Delayed Cardiomyopathy in Dystrophin Deficient mdx Mice Relies on Intrinsic Glutathione Resource
2010; Elsevier BV; Volume: 177; Issue: 3 Linguagem: Inglês
10.2353/ajpath.2010.090479
ISSN1525-2191
AutoresLara Khouzami, M Bourin, Christo Christov, Thibaud Damy, Brigitte Escoubet, Philippe Caramelle, Magali Perier, Karim Wahbi, Christophe Meune, Catherine Pavoine, Françoise Pecker,
Tópico(s)Exercise and Physiological Responses
ResumoOxidative stress contributes to the pathogenesis of Duchenne muscular dystrophy (DMD). Although they have been a model for DMD, mdx mice exhibit slowly developing cardiomyopathy. We hypothesized that disease process was delayed owing to the development of an adaptive mechanism against oxidative stress, involving glutathione synthesis. At 15 to 20 weeks of age, mdx mice displayed a 33% increase in blood glutathione levels compared with age-matched C57BL/6 mice. In contrast, cardiac glutathione content was similar in mdx and C57BL/6 mice as a result of the balanced increased expression of glutamate cysteine ligase catalytic and regulatory subunits ensuring glutathione synthesis in the mdx mouse heart, as well as increased glutathione peroxidase-1 using glutathione. Oral administration from 10 weeks of age of the glutamate cysteine ligase inhibitor, l-buthionine(S,R)-sulfoximine (BSO, 5 mmol/L), led to a 33% and 50% drop in blood and cardiac glutathione, respectively, in 15- to 20-week-old mdx mice. Moreover, 20-week-old BSO-treated mdx mice displayed left ventricular hypertrophy associated with diastolic dysfunction, discontinuities in β-dystroglycan expression, micronecrosis and microangiopathic injuries. Examination of the glutathione status in four DMD patients showed that three displayed systemic glutathione deficiency as well. In conclusion, low glutathione resource hastens the onset of cardiomyopathy linked to a defect in dystrophin in mdx mice. This is relevant to the glutathione deficiency that DMD patients may suffer. Oxidative stress contributes to the pathogenesis of Duchenne muscular dystrophy (DMD). Although they have been a model for DMD, mdx mice exhibit slowly developing cardiomyopathy. We hypothesized that disease process was delayed owing to the development of an adaptive mechanism against oxidative stress, involving glutathione synthesis. At 15 to 20 weeks of age, mdx mice displayed a 33% increase in blood glutathione levels compared with age-matched C57BL/6 mice. In contrast, cardiac glutathione content was similar in mdx and C57BL/6 mice as a result of the balanced increased expression of glutamate cysteine ligase catalytic and regulatory subunits ensuring glutathione synthesis in the mdx mouse heart, as well as increased glutathione peroxidase-1 using glutathione. Oral administration from 10 weeks of age of the glutamate cysteine ligase inhibitor, l-buthionine(S,R)-sulfoximine (BSO, 5 mmol/L), led to a 33% and 50% drop in blood and cardiac glutathione, respectively, in 15- to 20-week-old mdx mice. Moreover, 20-week-old BSO-treated mdx mice displayed left ventricular hypertrophy associated with diastolic dysfunction, discontinuities in β-dystroglycan expression, micronecrosis and microangiopathic injuries. Examination of the glutathione status in four DMD patients showed that three displayed systemic glutathione deficiency as well. In conclusion, low glutathione resource hastens the onset of cardiomyopathy linked to a defect in dystrophin in mdx mice. This is relevant to the glutathione deficiency that DMD patients may suffer. Duchenne muscular dystrophy (DMD) is a lethal X-linked recessive disorder caused by a defect in dystrophin, a subsarcolemmal structural protein of the cardiac and skeletal muscles that contributes to the integrity of