Siroheme- and [Fe4-S4]-dependent NirA from Mycobacterium tuberculosis Is a Sulfite Reductase with a Covalent Cys-Tyr Bond in the Active Site
2005; Elsevier BV; Volume: 280; Issue: 29 Linguagem: Inglês
10.1074/jbc.m502560200
ISSN1083-351X
AutoresR. Schnell, Tatyana Sandalova, Ulf Hellman, Ylva Lindqvist, G. Schneider,
Tópico(s)Tuberculosis Research and Epidemiology
ResumoThe nirA gene of Mycobacterium tuberculosis is up-regulated in the persistent state of the bacteria, suggesting that it is a potential target for the development of antituberculosis agents particularly active against the pathogen in its dormant phase. This gene encodes a ferredoxin-dependent sulfite reductase, and the structure of the enzyme has been determined using x-ray crystallography. The enzyme is a monomer comprising 555 amino acids and contains a [Fe4-S4] cluster and a siroheme cofactor. The molecule is built up of three domains with an α/β fold. The first domain consists of two ferredoxin-like subdomains, related by a pseudo-2-fold symmetry axis passing through the whole molecule. The other two domains, which provide much of the binding interactions with the cofactors, have a common fold that is unique to the sulfite/nitrite reductase family. The domains form a trilobal structure, with the cofactors and the active site located at the interface of all three domains in the center of the molecule. NirA contains an unusual covalent bond between the side chains of Tyr69 and Cys161 in the active site, in close proximity to the siroheme cofactor. Removal of this covalent bond by site-directed mutagenesis impairs catalytic activity, suggesting that it is important for the enzymatic reaction. These residues are part of a sequence fingerprint, able to distinguish between ferredoxin-dependent sulfite and nitrite reductases. Comparison of NirA with the structure of the truncated NADPH-dependent sulfite reductase from Escherichia coli suggests a binding site for the external electron donor ferredoxin close to the [Fe4-S4] cluster. The nirA gene of Mycobacterium tuberculosis is up-regulated in the persistent state of the bacteria, suggesting that it is a potential target for the development of antituberculosis agents particularly active against the pathogen in its dormant phase. This gene encodes a ferredoxin-dependent sulfite reductase, and the structure of the enzyme has been determined using x-ray crystallography. The enzyme is a monomer comprising 555 amino acids and contains a [Fe4-S4] cluster and a siroheme cofactor. The molecule is built up of three domains with an α/β fold. The first domain consists of two ferredoxin-like subdomains, related by a pseudo-2-fold symmetry axis passing through the whole molecule. The other two domains, which provide much of the binding interactions with the cofactors, have a common fold that is unique to the sulfite/nitrite reductase family. The domains form a trilobal structure, with the cofactors and the active site located at the interface of all three domains in the center of the molecule. NirA contains an unusual covalent bond between the side chains of Tyr69 and Cys161 in the active site, in close proximity to the siroheme cofactor. Removal of this covalent bond by site-directed mutagenesis impairs catalytic activity, suggesting that it is important for the enzymatic reaction. These residues are part of a sequence fingerprint, able to distinguish between ferredoxin-dependent sulfite and nitrite reductases. Comparison of NirA with the structure of the truncated NADPH-dependent sulfite reductase from Escherichia coli suggests a binding site for the external electron donor ferredoxin close to the [Fe4-S4] cluster. Mycobacterium tuberculosis, the causative agent of tuberculosis, poses a major threat to human health. Over