Tracking Cell Surface GABAB Receptors Using an α-Bungarotoxin Tag
2008; Elsevier BV; Volume: 283; Issue: 50 Linguagem: Inglês
10.1074/jbc.m803197200
ISSN1083-351X
AutoresMegan E. Wilkins, Xinyan Li, Trevor G. Smart,
Tópico(s)Nicotinic Acetylcholine Receptors Study
ResumoGABAB receptors mediate slow synaptic inhibition in the central nervous system and are important for synaptic plasticity as well as being implicated in disease. Located at pre- and postsynaptic sites, GABAB receptors will influence cell excitability, but their effectiveness in doing so will be dependent, in part, on their trafficking to, and stability on, the cell surface membrane. To examine the dynamic behavior of GABAB receptors in GIRK cells and neurons, we have devised a method that is based on tagging the receptor with the binding site components for the neurotoxin, α-bungarotoxin. By using the α-bungarotoxin binding site-tagged GABAB R1a subunit (R1aBBS), co-expressed with the R2 subunit, we can track receptor mobility using the small reporter, α-bungarotoxin-conjugated rhodamine. In this way, the rates of internalization and membrane insertion for these receptors could be measured with fixed and live cells. The results indicate that GABAB receptors rapidly turnover in the cell membrane, with the rate of internalization affected by the state of receptor activation. The bungarotoxin-based method of receptor-tagging seems ideally suited to follow the dynamic regulation of other G-protein-coupled receptors. GABAB receptors mediate slow synaptic inhibition in the central nervous system and are important for synaptic plasticity as well as being implicated in disease. Located at pre- and postsynaptic sites, GABAB receptors will influence cell excitability, but their effectiveness in doing so will be dependent, in part, on their trafficking to, and stability on, the cell surface membrane. To examine the dynamic behavior of GABAB receptors in GIRK cells and neurons, we have devised a method that is based on tagging the receptor with the binding site components for the neurotoxin, α-bungarotoxin. By using the α-bungarotoxin binding site-tagged GABAB R1a subunit (R1aBBS), co-expressed with the R2 subunit, we can track receptor mobility using the small reporter, α-bungarotoxin-conjugated rhodamine. In this way, the rates of internalization and membrane insertion for these receptors could be measured with fixed and live cells. The results indicate that GABAB receptors rapidly turnover in the cell membrane, with the rate of internalization affected by the state of receptor activation. The bungarotoxin-based method of receptor-tagging seems ideally suited to follow the dynamic regulation of other G-protein-coupled receptors. γ-Aminobutyric acid (GABA) 2The abbreviations used are: GABA, γ-amino butyric acid; GPCR, G-protein-coupled receptor; PBS, phosphate-buffered saline; BBS, α-bungarotoxin binding site; BTX, α-bungarotoxin; FITC, fluorescein isothiocyanate; TRITC, tetramethylrhodamine isothiocyanate; ROI, region of interest; GFP, green fluorescent protein. is the major inhibitory neurotransmitter in the central nervous system (CNS) activating ionotropic GABAA/C, as well as the metabotropic GABAB receptor. GABAB receptors are expressed in all major brain structures (1.Benke D. Honer M. Michel C. Bettler B. Mohler H. J. Biol. Chem. 1999; 274: 27323-27330Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar, 2.Fritschy J.M. Meskenaite V. Weinmann O. Honer M. Benke D. Mohler H. Eur. J. Neurosci. 1999; 11: 761-768Crossref PubMed Scopus (282) Google Scholar, 3.Fritschy J.M. Sidler C. Parpan F. Gassmann M. Kaupmann K. Bettler B. Benke D. J Comp Neurol. 