Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

The Orphan Receptor C5L2 Has High Affinity Binding Sites for Complement Fragments C5a and C5a des-Arg74

2002; Elsevier BV; Volume: 277; Issue: 9 Linguagem: Inglês

10.1074/jbc.c100714200

ISSN

1083-351X

Autores

Stuart A. Cain, Peter N. Monk,

Tópico(s)

Receptor Mechanisms and Signaling

Resumo

The substantial variations in the responses of cells to the anaphylatoxin C5a and its desarginated form, C5adR74, suggest that more than one type of cell surface receptor for these ligands might exist. However, only a single receptor for C5a and C5adR74, CD88, has been characterized to date. Here we report that the orphan receptor C5L2/gpr77, which shares 35% amino acid identity with CD88, binds C5a with high affinity but has a 10-fold higher affinity for C5adR74 than CD88. C5L2 also has a moderate affinity for anaphylatoxin C3a, but cross-competition studies suggest that C3a binds to a distinct site from C5a. C4a was able to displace C3a, suggesting that C5L2, like the C3a receptor, may have a low binding affinity for this anaphylatoxin. Unlike CD88 and C3a receptor, C5L2 transfected into RBL-2H3 cells does not support degranulation or increases in intracellular [Ca2+] and is not rapidly internalized in response to ligand binding. However, ligation of C5L2 by anaphylatoxin did potentiate the degranulation response to cross-linkage of the high affinity IgE receptor by a pertussis toxin-sensitive mechanism. These results suggest that C5L2 is an anaphylatoxin-binding protein with unique ligand binding and signaling properties. The substantial variations in the responses of cells to the anaphylatoxin C5a and its desarginated form, C5adR74, suggest that more than one type of cell surface receptor for these ligands might exist. However, only a single receptor for C5a and C5adR74, CD88, has been characterized to date. Here we report that the orphan receptor C5L2/gpr77, which shares 35% amino acid identity with CD88, binds C5a with high affinity but has a 10-fold higher affinity for C5adR74 than CD88. C5L2 also has a moderate affinity for anaphylatoxin C3a, but cross-competition studies suggest that C3a binds to a distinct site from C5a. C4a was able to displace C3a, suggesting that C5L2, like the C3a receptor, may have a low binding affinity for this anaphylatoxin. Unlike CD88 and C3a receptor, C5L2 transfected into RBL-2H3 cells does not support degranulation or increases in intracellular [Ca2+] and is not rapidly internalized in response to ligand binding. However, ligation of C5L2 by anaphylatoxin did potentiate the degranulation response to cross-linkage of the high affinity IgE receptor by a pertussis toxin-sensitive mechanism. These results suggest that C5L2 is an anaphylatoxin-binding protein with unique ligand binding and signaling properties. Complement fragment C5a is a potent chemoattractant and anaphylatoxin that acts on all classes of leukocytes and on many other cell types including endothelial, smooth muscle, kidney, liver, and neuronal cells (1Gallin J.I. Goldstein I.M. Snyderman R. Inflammation: Basic Principles and Clinical Correlates. 1st Ed. Raven Press, New York1992: 63-81Google Scholar, 2Zwirner J. Fayyazi A. Gotze O. Mol. Immunol. 1999; 36: 877-884Crossref PubMed Scopus (80) Google Scholar). In addition to its proinflammatory effects, C5a has recently been shown to protect cells against toxic insult and to stimulate proliferation in neurons and hepatocytes (3Bhatia M. Saluja A.K. Singh V.P. Frossard J.L. Lee H.S. Bhagat L. Gerard C. Steer M.L. Am. J. Physiol. 