Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

The Condensing Activities of the Mycobacterium tuberculosis Type II Fatty Acid Synthase Are Differentially Regulated by Phosphorylation

2006; Elsevier BV; Volume: 281; Issue: 40 Linguagem: Inglês

10.1074/jbc.m601691200

ISSN

1083-351X

Autores

Virginie Molle, Alistair K. Brown, Gurdyal S. Besra, Alain J. Cozzone, Laurent Kremer,

Tópico(s)

Biochemical and Molecular Research

Resumo

Phosphorylation of proteins by Ser/Thr protein kinases (STPKs) has recently become of major physiological importance because of its possible involvement in virulence of bacterial pathogens. Although Mycobacterium tuberculosis has eleven STPKs, the nature and function of the substrates of these enzymes remain largely unknown. In this work, we have identified for the first time STPK substrates in M. tuberculosis forming part of the type II fatty acid synthase (FAS-II) system involved in mycolic acid biosynthesis: the malonyl-CoA::AcpM transacylase mtFabD, and the β-ketoacyl AcpM synthases KasA and KasB. All three enzymes were phosphorylated in vitro by different kinases, suggesting a complex network of interactions between STPKs and these substrates. In addition, both KasA and KasB were efficiently phosphorylated in M. bovis BCG each at different sites and could be dephosphorylated by the M. tuberculosis Ser/Thr phosphatase PstP. Enzymatic studies revealed that, whereas phosphorylation decreases the activity of KasA in the elongation process of long chain fatty acids synthesis, this modification enhances that of KasB. Such a differential effect of phosphorylation may represent an unusual mechanism of FAS-II system regulation, allowing pathogenic mycobacteria to produce full-length mycolates, which are required for adaptation and intracellular survival in macrophages. Phosphorylation of proteins by Ser/Thr protein kinases (STPKs) has recently become of major physiological importance because of its possible involvement in virulence of bacterial pathogens. Although Mycobacterium tuberculosis has eleven STPKs, the nature and function of the substrates of these enzymes remain largely unknown. In this work, we have identified for the first time STPK substrates in M. tuberculosis forming part of the type II fatty acid synthase (FAS-II) system involved in mycolic acid biosynthesis: the malonyl-CoA::AcpM transacylase mtFabD, and the β-ketoacyl AcpM synthases KasA and KasB. All three enzymes were phosphorylated in vitro by different kinases, suggesting a complex network of interactions between STPKs and these substrates. In addition, both KasA and KasB were efficiently phosphorylated in M. bovis BCG each at different sites and could be dephosphorylated by the M. tuberculosis Ser/Thr phosphatase PstP. Enzymatic studies revealed that, whereas phosphorylation decreases the activity of KasA in the elongation process of long chain fatty acids synthesis, this modification enhances that of KasB. Such a differential effect of phosphorylation may represent an unusual mechanism of FAS-II system regulation, allowing pathogenic mycobacteria to produce full-length mycolates, which are required for adaptation and intracellular survival in macrophages. Mycobacterium tuberculosis has a unique cell wall structure that accounts for the ability of the bacterium to grow in several contrasting environments and which is responsible for its low membrane permeability, contributing to its resistance to common chemotherapeutic agents (1Brennan P.J. Nikaido H. Annu. Rev. Biochem. 1995; 64: 29-63Crossref PubMed Scopus (1572) Google Scholar). The cell wall has been implicated as a direct modulator of interactions between mycobacteria and the environment (2Daffe M. Draper P. Adv. Microb. Physiol. 