2004; 477: 235-252Crossref PubMed Scopus (52) Google Scholar) and are important for synaptic plasticity as well as having therapeutic implications for epilepsy, pain, spasticity, drug addiction, schizophrenia, depression, and anxiety (4.Enna S.J. Bowery N.G. Biochem. Pharmacol. 2004; 68: 1541-1548Crossref PubMed Scopus (67) Google Scholar). The trafficking and cell surface mobility of ligand-gated GABAA receptors has been studied using reporter tags with electrophysiological (5.Thomas P. Mortensen M. Hosie A.M. Smart T.G. Nat. Neurosci. 2005; 8: 889-897Crossref PubMed Scopus (150) Google Scholar) or imaging approaches (6.Bogdanov Y. Michels G. Armstrong-Gold C. Haydon P.G. Lindstrom J. Pangalos M. Moss S.J. EMBO J. 2006; 25: 4381-4389Crossref PubMed Scopus (147) Google Scholar, 7.Luscher B. Keller C.A. Pharmacol. Ther. 2004; 102: 195-221Crossref PubMed Scopus (226) Google Scholar). However, the mobility and trafficking of extrasynaptic GABAB receptors has provided diverse results (8.Fairfax B.P. Pitcher J.A. Scott M.G. Calver A.R. Pangalos M.N. Moss S.J. Couve A. J. Biol. Chem. 2004; 279: 12565-12573Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar, 9.Grampp T. Sauter K. Markovic B. Benke D. J. Biol. Chem. 2007; 282: 24157-24165Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 10.Pooler A.M. McIlhinney R.A.J. J. Biol. Chem. 2007; 282: 25349-25356Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar, 11.Laffray S. Tan K. Dulluc J. Bouali-Benazzouz R. Calver A.R. Nagy F. Landry M. Eur. J Neurosci. 2007; 25: 1402-1416Crossref PubMed Scopus (29) Google Scholar). The GABAB receptor is a heterodimeric G-protein-coupled receptor (GPCR), requiring R1 and R2 subunits to co-assemble before trafficking to the cell surface to form functional receptors. The R1 subunit possesses an ER retention motif that is masked by binding to the R2 subunit (12.Margeta-Mitrovic M. Jan Y.N. Jan L.Y. Neuron. 2000; 27: 97-106Abstract Full Text Full Text PDF PubMed Scopus (586) Google Scholar, 13.Bettler B. Kaupmann K. Mosbacher J. Gassmann M. Physiol. Rev. 2004; 84: 835-867Crossref PubMed Scopus (688) Google Scholar, 14.Couve A. Filippov A.K. Connolly C.N. Bettler B. Brown D.A. Moss S.J. J. Biol. Chem. 1998; 273: 26361-26367Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar). Although, generally, GPCRs are readily internalized from the cell surface following agonist activation and receptor phosphorylation (15.Marchese A. Paing M.M. Temple B.R. Trejo J. Annu. Rev. Pharmacol. Toxicol. 2008; 48: 601-629Crossref PubMed Scopus (353) Google Scholar, 16.Moore C.A. Milano S.K. Benovic J.L. Annu. Rev. Physiol. 2007; 69: 451-482Crossref PubMed Scopus (527) Google Scholar, 17.Hanyaloglu A.C. Zastrow M.v. Annu. Rev. Pharmacol. Toxicol. 2008; 48: 537-568Crossref PubMed Scopus (472) Google Scholar); the GABAB receptor was thought to behave differently, being relatively stable in the cell membrane (8.Fairfax B.P. Pitcher J.A. Scott M.G. Calver A.R. Pangalos M.N. Moss S.J. Couve A. J. Biol. Chem. 2004; 279: 12565-12573Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar, 9.Grampp T. Sauter K. Markovic B. Benke D. J. Biol. Chem. 2007; 282: 24157-24165Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). However, other reports indicate that agonist activation of GABAB receptors may promote internalization and/or rapid recycling (10.Pooler A.M. McIlhinney R.A.J. J. Biol. Chem. 2007; 282: 25349-25356Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar, 11.Laffray S. Tan K. Dulluc J. Bouali-Benazzouz R. Calver A.R. Nagy F. Landry M. Eur. J Neurosci. 2007; 25: 1402-1416Crossref PubMed Scopus (29) Google Scholar, 18.Gonzalez-Maeso J. Wise A. Green A. Koenig J.A. Eur. J. Pharmacol. 