2001; 280: G974-G978PubMed Google Scholar, 4Mukherjee P. Pasinetti G.M. J. Neuroimmunol. 2000; 105: 124-130Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 5O'Barr S.A. Caguioa J. Gruol D. Perkins G. Ember J.A. Hugli T. Cooper N.R. J. Immunol. 2001; 166: 4154-4162Crossref PubMed Scopus (126) Google Scholar, 6Mastellos D. Papadimitriou J.C. Franchini S. Tsonis P.A. Lambris J.D. J. Immunol. 2001; 166: 2479-2486Crossref PubMed Scopus (203) Google Scholar), suggesting a wider role for C5a in homeostasis. C5a is rapidly desarginated by serum carboxypeptidase N to the less potent derivative C5adR74, 1dR74des-Arg74CD88human C5a receptorC3aRhuman C3a receptorRBLrat basophilic leukemiaFluo3AMacetoxymethyl ester of Fluo3HAhemagglutininHSA-DNP2,4-dinitrophenol linked to human serum albuminIgEDNPimmunoglobulin E specific for 2,4-dinitrophenol 1dR74des-Arg74CD88human C5a receptorC3aRhuman C3a receptorRBLrat basophilic leukemiaFluo3AMacetoxymethyl ester of Fluo3HAhemagglutininHSA-DNP2,4-dinitrophenol linked to human serum albuminIgEDNPimmunoglobulin E specific for 2,4-dinitrophenol the first stage in deactivation of anaphylatoxin activity (7Bokisch V.A. Muller-Eberhardt H.J. J. Clin. Investig. 1970; 49: 2427-2434Crossref PubMed Scopus (379) Google Scholar). The dR74 form has a different spectrum of bioactivity to intact C5a; for instance, in human basophils, stimulation by intact C5a causes the release of lipid mediators (e.g. leukotriene C4) and cytokines (e.g. interleukin-4 and interleukin-13), whereas C5adR74 stimulates only cytokine release (8Eglite S. Pluss K. Dahinden C.A. J. Immunol. 2000; 165: 2183-2189Crossref PubMed Scopus (55) Google Scholar). Antagonists can also discriminate between different cell types: a cyclic peptide is 30-fold more potent on human neutrophils than a linear peptide antagonist, but both peptides are equally potent on human umbilical artery macrophages (9Paczkowski N.J. Finch A.M. Whitmore J.B. Short A.J. Wong A.K. Monk P.N. Cain S.A. Fairlie D.P. Taylor S.M. Br. J. Pharmacol. 1999; 128: 1461-1466Crossref PubMed Scopus (81) Google Scholar). Wide variations in antagonist affinity have also been observed in different species, but the sequences of C5a receptor homologs in these species do not suggest an obvious mechanism for these variations (10Cain S.A. Woodruff T.M. Taylor S.M. Fairlie D.P. Sanderson S.D. Monk P.N. Biochem. Pharmacol. 2001; 61: 1571-1579Crossref PubMed Scopus (13) Google Scholar). The molecular basis for the ability of different cell types to discriminate between agonists, antagonists, and intact C5a/C5adR74 has yet to be elucidated as only a single receptor for C5a (CD88), a member of the G protein-coupled receptor superfamily, has so far been cloned (11Gerard C. Gerard N.P. Nature. 1991; 349: 614-617Crossref PubMed Scopus (565) Google Scholar, 12Boulay F. Tardif M. Brouchon L. Vignais P. Biochemistry. 1991; 30: 2993-2999Crossref PubMed Scopus (192) Google Scholar). CD88 is in a G protein-coupled receptor subfamily that contains the receptors for human C3a (C3aR), formyl peptide, and an orphan receptor, C5L2 (also known as gpr77) (13Ohno M. Hirata T. Enomoto M. Araki T. Ishimaru H. Takahashi T.A. Mol. Immunol. 2000; 37: 407-412Crossref PubMed Scopus (142) Google Scholar, 14Lee D.K. George S.R. Cheng R. Nguyen T. Liu Y. Brown M. Lynch K.R. O'Dowd B.F. Brain Res. Mol. Brain Res. 2001; 86: 13-22Crossref PubMed Scopus (63) Google Scholar). C5L2 transcripts are widespread with expression demonstrated in spleen, testis, brain, heart, lung, liver, kidney, ovary, and colon and in granulocytes and dendritic cells but not monocyte-derived macrophages (13Ohno M. Hirata T. Enomoto M. Araki T. Ishimaru H. Takahashi T.A. Mol. Immunol. 