the last decade, the number of registered cases has been progressively increasing, resulting presently in approximately 2 million deaths per year (statistics available on the World Wide Web at www.who.int). The emergence of multidrug-resistant strains of M. tuberculosis raises serious concerns about future capabilities to control this pathogen. Chemotherapy is further complicated by the ability of M. tuberculosis to persist in the lungs of infected individuals for decades by switching to a dormant or latent phase (1Bloom B.R. McKinney J.D. Nat. Med. 1999; 5: 872-874Crossref PubMed Scopus (41) Google Scholar), which also induces tolerance to current antibiotics (2Wayne L.G. Sramek H.A. Antimicrob. Agents Chemother. 1994; 38: 807-811Crossref Scopus (275) Google Scholar, 3Wallis R.S. Patil S. Cheon S.H. Edmonds K. Phillips M. Perkins M.D. Joloba M. Namale A. Johnson J.L. Teixeira L. Dietze R. Siddiqi S. Mugerwa R.D. Eisenach K. Ellner J.J. Antimicrob. Agents Chemother. 1999; 43: 2600-2666Crossref PubMed Google Scholar). Estimates by the WHO suggest that about one-third of the world's population is infected with persistent mycobacteria. Reactivation of these dormant bacteria can occur either spontaneously or as the consequence of an immunocompromised state (e.g. HIV infection/therapy), resulting in active tuberculosis. It is thus clear that a successful long term strategy against M. tuberculosis requires antibiotics targeting the bacteria also in the persistent state. Latency is associated with nonreplicating or very slow growth of M. tuberculosis, and several experimental in vitro models for the dormant phase of the bacilli have been developed (4Wayne L.G. Hayes L.G. Infect. Immun. 1996; 64: 2062-2069Crossref PubMed Google Scholar, 5Betts J.C. Lukey P.T. Robb L.C. McAdam R.A. Duncan K. Mol. Microbiol. 2002; 43: 717-731Crossref PubMed Scopus (1131) Google Scholar, 6Voskuil M.I. Schnappinger D. Visconti K.C. Harrell M.I. Dolganov G.M. Sherman D.R. Schoolnik G.K. J. Exp. Med. 2003; 198: 705-713Crossref PubMed Scopus (769) Google Scholar, 7Hu Y. Mangan J.A. Dhillon J. Sole K.M. Mitchison D.A. Butcher P.D. Coates A.R. J. Bacteriol. 2000; 182: 6358-6365Crossref PubMed Scopus (139) Google Scholar). Comparison of gene expression profiles and proteome analyses of active versus nonreplicating bacteria have identified a number of genes that are up-regulated in the dormant phase. Genes involved in oxidative stress, anaerobic respiration, and the metabolism of sulfur have consistently been identified as up-regulated in response to limited access to oxygen and nutrient starvation (8Hu Y. Coates A.R.M. FEMS Microbiol. Lett. 2001; 202: 59-65Crossref PubMed Google Scholar, 9Schnappinger D. Ehrt S. Voskuil M.I. Liu Y. Mangan J.A. Monahan I.M. Dolganov G. Efron B. Butcher P.D. Nathan C. Schoolnik G.K. J. Exp. Med. 2003; 198: 693-704Crossref PubMed Scopus (1143) Google Scholar, 10Hampshire T. Soneij S. Bacon J. James B.W. Hinds J. Laing K. Stabler R.A. Marsh P.D. Butcher P.D. Tuberculosis. 2004; 84: 228-238Crossref PubMed Scopus (174) Google Scholar, 11Starck J. Källenius G. Marklund B.-I. Andersson D.I. Åkerlund T. Microbiology. 2004; 150: 3821-3829Crossref PubMed Scopus (128) Google Scholar). One of the genes active in the dormant phase of M. tuberculosis is nirA (Rv2391) (9Schnappinger D. Ehrt S. Voskuil M.I. Liu Y. Mangan J.A. Monahan I.M. Dolganov G. Efron B. Butcher P.D. Nathan C. Schoolnik G.K. J. Exp. Med. 2003; 198: 693-704Crossref PubMed Scopus (1143) Google Scholar, 10Hampshire T. Soneij S. Bacon J. James B.W. Hinds J. Laing K. Stabler R.A. Marsh P.D. Butcher P.D. Tuberculosis. 2004; 84: 228-238Crossref PubMed Scopus (174) Google Scholar). Himar1 transposon mutagenesis has further shown that nirA is an essential gene (12Sasetti C.M. Boyd D.H. Rubin E.J. Mol. Microbiol. 