2003; 481: 15-23Crossref PubMed Scopus (24) Google Scholar). To address the topic of GABAB receptor trafficking, prior studies have used various techniques to monitor receptor movement, including: receptor biotinylation (8.Fairfax B.P. Pitcher J.A. Scott M.G. Calver A.R. Pangalos M.N. Moss S.J. Couve A. J. Biol. Chem. 2004; 279: 12565-12573Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar, 9.Grampp T. Sauter K. Markovic B. Benke D. J. Biol. Chem. 2007; 282: 24157-24165Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar); antibody labeling of extracellular GABAB receptor epitopes on live cells (9.Grampp T. Sauter K. Markovic B. Benke D. J. Biol. Chem. 2007; 282: 24157-24165Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar); as well as fluorescence recovery after photobleaching (FRAP) (10.Pooler A.M. McIlhinney R.A.J. J. Biol. Chem. 2007; 282: 25349-25356Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar). These methods have therefore relied on the use of relatively large reporter molecules, such as antibodies. Although such studies have revealed some aspects of trafficking behavior for GABAB receptors, there is still uncertainty regarding: how stable GABAB receptors are in the surface membrane; over what time scale they are likely to traffic; and whether trafficking observed in secondary cell lines is relevant to the movements of GABAB receptors in neurons. To address these questions, we adopted a different strategy, based on incorporating a minimal-size epitope into the R1a subunit of the GABAB receptor. This comprised a 13-amino acid α-bungarotoxin binding site (BBS) motif, which retains high affinity for its ligand (19.Harel M. Kasher R. Nicolas A. Guss J.M. Balass M. Fridkin M. Smit A.B. Brejc K. Sixma T.K. Katchalski-Katzir E. Sussman J.L. Fuchs S. Neuron. 2001; 32: 265-275Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). The mobility of GABAB receptors can then be tracked, in real time, using fluorescent derivatives of α-bungarotoxin (BTX), which is a small reporter molecule. This high affinity site has been previously incorporated into ligand-gated ion channels, including AMPA (20.Sekine-Aizawa Y. Huganir R.L. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 17114-17119Crossref PubMed Scopus (130) Google Scholar) and GABAA (6.Bogdanov Y. Michels G. Armstrong-Gold C. Haydon P.G. Lindstrom J. Pangalos M. Moss S.J. EMBO J. 2006; 25: 4381-4389Crossref PubMed Scopus (147) Google Scholar) receptors, to monitor their trafficking, but its use in GPCRs is unexplored. Here, we report that in HEK-293 cells, stably expressing inwardly rectifying Kir3.1 and 3.2 potassium channels (GIRK cells), and in hippocampal neurons expressing R1aBBSR2 subunits, the GABAB receptor undergoes quite rapid endocytosis and exocytosis. This indicates that the levels of this GPCR in the cell surface membrane are dynamically regulated, with implications for inhibitory synaptic plasticity. GABAB Receptor Containing the BTX-binding Site—Complementary DNA fragments for the 13 amino acid BBS (WRYYESSLEPYPD;(19)) were synthesized with the nucleotide sequences: CTAGCTGGAGATACTACGAGAGCTCCCTGGAGCCCTACCCTGACG (sense) and CTAGCGTCAGGGTAGGGCTCCAGGGAGCTCTCGTAGTATCTCCAG (anti-sense). BBS fragments were annealed and phosphorylated then subcloned into a NheI site that was introduced six amino acids after the start of the mature R1a subunit (Fig. 1A). cDNAs for the R1a and R2 subunits (21.Couve A. Thomas P. Calver A.R. Hirst W.D. Pangalos M.N. Walsh F.S. Smart T.G. Moss S.J. Nat. Neurosci. 