the cellular membrane.1Hoffman EP Fischbeck KH Brown RH Johnson M Medori R Loike JD Harris JB Waterston R Brooke M Specht L Kupsky W Chamberlain J Caskey Y Shapiro F Kunkel LM Characterization of dystrophin in muscle-biopsy specimens from patients with Duchenne's or Becker's muscular dystrophy.N Engl J Med. 1988; 318: 1363-1368Crossref PubMed Scopus (770) Google Scholar Dystrophin-deficient mdx mice are the most commonly used experimental model of DMD.2Chapman VM Miller DR Armstrong D Caskey CT Recovery of induced mutations for X chromosome-linked muscular dystrophy in mice.Proc Natl Acad Sci USA. 1989; 86: 1292-1296Crossref PubMed Scopus (183) Google Scholar, 3Allamand V Campbell KP Animal models for muscular dystrophy: valuable tools for the development of therapies.Hum Mol Genet. 2000; 9: 2459-2467Crossref PubMed Scopus (131) Google Scholar, 4Ferrari G Stornaiuolo A Mavilio F Failure to correct murine muscular dystrophy.Nature. 2001; 411: 1014-1015Crossref PubMed Scopus (144) Google Scholar, 5Connolly AM Keeling RM Mehta S Pestronk A Sanes JR Three mouse models of muscular dystrophy: the natural history of strength and fatigue in dystrophin-, dystrophin/utrophin-, and laminin alpha2-deficient mice.Neuromuscul Disord. 2001; 11: 703-712Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 6Chretien F Dreyfus PA Christov C Caramelle P Lagrange JL Chazaud B Gherardi RK In vivo fusion of circulating fluorescent cells with dystrophin-deficient myofibers results in extensive sarcoplasmic fluorescence expression but limited dystrophin sarcolemmal expression.Am J Pathol. 2005; 166: 1741-1748Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar, 7Duan D Challenges and opportunities in dystrophin-deficient cardiomyopathy gene therapy.Hum Mol Genet. 2006; 15: R253-R261Crossref PubMed Scopus (71) Google Scholar In DMD patients, as well as in mdx mice, dystrophin defect alters the sarcolemmal integrity of cardiac and skeletal myocytes,8Petrof BJ Shrager JB Stedman HH Kelly AM Sweeney HL Dystrophin protects the sarcolemma from stresses developed during muscle contraction.Proc Natl Acad Sci USA. 1993; 90: 3710-3714Crossref PubMed Scopus (1176) Google Scholar, 9Danialou G Comtois AS Dudley R Karpati G Vincent G Des Rosiers C Petrof BJ Dystrophin-deficient cardiomyocytes are abnormally vulnerable to mechanical stress-induced contractile failure and injury.FASEB J. 2001; 15: 1655-1657PubMed Google Scholar, 10Townsend D Yasuda S Metzger J Cardiomyopathy of Duchenne muscular dystrophy: pathogenesis and prospect of membrane sealants as a new therapeutic approach.Expert Rev Cardiovasc Ther. 2007; 5: 99-109Crossref PubMed Scopus (32) Google Scholar with increased susceptibility to oxidative stress11Rando TA Disatnik MH Yu Y Franco A Muscle cells from mdx mice have an increased susceptibility to oxidative stress.Neuromuscul Disord. 1998; 8: 14-21Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar, 12Messina S Altavilla D Aguennouz M Seminara P Minutoli L Monici MC Bitto A Mazzeo A Marini H Squadrito F Vita G Lipid peroxidation inhibition blunts nuclear factor-kappaB activation, reduces skeletal muscle degeneration, and enhances muscle function in mdx mice.Am J Pathol. 2006; 168: 918-926Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 13Tidball JG Wehling-Henricks M The role of free radicals in the pathophysiology of muscular dystrophy.J Appl Physiol. 2007; 102: 1677-1686Crossref PubMed Scopus (176) Google Scholar leading to necrotic cell death and inflammation.14Rando TA Role of nitric oxide in the pathogenesis of muscular dystrophies: a “two hit” hypothesis of the cause of muscle necrosis.Microsc Res Tech. 2001; 55: 223-235Crossref PubMed Scopus (115) Google Scholar, 15Dudley RW Danialou G Govindaraju K Lands L Eidelman DE Petrof BJ Sarcolemmal damage in dystrophin deficiency is modulated by synergistic interactions between mechanical and oxidative/nitrosative stresses.Am J Pathol. 