2000; 37: 407-412Crossref PubMed Scopus (142) Google Scholar, 14Lee D.K. George S.R. Cheng R. Nguyen T. Liu Y. Brown M. Lynch K.R. O'Dowd B.F. Brain Res. Mol. Brain Res. 2001; 86: 13-22Crossref PubMed Scopus (63) Google Scholar). Here we report that C5L2 has high affinity binding sites for both C5a and C5adR74, apparently with a distinct binding site for the related anaphylatoxin C3a. Unlike CD88, C5L2 couples poorly to Gi-like G protein-mediated signaling pathways and does not undergo rapid receptor internalization in response to ligand binding. des-Arg74 human C5a receptor human C3a receptor rat basophilic leukemia acetoxymethyl ester of Fluo3 hemagglutinin 2,4-dinitrophenol linked to human serum albumin immunoglobulin E specific for 2,4-dinitrophenol des-Arg74 human C5a receptor human C3a receptor rat basophilic leukemia acetoxymethyl ester of Fluo3 hemagglutinin 2,4-dinitrophenol linked to human serum albumin immunoglobulin E specific for 2,4-dinitrophenol RBL-2H3 cells were routinely cultured in Dulbecco's modified Eagle's medium + 10% (v/v) fetal calf serum, which was supplemented with 400 mg/liter G-418 for transfected cells, at 37 °C in 5% CO2. The C5L2 cDNA was cloned from a human brain (whole) Marathon-Ready cDNA (CLONTECH) by PCR using the sense primer 5′-GCGCGCAAGCTT GCCACC ATGTACCCATACGACGTCCCAGACTACGCTGGGAACGATTCTGTCAGCTAC-3′ and the antisense primer 5′-GGGCCCGAATTCCTACACCTCCATCTCCGAGAC-3′. The addedHindIII and EcoRI restriction sites are shown respectively in italics, the Kozak sequence used is shown underlined, and the added human influenza hemagglutinin (HA) tag on the sense primer is shown in bold. After authentication by sequencing, the full-length PCR product was digested with EcoRI andHindIII (Roche Molecular Biochemicals) and ligated into the expression vector pEE6hCMV.neo (Celltech). The C3aR cDNA, a generous gift of P. Gasque (Cardiff, United Kingdom), was inserted into PEE6hCMV.neo vector at the same site. Stable transfection of RBL-2H3 cells was achieved by electroporation as previously described (15Monk P.N. Barker M.D. Partridge L.J. Pease J.E. J. Biol. Chem. 1995; 270: 16625-16629Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). An anti-HA tag monoclonal antibody (clone 12CA5, Roche Molecular Biochemicals) or C3aR (clone P4B4, a generous gift from P. Gasque) was used to sort the highest 5% of transfected cells on a Becton-Dickinson Vantage flow cytometer in three rounds of cell sorting. C4a was cloned from the same human brain library as C5L2 using the sense primer 5′-CCGCCGGGATCCAACGTGAACTTCCAAAAGGCGA-3′ and the antisense primer 5′-GCACCTGGTACCCTATTATCGTTGGAGGCCCGCCT-3′; the addedBamHI and KpnI restriction sites are shown respectively in italics. Expression and purification of the recombinant His6-tagged C5a, C5adR74, C3a, and C4a was performed under denaturing conditions as described previously (9Paczkowski N.J. Finch A.M. Whitmore J.B. Short A.J. Wong A.K. Monk P.N. Cain S.A. Fairlie D.P. Taylor S.M. Br. J. Pharmacol. 1999; 128: 1461-1466Crossref PubMed Scopus (81) Google Scholar). C4a was also expressed and purified under nondenaturing conditions by sonication in the presence of BugBuster Protein Extraction Reagent (Novagen) using the conditions recommended by the manufacturer. Cellular activation was measured as the release of β-hexosaminidase from intracellular granules (16Cain S.A. Ratcliffe C.F. Williams D.M. Harris V. Monk P.N. J. Immunol. Methods. 