1998; 39: 131-203Crossref PubMed Google Scholar). This envelope, characterized by its high lipid content, comprises an inner membrane barrier composed of mycolic acids anchored to arabinogalactan, linked to peptidoglycan. Mycolic acids are a hallmark of the mycobacterial waxy coat: they represent key virulence factors required for intracellular survival (3Dubnau E. Chan J. Raynaud C. Mohan V.P. Laneelle M.A. Yu K. Quemard A. Smith I. Daffe M. Mol. Microbiol. 2000; 36: 630-637Crossref PubMed Scopus (257) Google Scholar, 4Gao L.Y. Laval F. Lawson E.H. Groger R.K. Woodruff A. Morisaki J.H. Cox J.S. Daffe M. Brown E.J. Mol. Microbiol. 2003; 49: 1547-1563Crossref PubMed Scopus (151) Google Scholar) and contribute to the physiopathology of tuberculosis. They consist of very long chains of α-branched β-hydroxy fatty acids (C60-C90), whose biosynthesis is controlled by two elongation systems, the eukaryotic-type fatty acid synthase (FAS-I) 3The abbreviations used are: FAS-I, eukaryotic-type fatty acid synthase; AcpM, mycobacterial acyl carrier protein; FAS-II, prokaryotic type II fatty acid synthase; FHA, forkhead-associated domain; STPK, Ser/Thr protein kinase; NTA, nitrilotriacetic acid; PVDF, polyvinylidene difluoride; IPTG, isopropyl-1-thio-β-d-galactopyranoside; GST, glutathione S-transferase. and the prokaryotic-like FAS-II (5Takayama K. Wang C. Besra G.S. Clin. Microbiol Rev. 2005; 18: 81-101Crossref PubMed Scopus (509) Google Scholar, 6Kremer L. Baulard A.R. Besra G.S. Hatfull G.F. a.W.R.J. Jr. Molecular Genetics of Mycobacteria. ASM Press, Washington, D. C.2000: 173-190Google Scholar). FAS-I consists of a single multifunctional polypeptide, catalyzing de novo synthesis of medium length acyl-CoA chains (C16-C26), whereas FAS-II comprises several distinct enzymes. It catalyzes similar types of reactions to FAS-I, but functions on acyl carrier protein (AcpM)-bound chains and is incapable of de novo synthesis. The initial substrates of FAS-II are β-ketoacyl-AcpM resulting from the condensation by mtFabH of the acyl-CoA products of FAS-I with malonyl-AcpM (7Choi K.H. Kremer L. Besra G.S. Rock C.O. J. Biol. Chem. 2000; 275: 28201-28207Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 8Brown A.K. Sridharan S. Kremer L. Lindenberg S. Dover L.G. Sacchettini J.C. Besra G.S. J. Biol. Chem. 2005; 280: 32539-32547Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Following reduction by MabA, elimination of water by a yet unidentified dehydratase, and reduction by the enoyl-AcpM reductase InhA, the β-ketoacyl-AcpM synthases KasA and KasB catalyze further condensations with malonyl-AcpM in the FAS-II cycle (9Schaeffer M.L. Agnihotri G. Volker C. Kallender H. Brennan P.J. Lonsdale J.T. J. Biol. Chem. 2001; 276: 47029-47037Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 10Kremer L. Dover L.G. Carrere S. Nampoothiri K.M. Lesjean S. Brown A.K. Brennan P.J. Minnikin D.E. Locht C. Besra G.S. Biochem. J. 2002; 364: 423-430Crossref PubMed Scopus (108) Google Scholar). Although changes in the mycolic acid profile seem to be regulated by various environmental stimuli, such as those encountered within the infected macrophage, very little is known at a molecular basis about how pathogenic mycobacteria modulate mycolate composition in response to these changes. Whether regulation of FAS-II enzymes occurs at the transcriptional and/or the translational level is not known. Elucidation of mechanisms modulating mycolic acid biosynthesis would shed some light on the capacity of M. tuberculosis to adapt and survive within the infected host. Reversible protein phosphorylation is a key mechanism by which environmental signals are transmitted to cause changes in protein expression or activity in both eukaryotes and prokaryotes. Genes encoding functional serine/threonine protein kinases (STPKs) are ubiquitous in prokaryotic genomes, but little is known regarding their physiological substrates and their participation in bacterial signal transduction pathways (11Av-Gay Y. Everett M. Trends Microbiol. 