2006; 168 (quiz 1404–1275): 1276-1287Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar Further evidence in support of oxidative stress as a cause of the dystrophic pathophysiology comes from in vivo studies demonstrating reduced signs of muscle damages in mdx mice given antioxidants.16Buetler TM Renard M Offord EA Schneider H Ruegg UT Green tea extract decreases muscle necrosis in mdx mice and protects against reactive oxygen species.Am J Clin Nutr. 2002; 75: 749-753PubMed Google Scholar, 17Whitehead NP Pham C Gervasio OL Allen DG N-Acetylcysteine ameliorates skeletal muscle pathophysiology in mdx mice.J Physiol. 2008; 586: 2003-2014Crossref PubMed Scopus (184) Google Scholar The tripeptide glutathione (l-gamma glutamyl-cysteinyl-glycine) is a major antioxidant, which plays a central role in cell redox regulation and controls multiple cellular processes. In particular, glutathione, through the inhibition of the neutral sphingomyelinase-dependent apoptotic pathway,18Liu B Andrieu-Abadie N Levade T Zhang P Obeid LM Hannun YA Glutathione regulation of neutral sphingomyelinase in tumor necrosis factor-alpha-induced cell death.J Biol Chem. 1998; 273: 11313-11320Crossref PubMed Scopus (324) Google Scholar, 19Pavoine C Pecker F Sphingomyelinases: their regulation and roles in cardiovascular pathophysiology.Cardiovasc Res. 2009; 82: 175-183Crossref PubMed Scopus (109) Google Scholar determines cardiac myocyte function and survival.20Bourraindeloup M Adamy C Candiani G Cailleret M Bourin MC Badoual T Su JB Adubeiro S Roudot-Thoraval F Dubois-Rande JL Hittinger L Pecker F N-acetylcysteine treatment normalizes serum tumor necrosis factor-alpha level and hinders the progression of cardiac injury in hypertensive rats.Circulation. 2004; 110: 2003-2009Crossref PubMed Scopus (61) Google Scholar, 21Adamy C Mulder P Khouzami L Andrieu-Abadie N Defer N Candiani G Pavoine C Caramelle P Souktani R Le Corvoisier P Perier M Kirsch M Damy T Berdeaux A Levade T Thuillez C Hittinger L Pecker F Neutral sphingomyelinase inhibition participates to the benefits of N-acetylcysteine treatment in post-myocardial infarction failing heart rats.J Mol Cell Cardiol. 2007; 43: 344-353Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 22Damy T Kirsch M Khouzami L Caramelle P Le Corvoisier P Roudot-Thoraval F Dubois-Rande JL Hittinger L Pavoine C Pecker F Glutathione deficiency in cardiac patients is related to the functional status and structural cardiac abnormalities.PLoS ONE. 2009; 4: e4871Crossref PubMed Scopus (74) Google Scholar Alterations in glutathione homeostasis and metabolism are associated with inflammation23Haddad JJ Harb HL L-gamma-Glutamyl-L-cysteinyl-glycine (glutathione; GSH) and GSH-related enzymes in the regulation of pro- and anti-inflammatory cytokines: a signaling transcriptional scenario for redox (y) immunologic sensor (s) ?.Mol Immunol. 2005; 42: 987-1014Crossref PubMed Scopus (129) Google Scholar and characterize several human inflammatory chronic diseases.24Townsend DM Tew KD Tapiero H The importance of glutathione in human disease.Biomed Pharmacother. 2003; 57: 145-155Crossref PubMed Scopus (1513) Google Scholar, 25Franco R Schoneveld OJ Pappa A Panayiotidis MI The central role of glutathione in the pathophysiology of human diseases.Arch Physiol Biochem. 2007; 113: 234-258Crossref PubMed Scopus (393) Google Scholar Thus, fibroblasts from DMD patients show a low capacity for glutathione synthesis.26Degl'Innocenti D Rosati F Iantomasi T Vincenzini MT Ramponi G GSH system in relation to redox state in dystrophic skin fibroblasts.Biochimie. 