2000; 245: 139-145Crossref PubMed Scopus (11) Google Scholar). The percentage of β-hexosaminidase release was calculated as a percentage of the maximal release (1 μm C5a or C3a for CD88 and C3aR, respectively) or total cellular β-hexosaminidase (C5L2). EC50 and standard error values were obtained by iterative curve fitting using GraphPad Prism 2.0. Alternatively activation was assayed as the increase in intracellular [Ca2+] measured by flow cytometry of RBL cells labeled with the fluorescent indicator Fluo3AM (15Monk P.N. Barker M.D. Partridge L.J. Pease J.E. J. Biol. Chem. 1995; 270: 16625-16629Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). Competition binding assays were performed using 50 pm125I-C5a or125I-C3a (PerkinElmer Life Sciences) on adherent C5aR-transfected RBL cells in 96-well microtiter plates at 4 °C as described previously (17Monk P.N. Pease J.E. Marland G. Barker M.D. Eur. J. Immunol. 1994; 24: 2922-2925Crossref PubMed Scopus (21) Google Scholar). Binding curves were generated by incubating adherent cells in microtiter plates (at 55,000/well) with increasing concentrations of radiolabeled C5a and C3a in the presence or absence of 1 μm unlabeled anaphylatoxin. The IC50, standard error values, and linear regression analyses were obtained by using GraphPad Prism 2.0. These were performed as described previously (18Bock D. Martin U. Gartner S. Rheinheimer C. Raffetseder U. Arseniev L. Barker M.D. Monk P.N. Bautsch W. Kohl J. Klos A. Eur. J. Immunol. 1997; 27: 1522-1529Crossref PubMed Scopus (26) Google Scholar). Transfected RBL cells were incubated with 100 nm ligand to stimulate receptor internalization, which was determined as the loss of surface receptor using specific monoclonal antibodies for CD88 (clone S5/1, Serotec), C3aR (clone P4B4), and HA tag at 10 μg/ml. A sequence alignment between CD88, C3aR, and C5L2 is shown in Fig. 1. The N termini of CD88 and C5L2 contain several acidic residues that are characteristic of complement fragment receptors and that, for CD88 at least, form a part of the ligand binding site (19Mery L. Boulay F. Eur. J. Haematol. 1993; 51: 2872-2877Google Scholar). Both CD88 and C3aR have been shown to have distinct ligand binding and activation sites (20Siciliano S.J. Rollins T.E. DeMartino J. Konteatis Z. Malkowitz L. Van Riper G. Bondy S. Rosen H. Springer M.S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1214-1218Crossref PubMed Scopus (218) Google Scholar). Receptor activation by ligand involves the engagement of charged and uncharged residues on the extracellular faces of the transmembrane helices. For CD88, these include Ile116, Val286, Arg175, Glu199, Arg206, and Asp282 (21Geva A. Lassere T.B. Lichtarge O. Pollitt S.K. Baranski T.J. J. Biol. Chem. 2000; 275: 35393-35401Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 22Crass T. Bautsch W. Cain S.A. Pease J.E. Monk P.N. Biochemistry. 1999; 38: 9712-9717Crossref PubMed Scopus (19) Google Scholar, 23Cain S.A. Coughlan T. Monk P.N. Biochemistry. 