2000; 8: 238-244Abstract Full Text Full Text PDF PubMed Scopus (330) Google Scholar). Understanding prokaryotic kinase biology has been seriously hampered by the failure to identify relevant kinase substrates. Signaling through Ser/Thr phosphorylation has emerged as a critical regulatory mechanism in various bacteria, including pathogenic mycobacteria. The genome of M. tuberculosis contains eleven coding regions with significant similarity to eukaryotic STPKs (11Av-Gay Y. Everett M. Trends Microbiol. 2000; 8: 238-244Abstract Full Text Full Text PDF PubMed Scopus (330) Google Scholar, 12Cole S.T. Brosch R. Parkhill J. Garnier T. Churcher C. Harris D. Gordon S.V. Eiglmeier K. Gas S. Barry 3rd, C.E. Tekaia F. Badcock K. Basham D. Brown D. Chillingworth T. Connor R. Davies R. Devlin K. Feltwell T. Gentles S. Hamlin N. Holroyd S. Hornsby T. Jagels K. Krogh A. McLean J. Moule S. Murphy L. Oliver K. Osborne J. Quail M.A. Rajandream M.A. Rogers J. Rutter S. Seeger K. Skelton J. Squares R. Squares S. Sulston J.E. Taylor K. Whitehead S. Barrell B.G. Nature. 1998; 393: 537-544Crossref PubMed Scopus (6557) Google Scholar). Nine of these gene products are predicted to be membrane proteins, presenting a sensor domain to the extracellular face and a kinase catalytic domain to the cytoplasm (11Av-Gay Y. Everett M. Trends Microbiol. 2000; 8: 238-244Abstract Full Text Full Text PDF PubMed Scopus (330) Google Scholar). All mycobacterial Ser/Thr kinases described to date display autophosphorylation activity, and several exogenous substrates have been reported to be phosphorylated by these enzymes (13Peirs P. De Wit L. Braibant M. Huygen K. Content J. Eur. J. Biochem. 1997; 244: 604-612Crossref PubMed Scopus (77) Google Scholar, 14Av-Gay Y. Jamil S. Drews S.J. Infect. Immun. 1999; 67: 5676-5682Crossref PubMed Google Scholar, 15Molle V. Girard-Blanc C. Kremer L. Doublet P. Cozzone A.J. Prost J.F. Biochem. Biophys. Res. Commun. 2003; 308: 820-825Crossref PubMed Scopus (42) Google Scholar, 16Chaba R. Raje M. Chakraborti P.K. Eur. J. Biochem. 2002; 269: 1078-1085Crossref PubMed Scopus (89) Google Scholar, 17Chopra P. Singh B. Singh R. Vohra R. Koul A. Meena L.S. Koduri H. Ghildiyal M. Deol P. Das T.K. Tyagi A.K. Singh Y. Biochem. Biophys. Res. Commun. 2003; 311: 112-120Crossref PubMed Scopus (50) Google Scholar, 18Boitel B. Ortiz-Lombardia M. Duran R. Pompeo F. Cole S.T. Cervenansky C. Alzari P.M. Mol. Microbiol. 2003; 49: 1493-1508Crossref PubMed Scopus (141) Google Scholar, 19Koul A. Choidas A. Tyagi A.K. Drlica K. Singh Y. Ullrich A. Microbiology. 2001; 147: 2307-2314Crossref PubMed Scopus (90) Google Scholar, 20Young T.A. Delagoutte B. Endrizzi J.A. Falick A.M. Alber T. Nat. Struct. Biol. 2003; 10: 168-174Crossref PubMed Scopus (198) Google Scholar, 21Gopalaswamy R. Narayanan P.R. Narayanan S. Protein Expr. Purif. 2004; 36: 82-89Crossref PubMed Scopus (33) Google Scholar). Our understanding of STPKs/substrate interactions in mycobacteria remains limited, because only a few endogenous substrates have been reported, most of them being recognized by virtue of being encoded by genes close to their cognate STPK genes (22Molle V. Kremer L. Girard-Blanc C. Besra G.S. Cozzone A.J. Prost J.F. Biochemistry. 