2002; 5: 415-424Crossref PubMed Scopus (106) Google Scholar) were mutated to include epitope tags for Myc (R1a) or FLAG (R2) inserted four amino acids from the start of the mature proteins. cDNAs were subcloned into the pRK5 vector, sequenced, and analyzed using Sequencher 3.1. The α7/5HT3a chimeric receptor was provided by N. Millar (UCL). Cell Culture and Transfection—GIRK cells (22.Leaney J.L. Milligan G. Tinker A. J. Biol. Chem. 2000; 275: 921-929Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar) were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with penicillin-G/streptomycin (100 units/100 μg/ml; Invitrogen), 2 mm glutamine, 10%v/v fetal calf serum, and geneticin (0.5 mg/ml). These cells were transfected using a calcium phosphate method (23.Wilkins M.E. Hosie A.M. Smart T.G. J. Physiol. 2005; 567: 365-377Crossref PubMed Scopus (28) Google Scholar) with cDNAs (1 mg/ml) mixed in the following ratios: R1 (or R1BBS)/R2/EGFP reporter, 1:5:1, or for α7/5HT3a/EGFP reporter, 1:1. Primary hippocampal neurons were prepared from postnatal day 4 (P4) rat brains and plated onto poly-d-lysine-treated 22 mm glass coverslips (Assistence (5.Thomas P. Mortensen M. Hosie A.M. Smart T.G. Nat. Neurosci. 2005; 8: 889-897Crossref PubMed Scopus (150) Google Scholar)). Neurons were transfected at 6–8 DIV using a calcium phosphate method (Clontech). Patch Clamp Electrophysiology—Membrane currents were recorded, using whole cell patch clamp, from single GIRK cells as described previously (24.Kuramoto N. Wilkins M.E. Fairfax B.P. Revilla-Sanchez R. Terunuma M. Tamaki K. Iemata M. Warren N. Couve A. Calver A. Horvath Z. Freeman K. Carling D. Huang L. Gonzales C. Cooper E. Smart T.G. Pangalos M.N. Moss S.J. Neuron. 2007; 53: 233-247Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). Patch pipettes (3–5 MΩ) were filled with a solution containing (mm): 120 KCl, 2 MgCl2, 11 EGTA, 30 KOH, 10 HEPES, 1 CaCl2, 1 GTP, 2 ATP, 14 creatine phosphate, pH 7.0. The cells were continuously perfused with Krebs solution containing (mm): 140 NaCl, 4.7 KCl, 1.2 MgCl2, 2.5 CaCl2, 11 glucose, and 5 HEPES, pH 7.4. To increase the size of the GABAB receptor-activated K+ currents and convert them to inward currents, prior to GABA application, the Krebs concentration of KCl was increased to 25 mm and that of NaCl reduced to 120 mm. This change altered EK from approximately -90 mV to -47mV. Peak amplitude GABA-activated K+ currents, were recorded from cells 48–72 h after transfection, at -70 mV holding potential and filtered at 5 kHz (-3dB, 6th pole Bessel, 36 dB/octave) before storage on a Dell Pentium III computer for analysis with Clampex 8. Changes >10% in the membrane input conductance or series resistance resulted in the recording being discarded. To construct GABA concentration-response relationships, the current (I) was measured in the presence of each concentration of GABA applied at 3-min intervals as described previously (24.Kuramoto N. Wilkins M.E. Fairfax B.P. Revilla-Sanchez R. Terunuma M. Tamaki K. Iemata M. Warren N. Couve A. Calver A. Horvath Z. Freeman K. Carling D. Huang L. Gonzales C. Cooper E. Smart T.G. Pangalos M.N. Moss S.J. Neuron. 2007; 53: 233-247Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). The currents were normalized to the maximum GABA response (Imax) and the concentration response relationship fitted with the Hill equation (24.Kuramoto N. Wilkins M.E. Fairfax B.P. Revilla-Sanchez R. Terunuma M. Tamaki K. Iemata M. Warren N. Couve A. Calver A. Horvath Z. Freeman K. Carling D. Huang L. Gonzales C. Cooper E. Smart T.G. Pangalos M.N. Moss S.J. Neuron. 