2001; 40: 14047-14052Crossref PubMed Scopus (27) Google Scholar); C3aR has conserved residues at most analogous positions (Fig. 1). Interestingly C5L2 shares all of these residues except for Asp282, where there is a Glu residue (boxed residues in Fig. 1). Thus C5L2 has a similar acidic ligand-binding N-terminal domain to CD88 and a similar ligand activation domain. C5L2 was cloned from a human brain cDNA library and expressed as a stable transfectant in the rat basophilic leukemia line RBL-2H3. Antibodies against an N-terminal HA peptide, inserted after the initiating methionine of C5L2, was used to select the top 5% of expressing cells by fluorescence-activated cell sorting in three rounds of cell sorting. Anti-HA antibody, but not anti-CD88 or anti-C3aR monoclonal antibody, recognized these cells (data not shown). Binding assays were performed using 125I-C5a and 125I-C3a to determine the ligand specificity. The specific binding curve indicates that specific, saturable binding of C5a occurs (Fig.2 a) with a receptor number calculated from the B max value of 39,736 ± 5,993/cell, mean ± S.E., n = 3. C3a also binds specifically (Fig. 2 b) with a similar number of binding sites (25,652 ± 10,237/cell, mean ± S.E., n= 3; not significantly different from the C5a binding site number), but the calculated affinity for C5a was higher than that for C3a. Ligand specificity was investigated further using competition binding analysis, preincubating cells with a number of potential ligands prior to the addition of 125I-C5a or 125I-C3a (TableI). Using 125I-C5a, the IC50 for C5a was similar to that observed with CD88 in RBL cells, but C5L2 had a 10-fold lower IC50 for C5adR74 than CD88 (Table I). In contrast, C3a and C4a were very poor competitors for 125I-C5a binding to both C5L2 and CD88 (Table I). A very different pattern was observed using125I-C3a: C5a, C4a, and C3a all had similar IC50 values for 125I-C3a binding to C5L2 (TableI), whereas C5adR74, a very effective competitor for125I-C5a binding, had no detectable ability to compete for125I-C3a binding (Table I). This pattern is clearly different to that observed for C3aR (Table I) where both C3a and C4a competed much more effectively with 125I-C3a than C5a or C5adR74. These data demonstrate that C5L2 has a high affinity binding site for C5a and C5adR74 and that C3a (and possibly also C4a) is a low affinity ligand for C5L2. It is likely that the binding sites for C5a and C3a on C5L2 are distinct because of the complex pattern of competition between ligands, in particular the complete failure of C5adR74 to compete with125I-C3a. The location of the C3a binding site is, however, unclear as C5L2 does not have the very large second extracellular loop that appears to form the binding site for C3a on C3aR (24Chao T.H. Ember J.A. Wang M. Bayon Y. Hugli T.E. Ye R.D. J. Biol. Chem. 1999; 274: 9721-9728Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). The binding of C4a to C3aR has been previously observed (25Lienenklaus S. Ames R.S. Tornetta M.A. Sarau H.M. Foley J.J. Crass T. Sohns B. Raffetseder U. Grove M. Holzer A. Klos A. Kohl J. Bautsch W. J. Immunol. 1998; 161: 2089-2093PubMed Google Scholar), albeit with a larger difference between C3a and C4a affinities than observed here. The relatively high binding activity of the recombinant C4a used here may be due to the production process, which did not include the denaturation/refolding step used for C5a and C3a. Denaturation of C4a in urea during purification appeared to destroy both the C5L2 and C3aR binding activity.Table ICompetition binding analysis of RBL cells transfected with CD88, C3aR, or C5L2Unlabeled ligandReceptor (radioligand)CD88 (125I-C5a)C3aR (125I-C3a)C5L2 (125I-C5a)C5L2 (125I-C3a)−log IC501-aIC50, concentration of unlabeled ligand resulting in 50% of maximal radioligand binding. ± S.E.IC50n1-bn, number of separate experiments performed in triplicate.