2003; 42: 15300-15309Crossref PubMed Scopus (118) Google Scholar, 23Molle V. Soulat D. Jault J.M. Grangeasse C. Cozzone A.J. Prost J.F. FEMS Microbiol Lett. 2004; 234: 215-223Crossref PubMed Google Scholar, 24Villarino A. Duran R. Wehenkel A. Fernandez P. England P. Brodin P. Cole S.T. Zimny-Arndt U. Jungblut P.R. Cervenansky C. Alzari P.M. J. Mol. Biol. 2005; 350: 953-963Crossref PubMed Scopus (128) Google Scholar, 25Kang C.M. Abbott D.W. Park S.T. Dascher C.C. Cantley L.C. Husson R.N. Genes Dev. 2005; 19: 1692-1704Crossref PubMed Scopus (317) Google Scholar, 26Dasgupta A. Datta P. Kundu M. Basu J. Microbiology. 2006; 152: 493-504Crossref PubMed Scopus (134) Google Scholar). A recent proteomic study with Corynebacterium glutamicum revealed that the vast majority of the phosphorylated proteins are metabolic enzymes rather than regulatory proteins, suggesting that protein phosphorylation plays a much broader function in the physiology of the bacteria than was previously expected (27Bendt A.K. Burkovski A. Schaffer S. Bott M. Farwick M. Hermann T. Proteomics. 2003; 3: 1637-1646Crossref PubMed Scopus (138) Google Scholar). This observation, along with several pieces of data brought us to suspect that activity of the tightly interconnected FAS-II components (28Veyron-Churlet R. Guerrini O. Mourey L. Daffe M. Zerbib D. Mol. Microbiol. 2004; 54: 1161-1172Crossref PubMed Scopus (80) Google Scholar) might depend on post-translational modifications, such as phosphorylation. Therefore, as a first step toward the identification of regulatory mechanisms governing mycolic acid biosynthesis, we investigated whether metabolic FAS-II components from M. tuberculosis may represent substrates of STPKs. In this study, we show for the first time that several FAS-II components, including KasA and KasB, are phosphorylated in vitro and in vivo by STPKs and provide evidence that phosphorylation differentially affects their condensing activity. Bacterial Strains and Growth Conditions—Strains used for cloning and expression of recombinant proteins were Escherichia coli DH5α (Clontech Laboratories), E. coli TOP-10 (Invitrogen), E. coli BL21(DE3)pLysS (Novagen) and E. coli strain C41(DE3) (29Miroux B. Walker J.E. J. Mol. Biol. 1996; 260: 289-298Crossref PubMed Scopus (1586) Google Scholar). All strains were grown and maintained in LB medium at 37 °C. When required, media were supplemented with 100 μg/ml ampicillin, and/or 50 μg/ml chloramphenicol, and/or kanamycin 25 μg/ml. M. bovis BCG strain Pasteur 1173P2 was grown on Middlebrokk 7H10 agar plates supplemented with OADC enrichment (Difco) or in Sauton medium. Cloning, Expression, and Purification of the Eleven Recombinant GST-tagged STPKs of M. tuberculosis—PCR fragments encoding the intracellular region corresponding to the kinase core and the juxtamembrane linker of PknA (residues 1-338), PknB (residues 1-331), PknD (residues 1-378), PknE (residues 1-337), PknF (1-300), PknG (residues 1-360), PknH (residues 1-399), PknI (residues 1-351), PknJ (residues 1-340), PknK (residues 1-300), and PknL (residues 1-369) were amplified by using M. tuberculosis H37Rv genomic DNA as template. Site-directed mutagenesis based on PCR amplification was carried out for the cloning of PknG, PknI, and PknJ. This strategy, as already described by Molle et al. (22Molle V. Kremer L. Girard-Blanc C. Besra G.S. Cozzone A.J. Prost J.F. Biochemistry. 2003; 42: 15300-15309Crossref PubMed Scopus (118) Google Scholar), consisted of creating substitutions in the BamHI restriction site naturally present in those genes to create a mismatch in the specific restriction sequence without changing the coding sequence. Therefore, PknG, PknI, and PknJ could be digested and cloned as BamHI/HindIII DNA fragments. DNA fragments corresponding to the 11 intracellular regions of the different kinases were amplified with their specific primers (Table 1), digested by BamHI and HindIII, and ligated into vector pGEX(M).TABLE 1Primers used in this studyKinasePrimeraForward and reverse primers are represented by plus (+) or