2007; 53: 233-247Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). Drugs and solutions were rapidly applied to the cells using a modified Y-tube, positioned ∼200–300 μm from the recorded cell. Inhibition concentration response curves, for the antagonist CGP55845, were fitted to Equation 1, I/Imax=1-[1/(1+(IC50/[B])nH)](Eq. 1) where the IC50 is the antagonist concentration (B) eliciting half-maximal inhibition of the GABA-activated potassium current. For the analysis of GABA-activated potassium current run-down, current amplitudes were measured at 3-min intervals, in the absence or presence of 3 μg/ml BTX-Rhd (Molecular Probes), and the resulting time stability relationships were fitted with a single exponential function as described previously (24.Kuramoto N. Wilkins M.E. Fairfax B.P. Revilla-Sanchez R. Terunuma M. Tamaki K. Iemata M. Warren N. Couve A. Calver A. Horvath Z. Freeman K. Carling D. Huang L. Gonzales C. Cooper E. Smart T.G. Pangalos M.N. Moss S.J. Neuron. 2007; 53: 233-247Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). The best fits to the data were determined using a Marquardt nonlinear least squares routine (Origin 6). Immunocytochemistry—Transfected GIRK cells were fixed 48 h after transfection. Briefly, cells were washed twice with a phosphate-buffered saline (PBS, Sigma). BTX-Rhd was applied for different times and/or at different concentrations, in the absence or presence of unlabeled BTX. The cells were then fixed with 4% PFA for 15 min and quenched with NH4Cl (50 mm; VWR), for 10 min, prior to adhering the coverslips to slides using glycerol/gelatin (Sigma). When antibodies were added, cells were permeabilized with 0.1% v/v Triton X in 10% v/v blocking serum (see below). Cells were then incubated in 10% blocking serum (5% v/v horse (Invitrogen) and 5% v/v Donkey (Sigma) serum in PBS) for 25 min. Primary and secondary antibodies were diluted in 1.5% or 3% blocking serum, respectively. Antibodies against the C-terminal of the GABAB receptor R2 (guinea pig; 1:1000; Chemicon) were used in conjunction with a secondary Cy5 antibody (Donkey anti Guinea pig; Chemicon). Hippocampal neurons were transfected at 6–8DIV and fixed, as above, 6–8 days after transfection. We found that available N-terminal antibodies performed poorly in our immunoassays (see also Ref. 25.Correa S.A. Munton R. Nishimune A. Fitzjohn S. Henley J.M. Neuropharmacology. 2004; 47: 475-484Crossref PubMed Scopus (20) Google Scholar). Confocal Imaging—To image the fixed cells, a Zeiss Axioskop LSM 510 Meta Confocal microscope was used with a ×40/1.3 oil DIC objective and the following laser settings: FITC, 543 nm, 5% of maximum; TRITC, 633 nm, 80%; Cy5, 488 nm, 30%. The top and bottom of the cell was determined using a rapid z-stack scan, and a mid image of each cell was optimized and acquired with a mean of 8 scans, and stored for further analysis. Analysis of the confocal images was performed using Image J, where 3 regions of interest (ROI) were identified per cell (the cell surface membrane, intracellular compartment, and total cell fluorescence; see Fig. 2A, inset). Each pixel in the ROI was graded on a scale of 0 to 255 (max) and a mean fluorescence value was determined for the specific area (μm2) of interest. The background, a region where no cells were present, was subtracted from the ROI of each cell to give a normalized mean. To image live transfected neurons, PBS with 1 mm d-tubocurarine (d-TC) was applied for 2 min to block endogenous nicotinic ACh α7 subunit-containing receptors, and then with d-TC (1 mm) + BTX-Rhd (3 μg/ml) for 5 min to allow BTX-Rhd to bind to R1aBBSR2 receptors. Cells were washed (2×) with PBS, to remove any excess BTX-Rhd or d-TC, and superfused with Krebs, in a recording chamber, at either 37, 15, or at room temperature, 23 °C, by using a Peltier device. Transfected neurons were identified by the expression of GFP and images were scanned at specified time points using a Achroplan ×40/0.8 water DIC objective. Radioactive α-Bungarotoxin Binding Assay—To ascertain the apparent affinity of BTX for its binding site in the GABAB R1aBBSR2 receptor, binding studies with 125I-BTX (200Ci/mmol; Amersham Biosciences) to cell