1999; 81: 1025-1029Crossref PubMed Scopus (10) Google Scholar In contrast, a noticeable feature of dystrophic muscles in mdx mice is the up-regulation of glutathione peroxidase and glutathione reductase, which respectively use and recycle reduced glutathione.27Dudley RW Khairallah M Mohammed S Lands L Des Rosiers C Petrof BJ Dynamic responses of the glutathione system to acute oxidative stress in dystrophic mouse (mdx) muscles.Am J Physiol Regul Integr Comp Physiol. 2006; 291: R704-R710Crossref PubMed Scopus (54) Google Scholar However, this protective mechanism does not entirely compensate the chronic oxidative challenge since glutathione levels in 6- to 8-week-old mdx mice tibialis anterior muscles are decreased by 20% compared with control mice.27Dudley RW Khairallah M Mohammed S Lands L Des Rosiers C Petrof BJ Dynamic responses of the glutathione system to acute oxidative stress in dystrophic mouse (mdx) muscles.Am J Physiol Regul Integr Comp Physiol. 2006; 291: R704-R710Crossref PubMed Scopus (54) Google Scholar Accordingly, green tea polyphenols, which beyond their inherent antioxidant properties, promote glutathione synthesis, and reduce muscle damage and necrosis in mdx mice.16Buetler TM Renard M Offord EA Schneider H Ruegg UT Green tea extract decreases muscle necrosis in mdx mice and protects against reactive oxygen species.Am J Clin Nutr. 2002; 75: 749-753PubMed Google Scholar, 17Whitehead NP Pham C Gervasio OL Allen DG N-Acetylcysteine ameliorates skeletal muscle pathophysiology in mdx mice.J Physiol. 2008; 586: 2003-2014Crossref PubMed Scopus (184) Google Scholar This does not rule out that the intrinsic increased turnover of glutathione in mdx mice may delay the progression of the dystrophic disease, although it cannot fully protect against it. Cardiac manifestations of DMD are recognized later than those of skeletal muscles, but are present in 90% of DMD patients by the age of 18 years, progressing to fatal heart failure in 20% of patients.28Finsterer J Stollberger C The heart in human dystrophinopathies.Cardiology. 2003; 99: 1-19Crossref PubMed Scopus (364) Google Scholar Similar to DMD patients, mdx mice experience a progressive development of cardiac defects. However, the disease develops with less severity than in patients and in old mice only; young adult mice show few echocardiographic signs of cardiomyopathy before 10 months of age.7Duan D Challenges and opportunities in dystrophin-deficient cardiomyopathy gene therapy.Hum Mol Genet. 2006; 15: R253-R261Crossref PubMed Scopus (71) Google Scholar, 29Quinlan JG Hahn HS Wong BL Lorenz JN Wenisch AS Levin LS Evolution of the mdx mouse cardiomyopathy: physiological and morphological findings.Neuromuscul Disord. 2004; 14: 491-496Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar Glutathione plays a central role in protecting cardiac vasculature,30Forgione MA Cap A Liao R Moldovan NI Eberhardt RT Lim CC Jones J Goldschmidt-Clermont PJ Loscalzo J Heterozygous cellular glutathione peroxidase deficiency in the mouse: abnormalities in vascular and cardiac function and structure.Circulation. 2002; 106: 1154-1158Crossref PubMed Scopus (161) Google Scholar and cardiac glutathione deficiency is a common feature of cardiomyopathies in animal models,20Bourraindeloup M Adamy C Candiani G Cailleret M Bourin MC Badoual T Su JB Adubeiro S Roudot-Thoraval F Dubois-Rande JL Hittinger L Pecker F N-acetylcysteine treatment normalizes serum tumor necrosis factor-alpha level and hinders the progression of cardiac injury in hypertensive rats.Circulation. 