minus (−), respectively.5′ to 3′ sequencebRestriction sites are italicized.cThe bases mutated from those present in the wild type are underlined.Primers pairPknA-(1-338)132 (+)TATGGATCCATGAGCCCCCGAGTTGGCGTGACGC132/184184 (−)TATAAGCTTCAACGCTGACCGGACGAAAACGTGCGPknB-(1-331)133 (+)TATGGATCCATGACCACCCCTTCCCACCTGTCCG133/8686 (−)TATAAGCTTCAACGGCCCACCGAACCGATGCTGCGPknD-(1-378)206 (+)TATGGATCCGTGAGCGATGCCGTTCCGCAG206/207207 (−)TATAAGCTTTTACCGTTTGTTGCCGGCCGGCGGPknE-(1-337)220 (+)TATGGATCCATGGATGGCACCGCGGAATCG220/222222 (−)TATAAGCTTTTACCAGGGCTGGCGGGCTGAPknF-(1-300)212 (+)TATGGATCCATGCCGCTCGCGGAAGGTTCGACGTTCGCCGGC212/141TTCACCATCGTCCGGCAGTTGGGGTCC141 (−)TATAAGCTTTTACGGTTGCGACACCCGCGTPknG-(1-360)200 (+)TATGGATCCATGGCCAAAGCGTCAGAGACCPCR1 = 200/201201 (−)GTAGCCGACCGGGTCCCCGTGCCTPCR2 = PCR1/273273 (−)TATAAGCTTTTACAGCACCGGGTCGTCTTCPknH-(1-399)187 (+)TATGGATCCATGAGCGACGCACAGGAC187/8888 (−)TATAAGCTTGAGTTGGTTTTGCGCGGGGTCTGPknI-(1-351)198 (+)TATGGATCCATGGCGTTGGCCAGCGGCGTGPCR1 = 198/199199 (−)GGCCAACAGAATCCGTTGGTCPCR2 = PCR1/211211 (−)TATAAGCTTTTAGCGTGGCCGGCGCCTGGTGGGPknJ-(1-340)208 (+)GCGATGGCCAAGGACCCCATGCGTPCR1 = 209/210210 (−)TATAAGCTTTTAGTAGCGGCGCGGTCGTCTCGGPCR2 = PCR1/209209 (+)TATGGATCCGTGGCCCACGAGTTGAGTPknK-(1-300)274 (+)TATGGATCCATGACCGACGTTGATCCGCAC274/275275 (−)TATAAGCTTTTAGACGGGCAGGGGCATCTCGTCPknL-(1-369)196 (+)TATGGATCCGTGGTCGAAGCTGGCACG196/197197 (−)TATAAGCTTTTATCGACGGGCGTGCTGTCGa Forward and reverse primers are represented by plus (+) or minus (−), respectively.b Restriction sites are italicized.c The bases mutated from those present in the wild type are underlined. Open table in a new tab Recombinant strains harboring the kinase-expressing constructs were used to inoculate 100 ml of LB medium supplemented with ampicillin and were incubated at 37 °C with shaking until A600 reached 0.5. IPTG was then added at a final concentration of 1 mm, and growth was continued for an additional 3 h at 37 °C, with shaking. Purification of the GST-tagged recombinant proteins was performed with glutathione-Sepharose 4B matrix (Amersham Biosciences), as already described (22Molle V. Kremer L. Girard-Blanc C. Besra G.S. Cozzone A.J. Prost J.F. Biochemistry. 2003; 42: 15300-15309Crossref PubMed Scopus (118) Google Scholar). Construction and Purification of His6-tagged mtFabD, KasA, KasB, Holo-AcpM, and OmpATb—Plasmids designed to express mtFabD and KasA (pET28a-mtFabD and pET28a-kasA) were described earlier (10Kremer L. Dover L.G. Carrere S. Nampoothiri K.M. Lesjean S. Brown A.K. Brennan P.J. Minnikin D.E. Locht C. Besra G.S. Biochem. J. 2002; 364: 423-430Crossref PubMed Scopus (108) Google Scholar, 30Kremer L. Nampoothiri K.M. Lesjean S. Dover L.G. Graham S. Betts J. Brennan P.J. Minnikin D.E. Locht C. Besra G.S. J. Biol. Chem. 2001; 276: 27967-27974Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). The kasB gene (Rv2246) was amplified by PCR using M. tuberculosis H37Rv genomic DNA as a template and the following primers: kasB-up 5′-GGG TAC CAC CAC TTG CGG GGG CGA GT-3′ and kasB-lo 5′-GGG GGC CAA GCT TGT CAT CGC AGG TCT-3′. This 1361-bp DNA fragment was directly ligated into the pET28a (Novagen), which had been cut with NdeI and filled-in with the Klenow enzyme, thus giving rise to pET28a-kasB. E. coli C41(DE3) cells transformed with pET28a-kasB were used to inoculate 100 ml of Terrific Broth medium supplemented with 25 μg/ml kanamycin. Cultures were incubated at 37 °C with shaking until A600 reached 1. IPTG was then added at a final concentration of 1 mm, and growth was continued over-night at 16 °C with shaking. Purification of recombinant mtFabD, KasA, KasB was performed as described earlier (30Kremer L. Nampoothiri K.M. Lesjean S. Dover L.G. Graham S. Betts J. Brennan P.J. Minnikin D.E. Locht C. Besra G.S. J. Biol. Chem. 2001; 276: 27967-27974Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). Expression and purification of holo-AcpM and OmpATb was done as reported previously (30Kremer L. Nampoothiri K.M. Lesjean S. Dover L.G. Graham S. Betts J. Brennan P.J. Minnikin D.E. Locht C. Besra G.S. J. Biol. Chem. 2001; 276: 27967-27974Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar, 31Molle V. Saint N. Campagna S. Kremer L. Lea E. Draper P. Molle G. Mol. Microbiol. 