−log IC50 ± S.E.IC50n−log IC50 ± S.E.IC50n−log IC50 ± S.E.IC50nnmnmnmnmC5a7.72 ± 0.0319.0145.54 ± 0.072,90038.02 ± 0.04**9.5076.53 ± 0.16***2933C5adR746.39 ± 0.0941265.02 ± 0.189,67037.44 ± 0.10***36.53 5%; **, p < 0.5%; ***,p < 0.005% (t test).1-a IC50, concentration of unlabeled ligand resulting in 50% of maximal radioligand binding.1-b n, number of separate experiments performed in triplicate. Open table in a new tab Significantly different from human C5a receptor (CD88) (125I-C5a) or human C3a receptor (C3aR) (125I-C3a): ns,p > 5%; **, p < 0.5%; ***,p < 0.005% (t test). The ligand binding data suggested the possibility that the high affinity of C5L2 for C5adR74 might explain the sensitivity of some cell types to this ligand. We examined this by assessing the ability of C5L2 to activate transfected RBL cells using the degranulation response to ligand binding. The C5L2 ligands (C5a, C4a, C3a, and C5adR74) were not able to support degranulation at concentrations of up to 3 μm (Fig.3 a). In contrast, C5a and C5adR74 (EC50 = 8 and 21 nm, respectively) could activate CD88-transfected RBL cells (Fig.3 b), and C3a (EC50 = 52 nm) but not C4a could activate C3aR-transfected RBL cells (Fig. 3 c). C5L2 also did not increase degranulation even when RBL cells were primed with phorbol 12-myristate 13-acetate (100 nm), a treatment that enhances the response to suboptimal stimuli in RBL cells (26Monk P.N. Bingham B.R. Ahmad T.B. Helm B.A. Receptor. 1993; 3: 77-86PubMed Google Scholar), for 10 min prior to the addition of ligand (data not shown) (17Monk P.N. Pease J.E. Marland G. Barker M.D. Eur. J. Immunol. 1994; 24: 2922-2925Crossref PubMed Scopus (21) Google Scholar). The failure of C4a to activate C3aR has been previously reported (25Lienenklaus S. Ames R.S. Tornetta M.A. Sarau H.M. Foley J.J. Crass T. Sohns B. Raffetseder U. Grove M. Holzer A. Klos A. Kohl J. Bautsch W. J. Immunol. 1998; 161: 2089-2093PubMed Google Scholar). The signaling activity of C5L2 was also assessed as the increase in intracellular Ca2+ using Fluo3AM-labeled RBL cells, an assay previously shown to be 10-fold more sensitive to ligand concentration than degranulation (15Monk P.N. Barker M.D. Partridge L.J. Pease J.E. J. Biol. Chem. 1995; 270: 16625-16629Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). Cells expressing C5L2 did not respond to 100 nm C5a, C5adR74, C3a, or C4a (Fig. 3 d), whereas RBL cells expressing CD88 responded to C5a and C5adR74 with robust increases in cellular fluorescence (Fig. 3 e), and RBL cells expressing C3aR responded to C3a but not to C4a (Fig.3 f). Identical patterns of activity were observed using 1 μm ligand (data not shown). The absence of intracellular Ca2+ signaling is not due to low receptor number because the receptor expression level for C5L2 (∼40,000/cell) is actually higher than CD88 expression (∼36,000/cell (17Monk P.N. Pease J.E. Marland G. Barker M.D. Eur. J. Immunol. 1994; 24: 2922-2925Crossref PubMed Scopus (21) Google Scholar)). We then examined whether ligand binding to C5L2 could prime RBL cells for a subsequent stimulus through the tyrosine kinase-coupled high affinity IgE receptor, FcεRI. C5L2-transfected RBL cells were incubated with IgEDNP and activated by addition of 100 ng/ml HSA-DNP. Pretreatment for 10 min with 100 nm C5a, C3a, C4a, and C5adR74 caused small but significant increases in the secretory response to HSA-DNP (Fig. 4). Untransfected cells did not show any increased response to HSA-DNP (Fig. 4), and the pretreatment of C5L2-transfected cells with pertussis toxin at a dose that could completely inhibit the degranulatory response to ligation of CD88 (10 ng/ml for 4 h (30Ahamed J. Haribabu B. Ali H. J. Immunol. 