2003; 48: 77-84Crossref PubMed Scopus (1998) Google Scholar). The amino acid sequence, derived from the nirA gene, shows homology to a family of ferredoxin-dependent sulfite/nitrite reductases. These enzymes are found in archaea, bacteria, fungi, and plants (for a review, see Refs. 13Crane B.R. Getzoff E.D. Curr. Opin. Struct. Biol. 1996; 6: 744-756Crossref PubMed Scopus (122) Google Scholar and 14Nakayama M. Akashi T. Hase T. J. Inorg. Biochem. 2000; 82: 27-32Crossref PubMed Scopus (79) Google Scholar). The sulfite reductases catalyze the reduction of sulfite to sulfide, one step in the biosynthesis of sulfur-containing amino acids and cofactors. Nitrite reductases participate in the assimilation of nitrogen via nitrate in plants and can also act in anaerobic energy metabolism. This class of sulfite/nitrite reductases generally accepts both nitrite and sulfite as substrate, but the particular metabolic function is reflected in pronounced differences in the kinetic parameters. These enzymes contain a unique combination of cofactors, a [Fe4-S4] iron-sulfur cluster and a siroheme (15Krueger R.J. Siegel L.M. Biochemistry. 1982; 21: 2892-2904Crossref PubMed Scopus (112) Google Scholar). NirA also shows weak amino acid sequence similarity to bacterial NADPH-dependent [Fe4-S4]- and siroheme-containing sulfite reductases (e.g. 23% sequence identity to CysI from Escherichia coli). Unlike the monomeric ferredoxin-dependent enzymes, the NADPH-dependent sulfite reductases are oligomeric complexes consisting of four or eight subunits of the hemoprotein component (CysI) and eight flavoprotein subunits that deliver electrons derived from NADPH to the redox centers of the hemoprotein subunit (16Siegel L.M. Davis P.S. Kamin H. J. Biol. Chem. 1974; 249: 1572-1586Abstract Full Text PDF PubMed Google Scholar, 17Zeghouf M. Fontecave M. Coves J. J. Biol. Chem. 2000; 275: 37651-37656Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). In the ferredoxin-dependent enzymes, the electron donor binds transiently and delivers electrons to the [Fe4-S4] cluster, one at a time (18Knaff D.B. Hirasawa M. Biochim. Biophys. Acta. 1991; 1056: 93-125Crossref PubMed Scopus (229) Google Scholar). The electrons are then transferred to the siroheme, which coordinates the substrate. The only available structural information for this enzyme family is the crystal structure of a truncated form of the hemoprotein subunit of NADPH-dependent sulfite reductase from E. coli, CysI, where 73 amino acids at the N terminus had been proteolytically removed before crystallization (19Crane B.R. Siegel L.M. Getzoff E.D. Science. 1995; 270: 59-67Crossref PubMed Scopus (271) Google Scholar, 20Crane B.R. Siegel L.M. Getzoff E.D. Biochemistry. 1997; 36: 12120-12137Crossref PubMed Scopus (113) Google Scholar). No three-dimensional structure for a representative of the ferredoxin-dependent sulfite/nitrite reductases is yet available. Here, we show that the nirA gene from M. tuberculosis encodes [Fe4-S4] and siroheme-dependent sulfite reductase. The crystal structure of the mycobacterial enzyme, a potential target for novel drugs against human persistent tuberculosis infection, revealed an unexpected covalent bond between the side chains of Tyr69 and Cys161 in the immediate vicinity of the siroheme cofactor and the substrate binding site. The functional implications of this tyrosyl-cysteine residue in the active site of NirA have been probed by site-directed mutagenesis. Gene Cloning and Expression Screening—The gene coding for the predicted NirA protein (Rv2391) 1There is an annotation ambiguity regarding the exact definition of the open reading frame coding for NirA (Rv2391) in the genome sequence of M. tuberculosis H37Rv. The