2006; 61: 826-837Crossref PubMed Scopus (37) Google Scholar). Analysis of the Phosphoamino Acid Content of Proteins—Phosphoamino acid analysis of the labeled protein reaction products of the in vitro protein kinase reactions were performed as previously described (32Grangeasse C. Doublet P. Vaganay E. Vincent C. Deleage G. Duclos B. Cozzone A.J. Gene (Amst.). 1997; 204: 259-265Crossref PubMed Scopus (62) Google Scholar). Overexpression and Purification of the M. tuberculosis KasA and KasB Proteins in M. bovis BCG—Standard PCR strategies were used to amplify the M. tuberculosis H37Rv kasA or kasB genes, using the following primers: pVV16-kasA-up 5′-TGA GTC AGC CTT CCA CCG CTA-3′ and pVV16-kasA-lo 5′-TTT AAG CTT GTA ACG CCC GAA GGC AAG CG-3′ (containing a HindIII site underlined), pVV16-kasB-up 5′-TGG GGG TCC CCC CGC TTG CGG-3′ and pVV16-kasB-lo 5′-TTT AAG CTT GTA CCG TCC GAA GGC GAT TGC-3′ (containing a HindIII site underlined). The PCR products were cut with HindIII, enabling direct cloning into the pVV16 expression vector cut with MscI/HindIII (33Jackson M. Crick D.C. Brennan P.J. J. Biol. Chem. 2000; 275: 30092-30099Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). This plasmid is a derivative of pMV261 (34Stover C.K. de la Cruz V.F. Fuerst T.R. Burlein J.E. Benson L.A. Bennett L.T. Bansal G.P. Young J.F. Lee M.H. Hatfull G.F. Snapper S.B. Barletta R.G. Jacobs Jr., W.R. Bloom B.R. Nature. 1991; 351: 456-460Crossref PubMed Scopus (1214) Google Scholar), containing both a kanamycin and a hygromycin resistance cassette, harboring the hsp60 promoter as well as a His tag for expression of C-terminal His-tagged fusion proteins. The resulting expression vectors, named pVV16-kasA and pVV16-kasB, were used to transform M. bovis BCG. Transformants were selected on Middlebrook 7H10 supplemented with OADC enrichment and 25 μg/ml kanamycin and grown in Sauton containing kanamycin. Purification of soluble KasA-(His)6 and KasB-(His)6 was performed on Ni-NTA agarose beads as described previously (23Molle V. Soulat D. Jault J.M. Grangeasse C. Cozzone A.J. Prost J.F. FEMS Microbiol Lett. 2004; 234: 215-223Crossref PubMed Google Scholar). Cloning, Overexpression, and Purification of PstP—The PCR fragment encoding the cytoplasmic region of the PstP phosphatase (residues 1-298), containing the phosphatase catalytic core, was amplified by using M. tuberculosis genomic DNA as a template. The 894-bp pstP gene fragment with appropriate sites at both ends was synthesized by PCR amplification with the following primers: 5′-TAT GGA TCC GTG GCG CGC GTG ACC CTG GTC-3′; and 5′-TAT AAG CTT TCA GCC CGA CCA CCG TGG CCG ACT-3′. This DNA fragment was digested with BamHI and HindIII, and ligated into vector pETAmp, digested with the same enzymes, to yield pETAmp-pstP-(1-298). E. coli BL21(DE3)pLysS cells were transformed with pETAmp-pstP-(1-298) and the recombinant E. coli strain was used to inoculate 100 ml of LB medium supplemented with ampicillin and chloramphenicol, and was incubated at 37 °C with shaking until A600 reached 0.5. IPTG was then added at a final concentration of 1 mm, and growth was continued for an additional 3-h period at 37 °C, with shaking. Recombinant His-tagged PstP-(1-298) protein was purified on Ni-NTA beads (Qiagen) as described previously (23Molle V. Soulat D. Jault