surface receptors were performed with intact cells. Transfected GIRK cells were washed twice in PBS and re-suspended in Hanks buffered salt solution (GIBCO) containing 0.5% bovine serum albumin (Sigma). Cells were incubated in radioligand for 60 min at room temperature, with gentle agitation, in a total volume of 150 μl. Nonspecific binding was determined by the addition of a 1000-fold higher concentration of unlabeled BTX (Molecular Probes). Radioligand binding was assayed by filtration onto 0.5% polyethylenimine pre-soaked Whatman GF/A filters, followed by rapid washing with PBS using a Brandel cell harvester. Filters were assayed in a Wallac 1261 gamma counter. Scatchard analysis with non linear regression was used to obtain Bmax and Kd values (Origin 6) with Equation 2. y=Bmax∗X(Kd+X)(Eq. 2) For comparison, the same analysis was used for GIRK cells expressing a chimeric α7/5HT3a receptor which is known to retain a high affinity BTX binding site (26.Eisele J.L. Bertrand S. Galzi J.L. Devillers-Thiery A. Changeux J.P. Bertrand D. Nature. 1993; 366: 479-483Crossref PubMed Scopus (361) Google Scholar). Engineering the BBS into the GABAB Receptor—Incorporating a high affinity binding site for BTX into ligand-gated ion channels has demonstrated its usefulness in allowing the tracking of receptor movements into and out of the cell membrane (6.Bogdanov Y. Michels G. Armstrong-Gold C. Haydon P.G. Lindstrom J. Pangalos M. Moss S.J. EMBO J. 2006; 25: 4381-4389Crossref PubMed Scopus (147) Google Scholar, 7.Luscher B. Keller C.A. Pharmacol. Ther. 2004; 102: 195-221Crossref PubMed Scopus (226) Google Scholar). To explore whether a similar strategy could be used to monitor GPCR trafficking, with their quite different transmembrane topologies, we engineered the N terminus of the R1a subunit of the GABAB receptor, to include a BBS (R1aBBS). To empirically maximize access for BTX to its binding site, the BBS was inserted just after the start of the mature protein (Fig. 1A), a position noted for GABAA receptors to be silent in terms of its impact on receptor structure and function (27.Connolly C.N. Krishek B.J. McDonald B.J. Smart T.G. Moss S.J. J. Biol. Chem. 1996; 271: 89-96Abstract Full Text Full Text PDF PubMed Scopus (293) Google Scholar). This region of the GABAB receptor was also deemed suitable since inserting a Myc epitope, just 4 amino acids from the start of the protein (upstream of the BBS), did not affect receptor function (21.Couve A. Thomas P. Calver A.R. Hirst W.D. Pangalos M.N. Walsh F.S. Smart T.G. Moss S.J. Nat. Neurosci. 2002; 5: 415-424Crossref PubMed Scopus (106) Google Scholar). The R1a subunit used here contained both Myc and BBS epitopes. To determine if the R1aBBS subunit could bind α-bungarotoxin-rhodamine (BTX-Rhd) in vitro, GIRK cells were transfected with cDNAs encoding for: R1aBBS/R2/GFP; or the nicotinic/5-HT3a receptor chimera, α7/5HT3a/GFP (control for BTX binding); or GFP (negative control). The chimera was used to enhance the surface expression of bungarotoxin-binding α7 receptors, which is quite poor otherwise in HEK cells. After allowing receptor expression for 48 h, exposure to 3 μg/ml BTX-Rhd for 10 min, revealed prominent cell surface immunoreactivity for both the R1aBBSR2 and α7/5HT3a receptors. By contrast, no surface-specific BTX-Rhd immunoreactivity was observed on GFP-only transfected cells (Fig. 1B). Activation of Kir3.1 and 3.2 by GABAB R1aBBSR2 Receptors—The effect of the BBS on the GABAB receptor functional properties was studied using GIRK cells and patch clamp electrophysiology. The activation of Kir 3.1 and 3.2 channels by GABA was used to construct concentration response curves for wild-type (R1aR2) and mutant R1aBBSR2 GABAB receptors in the presence