2004; 110: 2003-2009Crossref PubMed Scopus (61) Google Scholar, 21Adamy C Mulder P Khouzami L Andrieu-Abadie N Defer N Candiani G Pavoine C Caramelle P Souktani R Le Corvoisier P Perier M Kirsch M Damy T Berdeaux A Levade T Thuillez C Hittinger L Pecker F Neutral sphingomyelinase inhibition participates to the benefits of N-acetylcysteine treatment in post-myocardial infarction failing heart rats.J Mol Cell Cardiol. 2007; 43: 344-353Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar as in patients.21Adamy C Mulder P Khouzami L Andrieu-Abadie N Defer N Candiani G Pavoine C Caramelle P Souktani R Le Corvoisier P Perier M Kirsch M Damy T Berdeaux A Levade T Thuillez C Hittinger L Pecker F Neutral sphingomyelinase inhibition participates to the benefits of N-acetylcysteine treatment in post-myocardial infarction failing heart rats.J Mol Cell Cardiol. 2007; 43: 344-353Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 22Damy T Kirsch M Khouzami L Caramelle P Le Corvoisier P Roudot-Thoraval F Dubois-Rande JL Hittinger L Pavoine C Pecker F Glutathione deficiency in cardiac patients is related to the functional status and structural cardiac abnormalities.PLoS ONE. 2009; 4: e4871Crossref PubMed Scopus (74) Google Scholar, 31Yucel D Aydogdu S Cehreli S Saydam G Canatan H Senes M Cigdem Topkaya B Nebioglu S Increased oxidative stress in dilated cardiomyopathic heart failure.Clin Chem. 1998; 44: 148-154PubMed Google Scholar We hypothesized that the progression of cardiomyopathy in mdx mice was slow owing to a boost in glutathione synthesis and resources, set as an adaptative mechanism against oxidative stress. Mice administered oral l-buthionine sulfoximine (BSO), a specific inhibitor of glutamate cysteine ligase (GLCL), the rate-limiting enzyme of glutathione synthesis, are a suitable, well-characterized model for glutathione deficiency.32Watanabe T Sagisaka H Arakawa S Shibaya Y Watanabe M Igarashi I Tanaka K Totsuka S Takasaki W Manabe S A novel model of continuous depletion of glutathione in mice treated with L-buthionine (S,R)-sulfoximine.J Toxicol Sci. 2003; 28: 455-469Crossref PubMed Scopus (94) Google Scholar From 10 weeks of age, mdx mice experience a continuing cycle of skeletal muscle fiber degeneration and regeneration.33Pastoret C Sebille A Age-related differences in regeneration of dystrophic (mdx) and normal muscle in the mouse.Muscle Nerve. 1995; 18: 1147-1154Crossref PubMed Scopus (71) Google Scholar, 34McGeachie JK Grounds MD Partridge TA Morgan JE Age-related changes in replication of myogenic cells in mdx mice: quantitative autoradiographic studies.J Neurol Sci. 1993; 119: 169-179Abstract Full Text PDF PubMed Scopus (137) Google Scholar We chose this age to start a 10-week treatment with BSO added to the drinking water at a low dose (5 mmol/L) devoid of toxicity.32Watanabe T Sagisaka H Arakawa S Shibaya Y Watanabe M Igarashi I Tanaka K Totsuka S Takasaki W Manabe S A novel model of continuous depletion of glutathione in mice treated with L-buthionine (S,R)-sulfoximine.J Toxicol Sci. 2003; 28: 455-469Crossref PubMed Scopus (94) Google Scholar At variance from 20-week-old untreated mdx mice receiving water, 20-week-old BSO-treated mdx mice displayed cardiac left ventricular (LV) structural abnormalities and hypertrophy together with altered diastolic function, reminiscent of the early stage of the cardiomyopathy in DMD patients before the manifestations of clinical symptoms.35Nigro G Comi LI Palladino A Petretta VR Politano L Cardiomyopathies: diagnosis of types and stages.Acta Myol. 2004; 23: 97-102PubMed Google Scholar, 36Crilley JG Boehm EA Rajagopalan B Blamire AM Styles P Muntoni F Hilton-Jones D Clarke K Magnetic resonance spectroscopy evidence of abnormal cardiac energetics in Xp21 muscular dystrophy.J Am Coll Cardiol. 