Swiss-Prot data base entry P71753 assigns the first methionine of the sequence MSAKENPQMTTARPAKARNEG as the N terminus, whereas in the GenBank™ entry AAK46756, the second methionine is defined as start of the NirA protein. The latter appears more likely, since it results in a better Shine-Dalgarno sequence, and therefore a construct starting with the second methionine was chosen for further work. was amplified from M. tuberculosis H37Rv genomic DNA by PCR using Pfu Turbo polymerase (Stratagene) with the appropriate upstream primer GATCCATGGCCACTGCACGTCCCGCCAAG and the downstream primer GATAAGCTTATCGCAGGTCGTCCTCCTCG. The PCR fragments containing upstream NcoI and downstream HindIII sites were cloned into the pMOSBlue vector (Amersham Biosciences), and the nucleotide sequence of the PCR product was verified by DNA sequencing. Extensive expression screening using a series of expression vectors and several E. coli strains at different temperatures, however, only resulted in insoluble protein. Availability of the siroheme cofactor might be limiting for proper folding, and co-expression of cysG, coding for an uroporphyrinogen III C-methyl-transferase active in the biosynthesis of siroheme, has been shown to support the production of soluble siroheme-containing proteins (21Wu J.Y. Siegel L.M. Kredich N.M. J. Bacteriol. 1991; 173: 325-333Crossref PubMed Google Scholar, 22Curdt I. Singh B.B. Jakoby M. Hachtel W. Böhme H. Biochim. Biophys. Acta. 2000; 1543: 60-68Crossref PubMed Scopus (13) Google Scholar). The cysG gene was therefore amplified from Salmonella typhimurium genomic DNA and cloned into the expression vector utilizing the PBAD promoter pACYC origin of replication and compatible with all of our nirA expression constructs. Co-expression of cysG resulted in partially soluble product (up to ∼20% of the total amount of NirA produced) using modified pET28a-NirA plasmids containing either a His6 tag (MDVSHHHHHHG) or an IgG-binding ZZ tag (23Nilsson B. Moks T. Jansson B. Abrahamsen L. Elmblad A. Holmgren E. Henrichson C. Jones T.A. Uhlen M. Protein Eng. 1987; 1: 107-113Crossref PubMed Scopus (643) Google Scholar) inserted into the NcoI site. Protein Production and Purification—The pET28a expression system was chosen to produce the recombinant His6-NirA enzyme with E. coli BL21(DE3) as expression host. Typically, cells were grown in 2 liters of LB medium at 21 °C and induced in midlog phase by adding 0.1 mm isopropyl 1-thio-β-d-galactopyranoside and 0.01% arabinose and increasing the concentration of FeSO4 to 1 mm. After 24 h, E. coli cells were harvested, resuspended, and disrupted in a buffer (10 mm Tris-HCl, pH 8.0, 300 mm NaCl, and 10 mm imidazol) by lysozyme (0.08 mg/ml) treatment and sonication. The insoluble material was removed by centrifugation. The lysates were added to an Ni2+-nitrilotriacetic acid affinity matrix (Qiagen), and the bound proteins were eluted by an imidazol step-gradient. After desalting on a NAP10 column (Amersham Biosciences), the His6-NirA protein was purified to homogeneity by ion exchange chromatography using a Q-Sepharose column (Amersham Biosciences) and NaCl gradient elution. The protein was concentrated and kept frozen at -80 °C. The yield was ∼2.5 mg of protein from 1 liter of culture. Protein concentration was determined according to Bradford (24Bradford M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (215632) Google Scholar). Site-directed Mutagenesis—Site-directed mutagenesis was carried out using the QuikChange kit (Stratagene) following the manufacturer's recommendations. Mutagenic oligonucleotides used were CTTTCGCTGGTGGGGCCTGTTCACCCAGCGTGAGCAGGGC and GCCCTGCTCACGCTGGGTGAACAGGCCCCACCAGCGAAAG for Y69F; CTTTCGCTGGTGGGGCCTGGCCACCCAGCGTGAGCAGGGC and GCCCTGCTCACGCTGGGTCGGCAGGCCCCACCAGCGAAAG