and absence of 3 μg/ml BTX-Rhd (Fig. 1C). There was no significant shift in the concentration response curves, or the potency of GABA, determined from the EC50 values for the R1aBBSR2 receptor in the presence (0.48 ± 0.06 μm) or absence (0.36 ± 0.05 μm) of BTX-Rhd, compared with the wild-type receptor (0.43 ± 0.05 μm; n = 5–11; p > 0.05; Fig. 1C). In addition, antagonism by the competitive GABAB antagonist CGP55845 at R1aBBSR2 was minimally affected by the BBS (Fig. 1D) with only a small increase in the IC50 at R1aBBSR2 (118 ± 14 nm) compared with wild type (50 ± 6 nm). The time-dependent stability of GABA-activated potassium currents was assessed by sequential applications of GABA, at 3-min intervals. By comparison with wild-type receptors, the effect of the BBS was assessed in R1aBBSR2 receptors by either using a 10-min pretreatment with BTX-Rhd or by applying BTX-Rhd for 3 min following the first two sequential GABA applications. With each protocol, the BBS appeared silent as there was no significant difference in the run-down profiles of either of the BTX-Rhd treated receptors compared with the wild-type receptors (Fig. 1E). The run-down of currents could be fitted with a single exponential providing time constants of: 2.9 ± 0.8 min (wild-type); 4.2 ± 0.7 min (R1aBBSR2 + 10 min BTX-Rhd pretreatment); and 2.3 ± 0.3 min (R1aBBSR2 + BTX-Rhd treatment after the first two sequential GABA applications). These results suggested that the incorporation of the BBS into the N terminus of the GABAB R1a subunit, when expressed with the R2 subunit, did not alter the activation or pharmacological profiles of this receptor. Similarly, the addition of BTX-Rhd, which binds to the BBS on the N terminus of the R1aBBS subunit, did not impact on the function of the receptor. Overall, this indicates that the inserted BBS has the capability to operate as a functionally silent reporter of GABAB receptor trafficking. BTX Binding to the R1aBBS Subunit—To determine the apparent affinity of BTX-Rhd for the BBS in R1a subunits, GIRK cells were transfected with cDNAs encoding for: R1aBBSR2/GFP; or α7/5HT3a/GFP; or just GFP. Cells were exposed for 10 min to increasing concentrations of BTX-Rhd before fixation with PFA. BTX-Rhd concentration cell surface fluorescence curves were constructed to deduce the apparent affinities of BTX-Rhd for these receptors, as well as for GFP (negative control; Fig. 2A). Receptors on or near the cell surface were determined by having an ROI, which incorporated just the surface fluorescence of the cell thus, providing mean fluorescence values that accounted for cell size (Fig. 2A, inset). The BTX-Rhd concentration-fluorescence curves, using mean cell surface fluorescence, were normalized to the mean maximum fluorescence obtained from the α7/5HT3a positive controls exposed to 300 nm BTX-Rhd. The EC50 for BTX on the R1aBBSR2 receptor (52 ± 18 nm) was ∼80-fold greater when compared with that for the α7/5HT3a receptor (0.8 ± 0.1 nm; n = 8–12), indicating that the affinity of BTX for the BBS in GABAB receptors was lower than that for the site in α7/5HT3a receptor. The GFP-only expressing GIRK cells did not exhibit any concentration-dependent specific cell surface binding of the BTX-Rhd (Fig. 2A). To further evaluate the affinity of BTX for the R1aBBSR2 receptor, radioligand binding studies were performed with 125I-BTX. Increasing concentrations of 125I-BTX were applied to GIRK cells, expressing either R1aBBSR2 or α7/5HT3a receptors, for 1 h at room temperature. These cells were then washed, harvested, and placed in the gamma counter. The GABAB R1aBBSR2 containing receptors clearly bound 125I-BTX in a concentration-dependent manner (Fig. 2B). Using a Scatchard analysis, the Kd for BTX