2000; 36: 1953-1958Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar To get a first insight into the glutathione status of DMD patients, we measured blood glutathione in four DMD patients with mean age of 28 ± 2 years and on wheelchair dependency. We found that three of them demonstrated systemic glutathione deficiency. This study, performed prospectively for a period of 7 months (September 2009 to March 2010) at the AP-HP, Groupe Hospitalier Cochin, Service de Cardiologie, Paris, France and at the Hôpital Raymond Poincaré, Service de Réanimation et Unité de Ventilation à domicile, Garches, France conformed to the Declaration of Helsinki and to our institutional ethics committee guidelines. All of the participants gave informed consent. We enrolled four consecutive patients with DMD (four males with mean age of 28 ± 2 years), referred to our institutions for cardiac evaluation. Patients underwent biological tests including the measurement of whole blood glutathione and an echocardiography (ATL HDI 5000 system, ATL Ultrasound, Bothell, WA). Examinations were conformed to the recommendations of the American Society of Echocardiography. Left ventricular ejection fraction (LVEF) was determined according to the Simpson's method. Blood glutathione of DMD patients was compared with that of four matched healthy volunteers. Experimental procedures were performed in accordance with the European legislation on animal experimentation (L358-86/609/EEC). C57BL/6 (B6) and mdx4Cv (mdx) mice were used. The mdx4Cv mouse mutant, in which a C-to-T nucleotide transition generates a stop codon in exon 53 of the dystrophin gene, has almost no background of revertant fibers in skeletal muscle.4Ferrari G Stornaiuolo A Mavilio F Failure to correct murine muscular dystrophy.Nature. 2001; 411: 1014-1015Crossref PubMed Scopus (144) Google Scholar, 6Chretien F Dreyfus PA Christov C Caramelle P Lagrange JL Chazaud B Gherardi RK In vivo fusion of circulating fluorescent cells with dystrophin-deficient myofibers results in extensive sarcoplasmic fluorescence expression but limited dystrophin sarcolemmal expression.Am J Pathol. 2005; 166: 1741-1748Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar, 37Danko I Chapman V Wolff JA The frequency of revertants in mdx mouse genetic models for Duchenne muscular dystrophy.Pediatr Res. 1992; 32: 128-131Crossref PubMed Scopus (123) Google Scholar B6 and mdx mice were randomly assigned to two groups: 1) an untreated group receiving water; 2) a group receiving BSO (Sigma) via drinking water at the concentration of 5 mmol/L (average dose of 185 mg/kg/day) from 10 to 20 weeks of age. As previously stated by Watanabe et al,32Watanabe T Sagisaka H Arakawa S Shibaya Y Watanabe M Igarashi I Tanaka K Totsuka S Takasaki W Manabe S A novel model of continuous depletion of glutathione in mice treated with L-buthionine (S,R)-sulfoximine.J Toxicol Sci. 2003; 28: 455-469Crossref PubMed Scopus (94) Google Scholar this dose of BSO did not produce either deaths or pathological signs. Blood was withdrawn from the queue at regular intervals from 3 weeks to 20 weeks of age. At 20 weeks of age, all mice were subjected to echocardiography then euthanized by intraperitoneal injection of overdose anesthetics (xyzaline, 20 mg/kg, and ketamine, 50 mg/kg). Blood was withdrawn and hearts were excised and frozen in liquid nitrogen cooled isopentane. All samples were stored at −80°C until use. Transthoracic two-dimensional echocardiography measurements were performed in isoflurane-anesthetized mice using an echocardiograph (Vivid 7, General Electric) equipped with a linear 13 MHz transducer. Body temperature was maintained with a heating pad. Numeric images were stored and reviewed at a slower frame rate by a single observator blinded of the animal treatment and genotype status. Left ventricular end-diastolic diameter (LVEDD), interventricular septal wall thickness in diastole (IVS) and posterior wall thickness in diastole (LVPW) were measured from long axis view by two-dimensional-guided M-mode. LV mass (LVM) was calculated using the formula: LVM = 1.05 [(IVS + LVEDD + LVPW)3Allamand V Campbell KP Animal models for muscular dystrophy: valuable tools for the development of therapies.Hum Mol Genet. 