for Y69A; CTGCAGACCACCGAGGCGAGCGGTGACTGCCCGCGGGTAG and CTACCCGCGGGCAGTCACCGCTCGCCTCGGTGGTCTGCAG for C161S; and CTGCAGACCACCGAGGCGGCCGGTGACTGCCCGCGGGTAG and CTACCCGCGGGCAGTCACCGGCCGCCTCGGTGGTCTGCAG for C161A. In all cases, the mutant genes were sequenced to verify the absence of unintended mutations. Expression and purification of the mutant enzymes was carried out as for wild-type NirA. Enzyme Assay—Wild-type and mutant NirA was assayed for sulfite reductase activity using the artificial electron donor methyl viologen (MV), 2The abbreviations used are: MV, methyl viologen; r.m.s., root mean square. which was reduced by sodium dithionite (15Krueger R.J. Siegel L.M. Biochemistry. 1982; 21: 2892-2904Crossref PubMed Scopus (112) Google Scholar). The assay mixtures contained 100 mm Tris-HCl, pH 7.4, 5 mm sodium sulfite, 0.5 mm MV, and 1.5 mm sodium dithionite in a total volume of 0.8 ml at 22 °C. The reaction was started by the addition of sodium dithionite and followed spectrophotometrically as the consumption of reduced MV at 604 nm. The linear parts of the time curves were used to calculate the overall reaction rate for recombinant wild type and mutant enzymes. The background reoxidation rate of reduced methyl viologen was less than 0.1% of the enzymatic reaction. The extinction coefficient used at this wavelength was 1.4 × 104 m-1 cm-1 (25Asada K. J. Biol. Chem. 1967; 242: 3646-3654Abstract Full Text PDF PubMed Google Scholar). One unit of sulfite reductase activity is defined as that amount of enzyme that catalyzes the oxidation of 1 μmol of MV/min under assay conditions (15Krueger R.J. Siegel L.M. Biochemistry. 1982; 21: 2892-2904Crossref PubMed Scopus (112) Google Scholar). The reaction product, sulfide, was initially recognized by the typical smell of the developing H2S. For chemical identification of the product, 1 ml of the assay solution, including wild-type or mutant NirA, was added into the wells of a 24-well microtiter plate. The reaction was started by the addition of sodium dithionite, and the well was immediately sealed with coverslips carrying a hanging drop (3 μl) of 1.0 mm NaOH solution to trap the hydrogen sulfide formed. The latter was identified by the addition of 3.6 mm cadmium chloride or 2 mm N,N-dimethyl-p-phenylenediamine sulfate and 3 mm ferric chloride for the methylene blue assay (26Siegel L.M. Anal. Biochem. 1965; 11: 126-132Crossref PubMed Scopus (370) Google Scholar) to the drops. The assay for nitrite reductase activity consisted of the same mixture as above, except that nitrite (in the range 5-20 mm) was added instead of sodium sulfite. Nitrite reductase activity was monitored by MV oxidation or directly by the consumption of nitrite. For the latter case, the reaction was stopped at various time intervals, and the concentration of the remaining nitrite was determined spectrophotometrically at 540 nm after the addition of 0.02% (w/v) sulfanilamide and 0.002% (w/v) N-(1-naphtyl)ethylenediamine (27.Snell, F. D., and Snell, C. T. (1949) in Colorimetric Methods of Analysis (van Nostrand, R., ed) Vol. 3, pp. 804-805, Princeton, NJGoogle Scholar). Control experiments verified that components of the assay mixture did not interfere with the determination of nitrite concentration. Mass Spectrometry—The samples were in-gel digested using porcine sequence grade trypsin (Promega, Madison, WI) (28Hellman U. Jollès P. Jörnvall H. Proteomics in Functional Genomics: Protein Structure Analysis. Birkhauser Verlag AG, Basel, Switzerland2000: 43-54Crossref Scopus (66) Google Scholar). The digests were analyzed by matrix-assisted laser dissociation ionization time of flight mass spectrometry on a Bruker Ultraflex TOF/TOF spectrometer (Bruker Daltonics, Bremen, Germany) using α-cyanohydroxycinnamic acid as matrix and the instrument setting optimized for analytes up to m/z 3500. Internal calibration was achieved with the autolytic fragments of trypsin. Data were analyzed via GPMAW (Lighthouse Data, Odense, Denmark) Crystallization and Data Collection—Crystals of NirA were obtained by the hanging drop vapor diffusion method. 