binding was 9.8 ± 2.6 nm (n = 6) for the R1aBBSR2 receptor, which was 11-fold lower than the Kd for BTX binding to the α7/5HT3a receptor (0.86 ± 0.04 nm; n = 3). Constitutive Internalization and Membrane Insertion of GABAB Receptors—The rate at which GABAB R1aBBSR2 receptors were internalized from the cell surface membrane was examined by exposing GIRK cells expressing R1aBBSR2 to 3 μg/ml BTX-Rhd for 10 min at room temperature. The cells were washed free of unbound BTX-Rhd and then kept at either 37 or 18 °C, until fixed at selected time points after the initial exposure to BTX (Fig. 3A). At 18 °C, a temperature that inhibits endocytosis (28.Connolly C.N. Kittler J.T. Thomas P. Uren J.M. Brandon N.J. Smart T.G. Moss S.J. J. Biol. Chem. 1999; 274: 36565-36572Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar), there was little change in the mean cell surface fluorescence over a 300-min period, demonstrating the stability of BTX-Rhd binding to the BBS on the GABAB receptor. However, over a similar duration at 37 °C, the mean cell surface fluorescence was rapidly reduced, according to a single exponential process with a time constant of 39.6 ± 4 min (Fig. 3, A and B). During this period, there was little change (∼10% reduction) in intracellular fluorescence and only a slight reduction in total fluorescence over 300 min at 37 °C (data not shown). To ascertain that there was no significant dissociation of BTX-Rhd from the BSS at 37 °C, 125I-BTX was incubated with cells expressing R1aBBSR2 for 1 h at room temperature and then in the presence of excess unlabeled-BTX for up to 120 min at 37 °C. No decrease in 125I-BTX binding was observed over this period (97 ± 14% of control bound at t = 120 min; n = 6), confirming that BTX-Rhd binds with high affinity to the BBS. Taken overall, these data suggested that recombinant GABAB receptors in GIRK cells are subjected to substantive and constitutive internalization. To identify insertion of the GABAB R1aBBSR2 receptor into the plasma membrane and determine its rate, GIRK cells expressing R1aBBSR2 were exposed to unlabeled BTX (20 μg/ml), to block all the existing GABAB receptors on the cell surface, at room temperature for 5 min. After removing the excess unlabeled BTX, by washing, 3 μg/ml BTX-Rhd was applied for different times at 37 °C. The cells were then fixed prior to measuring levels of surface fluorescence. Within the first minute, there was little evidence of receptor insertion indicating that all pre-existing surface receptors were saturated and bound by unlabeled BTX. However, by 5–10 min, cell surface fluorescence appeared, indicating the membrane insertion of new R1aBBSR2 receptors, and by 20–25 min this had reached a steady state (Fig. 3, C and D). The rate for receptor insertion was best described by a single exponential process with a time constant of 7.8 ± 1.6 min (Fig. 3D). After longer incubation times (70 min), BTX-Rhd labeling appeared in intracellular compartments in accord with these newly inserted receptors being subject to internalization (Fig. 3C). These results indicate that there are GABAB receptors, forming part of an intracellular pool, which are ready for rapid insertion, and these receptors are also subject to internalization as part of a dynamic cycling/rapid turnover of receptors at the cell surface of GIRK cells. GABAB Receptor Activation and the Rate of Internalization—In accord with the process of internalization for other GPCRs, it might be expected that the state of GABAB receptor activation would be similarly influential. To investigate this, we examined whether the endocytosis of the R1aBBSR2 receptor, in GIRK cells, was influenced by receptor activation or inhibition at 37 °C. Cells expressing R
Referência(s)