2000; 9: 2459-2467Crossref PubMed Scopus (131) Google Scholar − (LVID)3Allamand V Campbell KP Animal models for muscular dystrophy: valuable tools for the development of therapies.Hum Mol Genet. 2000; 9: 2459-2467Crossref PubMed Scopus (131) Google Scholar].38Collins KA Korcarz CE Shroff SG Bednarz JE Fentzke RC Lin H Leiden JM Lang RM Accuracy of echocardiographic estimates of left ventricular mass in mice.Am J Physiol Heart Circ Physiol. 2001; 280: H1954-H1962PubMed Google Scholar Left ventricular ejection fraction (LVEF) was measured using two-dimensional parasternal long axis cine-loop.39Scorsin M Hagege A Vilquin JT Fiszman M Marotte F Samuel JL Rappaport L Schwartz K Menasche P Comparison of the effects of fetal cardiomyocyte and skeletal myoblast transplantation on postinfarction left ventricular function.J Thorac Cardiovasc Surg. 2000; 119: 1169-1175Abstract Full Text Full Text PDF PubMed Scopus (261) Google Scholar Peak mitral early diastolic velocity (E), its deceleration time (DcT) and the peak velocity of the atrial contraction (A) were measured using the trans-mitral pulsed wave Doppler. All measurements were averaged on three consecutive cardiac cycles. Total glutathione was measured in patients and mice whole blood collected in EDTA tubes, and in mouse heart homogenates according to a modification of Tietze method40Tietze F Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissues.Anal Biochem. 1969; 27: 502-522Crossref PubMed Scopus (5534) Google Scholar as previously described.21Adamy C Mulder P Khouzami L Andrieu-Abadie N Defer N Candiani G Pavoine C Caramelle P Souktani R Le Corvoisier P Perier M Kirsch M Damy T Berdeaux A Levade T Thuillez C Hittinger L Pecker F Neutral sphingomyelinase inhibition participates to the benefits of N-acetylcysteine treatment in post-myocardial infarction failing heart rats.J Mol Cell Cardiol. 2007; 43: 344-353Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 22Damy T Kirsch M Khouzami L Caramelle P Le Corvoisier P Roudot-Thoraval F Dubois-Rande JL Hittinger L Pavoine C Pecker F Glutathione deficiency in cardiac patients is related to the functional status and structural cardiac abnormalities.PLoS ONE. 2009; 4: e4871Crossref PubMed Scopus (74) Google Scholar, 41Rahman I Kode A Biswas SK Assay for quantitative determination of glutathione and glutathione disulfide levels using enzymatic recycling method.Nat Protoc. 2006; 1: 3159-3165Crossref PubMed Scopus (1481) Google Scholar Results are given as means ± SEM of three separate determinations made in duplicates. Cardiomyocyte structure was studied in air-dried frozen heart sections from B6 mice, untreated or BSO-treated mdx mice. After blocking nonspecific staining with AffiniPure Fab and Fc fragments (Jackson ImmunoResearch Europe Ltd. Suffolk, United Kingdom),17Whitehead NP Pham C Gervasio OL Allen DG N-Acetylcysteine ameliorates skeletal muscle pathophysiology in mdx mice.J Physiol. 