2 μl of the protein solution (10-14 mg/ml in 25 mm Tris buffer, pH 8.0, 150 mm sodium chloride) were mixed with 2 μl of well solution, containing 0.1 m Tris-HCl, pH range 8.2-8.7, 0.2 m MgCl2, and 30% polyethylene glycol 4000, and equilibrated against 1.0 ml of the well solution. Clusters of needle-shaped, brown crystals appeared after 3 days at room temperature. Rod-shaped single crystals suitable for x-ray structure analysis were obtained by streak seeding of freshly made drops (protein concentration 7 mg/ml) equilibrated for 1 day against the above mother liquor. X-ray data were collected from crystals after direct transfer into a nitrogen gas stream at 110 K, at station ID14-1, ESRF (Grenoble, France) and beam line ID711 at MAX-lab (Lund, Sweden). The x-ray data were processed and scaled with the programs MOSFLM and SCALA from the CCP4 suit (29Project Collaborative Computational Acta Crystallogr. D. 1994; 50: 760-763Crossref PubMed Scopus (19748) Google Scholar). Crystals belong to the monoclinic space group P21, with cell dimensions a = 59.9 Å, b = 83.3 Å, c = 108.8 Å, and β = 102.2°. A second crystal form in the orthorhombic space group P212121 with cell dimensions a = 84.25 Å, b = 115.35 Å, c = 114.7 Å was obtained under identical conditions. In both cases, the asymmetric unit contains two molecules, with a solvent content of ∼45%. The statistics of the data sets are given in Table I.Table IStatistics of data collection and refinementParameterValueSpace group P21Space group P212121Data collectionBeam lineID14-1 (ESRF)711 (MAX-lab)Resolution (Å)2.92.8No. of observed reflections73,907176,803No. of unique reflections23,20928,218I/s12.4 (3.4)aNumbers in parentheses are for the highest resolution shell.17.7 (3.5)Completeness99.1% (98.8%)100% (99.9%)Rsym9.6% (33.8%)10.9% (46.8%)B-factor from Wilson plot (Å2)53.355.3RefinementRfreeb5% of the reflections were used to monitor Rfree and were not included in the refinement.28.7% (40.8%)29.2% (38.6%)Rfactor21.3% (30.1%)21.4% (31.2%)No. of protein atoms86328632No. of cofactor atoms144144Overall B-factor (Å2)38.943.8r.m.s. deviation bonds (Å)0.0090.013r.m.s. deviation angles (degrees)1.331.50Ramachandran plotPercentage of non-glycine residues in most favorable regions85.087.0Percentage of non-glycine residues in additional allowed regions15.013.0a Numbers in parentheses are for the highest resolution shell.b 5% of the reflections were used to monitor Rfree and were not included in the refinement. Open table in a new tab Molecular Replacement and Crystallographic Refinement—The structure was solved by molecular replacement using the program MOLREP (30Vagin A. Teplyakov A. J. Appl. Crystallogr. 1997; 30: 1022-1025Crossref Scopus (4148) Google Scholar), initially in space group P21. A polyserine model of CysI from E. coli (19Crane B.R. Siegel L.M. Getzoff E.D. Science. 1995; 270: 59-67Crossref PubMed Scopus (271) Google Scholar) (Protein Data Bank accession code 2gep) with residues 158-172, 200-208, 268-274, and 554-569 omitted was used as a search model. The best solution for the monoclinic NirA data set had a correlation coefficient of 0.266 and an R-factor of 55% with two molecules in the asymmetric unit. Initial rounds of rigid body refinement using Refmac5 (31Murshudov G. Vagin A.A. Dodson E.J. Acta Crystallogr. D. 1997; 53: 240-253Crossref PubMed Scopus (13854) Google Scholar) resulted in a drop of the R-factor by 5%. The siroheme molecule and