J.M. Grangeasse C. Cozzone A.J. Prost J.F. FEMS Microbiol Lett. 2004; 234: 215-223Crossref PubMed Google Scholar). Two-dimensional Gel Electrophoresis—To detect the different phosphorylated isoforms of proteins that were phosphorylated in vitro, 5 μg of KasA, KasB, or mtFabD (purified from E. coli and phosphorylated in the presence of [γ-33P]ATP and PknA) were electrophoresed on immobilized 7-cm pH 5-8 gradient strips on a Protean IEF Cell (Bio-Rad) in the first dimension and on a 10% SDS-PAGE in the second dimension. The Coomassie Blue-stained gels were dried onto filter paper (Whatman), and radioactivity was revealed by autoradiography. For in vivo detection, wild-type M. bovis BCG was grown to early stationary phase. Cells were harvested, washed twice with 20 mm Tris-HCl, pH 7.5, and resuspended in lysis buffer (20 mm Tris-HCl pH 7.5, 10% glycerol, antiprotease mixture, Roche Applied Science), followed by sonication. The lysate was cleared by centrifugation at 14,000 rpm for 30 min at 4 °C. Approximately 150 μg of total soluble proteins were loaded onto a 7-cm immobiline strip (Bio-Rad, pH 3-6) and electrophoresed in a Protean IEF Cell in the first dimension and on a 10% SDS-PAGE in the second dimension. Immunoblotting—Two-dimensional gels of M. bovis BCG total soluble proteins were blotted on PVDF membrane, and probed with a rat anti-KasA antibody raised against the M. tuberculosis KasA protein, which also strongly cross-reacts with KasB (1:1000 dilution) (35Kremer L. Guerardel Y. Gurcha S.S. Locht C. Besra G.S. Microbiology. 2002; 148: 3145-3154Crossref PubMed Scopus (50) Google Scholar). Horseradish peroxidase-conjugated anti-rat serum was used as a secondary antibody (1:5000 dilution), and detection was carried out using the Western Lightening Reagent (PerkinElmer Life Sciences) according to the manufacturer's instructions. For immunoblotting of purified KasA and KasB proteins from E. coli or M. bovis BCG resolved on 1D PAGE, 2 μg were loaded on a 10% polyacrylamide gel, electrophoresed, blotted on PVDF, and detected using either polyclonal rabbit anti-phosphothreonine or polyclonal rabbit anti-phosphoserine (Invitrogen Immunodetection) antibodies used at 1:200 dilution. Horseradish peroxidase-conjugated anti-rabbit serum was used as a secondary antibody (1:5000 dilution), and detection was carried out using the Western Lightening Reagent according to the manufacturer's instructions. KasA and KasB Activity Assay—KasA and KasB enzymatic activities were assayed as described (10Kremer L. Dover L.G. Carrere S. Nampoothiri K.M. Lesjean S. Brown A.K. Brennan P.J. Minnikin D.E. Locht C. Besra G.S. Biochem. J. 2002; 364: 423-430Crossref PubMed Scopus (108) Google Scholar). Briefly, Holo-AcpM (40 μm) was incubated at 37 °C for 30 min with 1 mm β-mer-captoethanol in 100 mm potassium phosphate buffer, pH 7.0 to a total volume of 25 μl. Kinetic analysis used varied concentrations of [2-14C]malonyl-CoA (specific activity 1.92 Gbq/mmol; Amersham Biosciences) (0-40 μm). mtFabD (40 ng) was preheated to 37 °C, added to the reaction mixture and held at 37 °C for 30 min to allow mtFabD-catalyzed transacylation of holo-AcpM (30Kremer L. Nampoothiri K.M. Lesjean S. Dover L.G. Graham S. Betts J. Brennan P.J. Minnikin D.E. Locht C. Besra G.S. J. Biol. Chem. 2001; 276: 27967-27974Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar) using [2-14C]malonyl-CoA to reach equilibrium. C16-AcpM (0-35 μm) (30Kremer L. Nampoothiri K.M. Lesjean S. Dover L.G. Graham S. Betts J. Brennan P.J. Minnikin D.E. Locht C. Besra G.S. J. Biol. Chem. 2001; 276: 27967-27974Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar) was added to obtain a final volume of 49 μl. Unphosphorylated/phosphorylated KasA (0.6 μg) or unphosphorylated/phosphorylated