2008; 586: 2003-2014Crossref PubMed Scopus (184) Google Scholar sections were incubated with either a mouse monoclonal antibody to β-dystroglycan (diluted 1:50; Abcam, San Francisco, CA) and the secondary goat anti-mouse Alexa-fluor 555-conjugated antibody (diluted 1:1000; Invitrogen, Carlsbad, CA) or a rat monoclonal antibody to mouse CD68 (diluted 1:250; Serotec, Kidlington, United Kingdom) and the biotinylated sheep secondary anti-rat IgG antibody (diluted 1:500; Serotec). Slides were mounted with Prolong Gold antifade reagent with DAPI (Invitrogen) or Immu-Mount (Thermo Electron Corporation, Courtaboeuf, France) for β-dystroglycan or CD68 staining, respectively. Whole hearts were dissected and the apex of the LV was removed, and immediately placed in fix (4% paraformaldehyde, 3% glutaraldehyde in 0.1 mol/L sodium phosphate buffer, pH 7.4) for 1 hour. The samples were transferred to 3% glutaraldehyde in phosphate buffer (0.1 mol/L sodium phosphate, pH 7.4) overnight, then washed for 15 minutes in phosphate buffer, and postfixed for 1.5 hours in phosphate buffer added with in 1% osmium tetraoxide. Following osmium fixation, the samples were rinsed 3 to 5 minutes in phosphate buffer, dehydrated for 10 minutes in successive ethanol washes (50%, 70%, 80%, 95%, 100%, 100%), and rinsed for 15 minutes in propylene oxide. Finally, the samples were embedded in Lowecryl resin, overnight. Sections of 70 to 80 nm were cut on a Reichert UltracutE, stained with 2% uranyl acetate plus Reynold's lead citrate and viewed using a Phillips CM120 transmission electron microscope. RNA isolation and Real-Time PCR analysis Total RNA was extracted from frozen hearts using TRIzol reagent (Qiagen, Hilden, Germany) and reverse transcription (RT)-PCR was performed as previously described.42Defer N Wan J Souktani R Escoubet B Perier M Caramelle P Manin S Deveaux V Bourin MC Zimmer A Lotersztajn S Pecker F Pavoine C The cannabinoid receptor type 2 promotes cardiac myocyte and fibroblast survival and protects against ischemia/reperfusion-induced cardiomyopathy.FASEB J. 2009; 23: 2120-2130Crossref PubMed Scopus (103) Google Scholar Concentration of total RNA was dosed using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA) and RNA quality was assessed by electrophoresis. cDNA was synthesized using SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen). Real-time PCR was performed on a Light Cycler (Roche Diagnostics, Meylan, France), using the Quantitest SYBR green kit (Qiagen) with sense and anti-sense oligonucleotides primers for the different genes (Table 1). The PCR-amplified products were controlled by sequencing. Relative levels of mRNA expression were calculated according to the ΔΔCT method.43Ponchel F Toomes C Bransfield K Leong FT Douglas SH Field SL Bell SM Combaret V Puisieux A Mighell AJ Robinson PA Inglehearn CF Isaacs JD Markham AF Real-time PCR based on SYBR-Green I fluorescence: an alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions.BMC Biotechnol. 2003; 3: 18Crossref PubMed Scopus (278) Google Scholar Individual mRNA expression values were normalized by comparison with 18S mRNA level.Table 1Primers Used for Quantitative RT-PCRGenePrimersFragment size (bp)NCBI referenceGLCLC5′−ATCCTCCAGTTCCTGCACAT−3′390NM_010295.15′−TGTGAATCCAGGGCCTA−3′GLCLM5′−GCCACCAGATTTGACTGCCTTT−3′119NM_008129.25′−CAGGGATGCTTTCTTGAAGAGCTT−3′GPX15′−GACTACACCGAGATGAACGA−3′110NM_008160.55′−CTTCATTCTTGCCATTCTCCT−3′COL1A15′−ACCTGTGTGTTCCCTACTCA−3′322NM_007742.25′−GACTGTTGCCTTCGCCTCTG−3′COL1A25′−TTAAGACTCAGCCACCCAGA−3′267NM_007743.25′−GAGCTGAGTTGCCATTTCCT−3′COL3A15′−AATGGTGGTTTTCAGTTCAGC−3′322NM_009930.15′−TGGGGTTTCAGAGAGTTTGGC−3′COL6A15′−AATTGCCCTGGTCATTACGG−3′169NM_009933.35′−CGATAAGCCTTGGCAGGAAA−3′18S5′−GTAACCCGTTGAACCCCATT−3′151XO11175′−CCATCCAATCGGTAGTAGCG−3′Abbreviations: GLCLC, glutamate-l-cysteine ligase catalytic subunit; GLCLM, glutamate-l-cysteine ligase modulatory subunit; GPX1, Glutathione peroxidase 1; COL1A1, procollagen type I, alpha 1; COL1A2, procollagen type I, alpha 2; COL3A1, procollagen type III, alpha 1; COL6A1, procollagen type VI, alpha 1. Open table in a new tab
Referência(s)