the iron-sulfur cluster were excluded from these refinement cycles, and the correctness of the molecular replacement solution was confirmed by electron density for the cofactors appearing at the expected positions. Manual rebuilding of the model was carried out with the program O (32Jones T.A. Zou J. Cowan S. Kjeldgaard M. Acta Crystallogr. Sect. A. 1991; 47: 110-119Crossref PubMed Scopus (13009) Google Scholar), based on σA weighted 2Fo - Fc and Fo - Fc electron density maps (33Read R.J. Acta Crystallogr. Sect. A. 1986; 42: 140-149Crossref Scopus (2035) Google Scholar), and refinement was continued with the program Refmac5 (31Murshudov G. Vagin A.A. Dodson E.J. Acta Crystallogr. D. 1997; 53: 240-253Crossref PubMed Scopus (13854) Google Scholar). Tight noncrystallographic symmetry restraints were applied in order to limit the number of parameters, except for a few loop regions with slightly different conformations. The structure determination for the orthorhombic NirA crystal form was carried out in a similar way, except that an initial NirA model from the monoclinic data set was used for the molecular replacement with residues 10-94 excluded from the search model. This stretch of the polypeptide chain was gradually rebuilt during refinement. CNS (34Brunger A.T. Adams P.D. Clore G.M. DeLano W.L. Gros P. Grosse-Kunstleve R.W. Jiang J.S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Rice L.M. Simonson T. Warren G.L. Acta Crystallogr. Sect. D. 1998; 54: 905-921Crossref PubMed Scopus (16957) Google Scholar) was employed to calculate composite omit maps at the end of refinement. The protein models were analyzed with PROCHECK (35Laskowski R.A. MacArthur M.W. Moss D.S. Thornton J. J. Appl. Crystallogr. 1993; 26: 282-291Crossref Google Scholar) in order to monitor the stereochemistry. Details of the refinement are given in Table I. Sequence alignments were carried out using ClustalW (36Thompson J.D. Higgins D.G. Gibson T.J. Nucleic Acids Res. 1994; 22: 4673-4680Crossref PubMed Scopus (55635) Google Scholar). Structural comparisons were done with the programs DALI (37Dietmann S. Park J. Notredame C. Heger A. Lappe M. Holm L. Nucleic Acids Res. 2001; 29: 55-57Crossref PubMed Scopus (147) Google Scholar), TOP (38Lu G. J. Appl. Crystallogr. 2000; 33: 176-183Crossref Scopus (193) Google Scholar), and the LSQ option in O (32Jones T.A. Zou J. Cowan S. Kjeldgaard M. Acta Crystallogr. Sect. A. 1991; 47: 110-119Crossref PubMed Scopus (13009) Google Scholar), applying default parameters. Figures were made using BOBSCRIPT (39Esnouf R.M. J. Mol. Graphics Modelling. 1997; 15: 133-138Crossref Scopus (1794) Google Scholar) and rendered with RASTER3D (40Meritt E.A. Murphy M.E.P. Acta Crystallogr. D. 1994; 50: 869-873Crossref PubMed Scopus (2857) Google Scholar). The atomic coordinates and structure factors for NirA have been deposited with the Protein Data Bank with accession numbers 1zj8 (space group P212121) and 1zj9 (space group P21). Characterization of Recombinant NirA—Recombinant NirA from M. tuberculosis has a brown color and shows the characteristic absorption spectrum of [Fe4-S4]- and siroheme-containing sulfite/nitrite reductases in the oxidized state (15Krueger R.J. Siegel L.M. Biochemistry. 1982; 21: 2892-2904Crossref PubMed Scopus (112) Google Scholar, 22Curdt I. Singh B.B. Jakoby M. Hachtel W. Böhme H. Biochim. Biophys. Acta. 2000; 1543: 60-68Crossref PubMed Scopus (13) Google Scholar, 41Kuznetsova S. Knaff D.B. Hirasawa M. Setif P. Mattioli T.A. Biochemistry. 2004; 43: 10765-10774Crossref PubMed Scopus (22) Google Scholar) (Fig. 1). Purified recombinant NirA is catalytically active as a sulfite reductase and is able to reduce sulfite to sulfide using the non-physiological electron donor methyl viologen. The reaction product sulfide was chemically identified by the characteristic yellow, insoluble cadmium sulfide and by the methylene blue assay (26Siegel L.M. Anal. Biochem. 