the crystal structure and experiments involving EF1A (11, 12).XTPJC6NKXW1-cBy analogy to cytosolic phosphoenol pyruvate carboxykinase (26) and GTP:AMP phosphotransferase (27).GTP or ITPJC33TKXE1-dBy analogy to reovirus guanyltransferase (28).GTPJC5 and JC32DKXDATPJC2Nucleotide binding specificity sequences from different proteins and their found or expected nucleotide specificity. The letter Xindicates that any of the 20 amino acids could be in this position.1-a This is the wild-type eEF1A sequence (25Cavallius J. Zoll W. Chakraburtty K. Merrick W.C. Biochim. Biophys. Acta. 1993; 1163: 75-80Crossref PubMed Scopus (60) Google Scholar).1-b By analogy to the crystal structure and experiments involving EF1A (11Hwang Y.W. Miller D.L. J. Biol. Chem. 1987; 262: 13081-13085Abstract Full Text PDF PubMed Google Scholar, 12Weijland A. Parlato G. Parmeggiani A. Biochemistry. 1994; 33: 10711-10717Crossref PubMed Scopus (38) Google Scholar).1-c By analogy to cytosolic phosphoenol pyruvate carboxykinase (26Stoffel M. Xiang K.S. Espinosa R.D. Cox N.J. Le B.M. Bell G.I. Hum. Mol. Genet. 1993; 2: 1-4Crossref PubMed Scopus (22) Google Scholar) and GTP:AMP phosphotransferase (27Yamada M. Shahjahan M. Tanabe T. Kishi F. Nakazawa A. J. Biol. Chem. 1989; 264: 19192-19199Abstract Full Text PDF PubMed Google Scholar).1-d By analogy to reovirus guanyltransferase (28Seliger L.S. Zheng K. Shatkin A.J. J. Biol. Chem. 1987; 262: 16289-16293Abstract Full Text PDF PubMed Google Scholar). Open table in a new tab Nucleotide binding specificity sequences from different proteins and their found or expected nucleotide specificity. The letter Xindicates that any of the 20 amino acids could be in this position. Table II presents the characteristics of the yeast strains with mutant eEF1A species. All of the yeast strains that contained both host and mutant eEF1A were viable, indicating that none of the mutant eEF1As were behaving as dominant negative mutants. When grown on selective media, only the DKMD mutant, JC2, failed to grow, although the NKMW mutant, JC33, did display a temperature-sensitive phenotype with wild-type growth rates at or below 18 °C and no growth at elevated temperatures. Within experimental error, the yeast strains containing just the mutant form of eEF1A grew in liquid media at wild-type growth rates. Similarly, growth on alternate carbon sources (glycerol, lactose, or sucrose) did not show any difference between yeast with the wild-type or mutant eEF1As (data not shown).Table IISite-directed mutants of eEF1AMutant yeast amino acid no.2-aMutant designation: wild-type amino acid-residue number-mutant amino acid.Expected nucleotide specificityIn yeast2-bTS, temperature-sensitive. "Lethal" indicates whether the presence of the mutant eEF1A causes the strain not to grow (i.e., dominant negative phenotype). "Viable" indicates whether the mutant eEF1A was able to allow growth of the yeast as the sole source of eEF1A.Doubling time as % of wild type2-cDoubling time of wild type was 135 min at 30 °C.Yeast strainLethalViableWild type[eEF1A on URA-3 YCpMS29]NoYes100M213Wild type[eEF1A on TRP-1 YCpMS41]NoYes100M214N153T, D156ENo change (NKMD to TKME)NoYes100JC32N153DGTP to ATP (NKMD to DKMD)NoNoJC2N153TNo change (NKMD to TKMD)NoYes114JC5D156WGTP to ITP/GTP (NKMD to NKMW)NoTS1132-dWild-type doubling time at 18 °C was 310 min.JC33D156NGTP to XTP/GTP (NKMD to NKMN)NoYes107JC6Site-directed mutagenesis of yeast eEF1A in the nucleotide specificity sequence NKMD.2-a Mutant designation: wild-type amino acid-residue number-mutant amino acid.2-b TS, temperature-sensitive. "Lethal" indicates whether the presence of the mutant eEF1A causes the strain not to grow (i.e., dominant negative phenotype). "Viable" indicates whether the mutant eEF1A was able to allow growth of the yeast as the sole source of eEF1A.2-c Doubling time of wild type was 135 min at 30 °C.2-d Wild-type doubling time at 18 °C was 310 min. Open table in a new tab Site-directed mutagenesis of yeast eEF1A in the nucleotide specificity sequence NKMD. To examine the nucleotide specificity of the eEF1A species, the proteins were purified as described previously except for the DKMD mutant eEF1A. As yeast containing only this form of eEF1A were not viable, the yeast containing both the mutant and wild-type eEF1A were grown. The eEF1A was purified, and the
Referência(s)