KasB (0.8 μg) were added to the reaction mixture to a final volume of 50 μl. The reaction was held at 37 °C for 40 min, after which it was quenched by adding 2 ml of a NaBH4 reducing solution (5 mg/ml NaBH4 in 0.1 m K2HPO4, 0.4 m KCl and 30% (v/v) tetrahydrofuran) followed by incubation at 37 °C for 1 h. The completely reduced product was extracted twice with 2 ml of water-saturated toluene. The combined organic phases from both extractions were pooled and washed with 2 ml of toluene-saturated water. The organic layer was removed and dried under a stream of nitrogen in a scintillation vial. The 14C18-1,3-diol product was then quantified by liquid scintillation counting using 10 ml of EcoScintA. STPK-mediated Phosphorylation of Mycobacterial FAS-II Enzymes—The main locus of the mycobacterial FAS-II system is an operon comprising five genes, all transcribed in the same orientation (6Kremer L. Baulard A.R. Besra G.S. Hatfull G.F. a.W.R.J. Jr. Molecular Genetics of Mycobacteria. ASM Press, Washington, D. C.2000: 173-190Google Scholar, 36Mdluli K. Slayden R.A. Zhu Y. Ramaswamy S. Pan X. Mead D. Crane D.D. Musser J.M. Barry 3rd., C.E. Science. 1998; 280: 1607-1610Crossref PubMed Scopus (375) Google Scholar). The third and fourth ORFs, kasA and kasB, encode the β-ketoacyl-ACP synthases that elongate the growing meromycolate precursor, whereas the first gene, mtfabD, encodes the malonyl-CoA:AcpM transacylase that provides them with the malonyl-AcpM substrate, the carbon donor during the elongation steps (6Kremer L. Baulard A.R. Besra G.S. Hatfull G.F. a.W.R.J. Jr. Molecular Genetics of Mycobacteria. ASM Press, Washington, D. C.2000: 173-190Google Scholar, 10Kremer L. Dover L.G. Carrere S. Nampoothiri K.M. Lesjean S. Brown A.K. Brennan P.J. Minnikin D.E. Locht C. Besra G.S. Biochem. J. 2002; 364: 423-430Crossref PubMed Scopus (108) Google Scholar, 30Kremer L. Nampoothiri K.M. Lesjean S. Dover L.G. Graham S. Betts J. Brennan P.J. Minnikin D.E. Locht C. Besra G.S. J. Biol. Chem. 2001; 276: 27967-27974Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). AcpM, the mycobacterial acyl carrier protein, is encoded by a gene located between mtfabD and kasA (10Kremer L. Dover L.G. Carrere S. Nampoothiri K.M. Lesjean S. Brown A.K. Brennan P.J. Minnikin D.E. Locht C. Besra G.S. Biochem. J. 2002; 364: 423-430Crossref PubMed Scopus (108) Google Scholar). A systematic approach was used to investigate whether the eleven STPKs of M. tuberculosis (PknA to PknL) phosphorylate these FAS-II components. All eleven STPKs were expressed as GST fusions and purified from E. coli. The various FAS-II components investigated were expressed as His tag fusions and purified from E. coli. Interestingly, when STPKs were incubated in the presence of KasA and [γ-33P]ATP (specific activity 3000 Ci/mmol; Amersham Biosciences), phosphorylation of KasA was observed, although at different levels with regard to the kinase. Fig. 1A shows that PknA was the most efficient kinase to phosphorylate KasA, while PknB, E, F, and H were also found to efficiently phosphorylate KasA. However, PknK and PknL, which display strong autophosphorylation activity in vitro, did not phosphorylate KasA. PknG, PknI, and PknJ did not phosphorylate KasA but this might have been caused by their very low in vitro autokinase activity. To our knowledge, this is the first demonstration of phosphorylation of a FAS-II condensing enzyme. This unexpected result prompted us to explore whether KasB, which closely resembles KasA (67% identity) and is encoded by the adjacent gene, may also be a substrate of M. tuberculosis STPKs. As shown in Fig. 1A (second panel), KasB was also phosphorylated in vitro, as evidenced by the incorporation of radiolabeled phosphate from [γ-33P]ATP.

Referência(s)