1965; 11: 126-132Crossref PubMed Scopus (370) Google Scholar). The enzyme has a specific activity of 2.0 units/mg protein, comparable with sulfite reductases from other organisms (13Crane B.R. Getzoff E.D. Curr. Opin. Struct. Biol. 1996; 6: 744-756Crossref PubMed Scopus (122) Google Scholar, 15Krueger R.J. Siegel L.M. Biochemistry. 1982; 21: 2892-2904Crossref PubMed Scopus (112) Google Scholar). We could not detect any decrease in the concentration of nitrite in this assay. Reduction of the artificial electron donor methyl viologen by dithionite results in the formation of equimolar amounts of sulfite as a by-product, which will compete with nitrite as a substrate. The failure of the enzyme to reduce nitrite under these conditions, even when added in 10-fold excess over sodium dithionite, shows that NirA has a pronounced preference for sulfite over nitrite as substrate. 3Members of the SiR/NiR family usually are able to reduce both sulfite and nitrite, albeit at different rates. Absorption spectra of NirA recorded in the presence of nitrite or hydroxylamine, a postulated intermediate in the reduction of nitrite, show the same spectral changes as those described for spinach nitrite reductase (41Kuznetsova S. Knaff D.B. Hirasawa M. Setif P. Mattioli T.A. Biochemistry. 2004; 43: 10765-10774Crossref PubMed Scopus (22) Google Scholar, 53Vega J.M. Kamin H. J. Biol. Chem. 1977; 252: 896-909Abstract Full Text PDF PubMed Google Scholar). This indicated that NirA is able to bind nitrite and hydroxylamine and thus might be able to reduce nitrite although at lower rates than sulfite. Gel filtration chromatography and dynamic light scattering suggest that NirA is a monomer in solution (data not shown), a finding that is also consistent with the crystallographic analysis (see below). The Electron Density Map and Quality of the Model—The structure of NirA was solved by molecular replacement in two crystal forms, each containing two molecules in the asymmetric unit (Table I). Most parts of the polypeptide chain, including the iron-sulfur cluster and the siroheme cofactor, are well defined in electron density. The real space correlation to the electron density maps is in the range of 0.87-0.92 for both protein chains and space groups. The N-terminal His tag and the first nine residues of NirA are not seen in the electron density map. Less well defined regions of the polypeptide chain include several surface loops (residues 32-35, 51-55, 192-200, and 487-490). The final model consists of 8643 nonhydrogen protein atoms (two chains comprising residues 10-555) of NirA, two [Fe4-S4] clusters, two siroheme molecules, two chloride ions, and 20 water molecules. The stereochemistry of the model is as expected for this resolution (Table I). Superposition of the refined models of NirA from the two space groups gives an r.m.s. deviation of 0.45 Å, with the deviations mainly located in the weakly defined loop regions. Overall Structure of M. tuberculosis NirA—In solution and in the crystal, NirA is present as a monomer. The buried accessible surface areas for the enzyme molecules in both crystal forms are on the order of 550 Å2, corresponding to 2% of the total accessible surface area. This value is typical for crystal contacts rather than for a dimer interface. The NirA molecule consists of three α/β domains: the parachute (19Crane B.R. Siegel L.M. Getzoff E.D. Science. 1995; 270: 59-67Crossref PubMed Scopus (271) Google Scholar) domain (residues 1-159 and 331-405), the middle domain (residues 160-330), and the [Fe4-S4]-binding C-terminal domain (residues 406-555) (Fig. 2, A a
Referência(s)