2001; 167: 3559-3563Crossref PubMed Scopus (30) Google Scholar)) also inhibited the effects of C5L2 ligands on the HSA-DNP response (Fig. 4). It appears that a low level of pertussis toxin-sensitive G protein-dependent signal transduction can occur following ligand binding to C5L2. The relatively weak coupling of C5L2 to G protein (probably Gi) is not surprising because C5L2 does not have a sequence corresponding to the DRY motif found in most chemoattractant and chemokine receptors (Fig. 1); CD88 has132DRF, C3aR has DRC, but C5L2 has DLC (Fig. 1). The arginine residue of this motif in particular has been shown to be important in coupling to G proteins; mutation of the analogous residue in formyl peptide receptor inhibits signaling because of uncoupling from G protein (27Prossnitz E.R. Gilbert T.L. Chiang S. Campbell J.J. Qin S. Newman W. Sklar L.A. Ye R.D. Biochemistry. 1999; 38: 2240-2247Crossref PubMed Scopus (40) Google Scholar). In addition, the third intracellular loop of C5L2 is much shorter than that of CD88 and C3aR (Fig. 1) and lacks Ser/Thr residues that may be protein kinase C phosphorylation sites as well as a conserved basic region (239KTLK in CD88). Mutation of these Ser/Thr residues to Ala in CD88 inhibits signaling but not ligand binding (18Bock D. Martin U. Gartner S. Rheinheimer C. Raffetseder U. Arseniev L. Barker M.D. Monk P.N. Bautsch W. Kohl J. Klos A. Eur. J. Immunol. 1997; 27: 1522-1529Crossref PubMed Scopus (26) Google Scholar), suggesting that this loop plays an essential role in G protein coupling. RBL cells are regarded as an excellent model system for the expression of granulocyte chemoattractant receptors (28Ali H. Richardson R.M. Tomhave E.D. DuBose R.A. Haribabu B. Snyderman R. J. Biol. Chem. 1994; 269: 24557-24563Abstract Full Text PDF PubMed Google Scholar) with similar G proteins and other receptor-associated molecules. Platelet-activating factor receptor transfected into RBL cells (29Ali H. Richardson R.M. Tomhave E.D. Didsbury J.R. Snyderman R. J. Biol. Chem. 1993; 268: 24247-24254Abstract Full Text PDF PubMed Google Scholar) couples primarily to pertussis toxin-insensitive G proteins, demonstrating that different types of G proteins are available for stimulus-secretion coupling in the RBL cell line. We conclude therefore that C5L2, despite being expressed at high levels on granulocytes (13Ohno M. Hirata T. Enomoto M. Araki T. Ishimaru H. Takahashi T.A. Mol. Immunol. 2000; 37: 407-412Crossref PubMed Scopus (142) Google Scholar), couples only poorly to the normal range of G proteins for a granulocyte chemoattractant receptor. The possibility that C5L2 has additional signaling functions that do not require Gi protein activation cannot be excluded. This might occur, for example, by the receptor phosphorylation-dependent mechanism utilized by C3aR for chemokine production (30Ahamed J. Haribabu B. Ali H. J. Immunol. 2001; 167: 3559-3563Crossref PubMed Scopus (30) Google Scholar).Figure 4Potentiation by C5L2 ligands of the degranulation response to cross-linkage of the high affinity IgE receptor. RBL cells transfected with C5L2 or untransfected control cells were incubated overnight with 1 μg/ml IgEDNP and then treated with buffer or 100 nm C5a, C5adR74, C4a, or C3a for 15 min prior to the addition of the cross-linking agent HSA-DNP at 100 ng/ml. Degranulation was assessed as the secretion of β-hexosaminidase. In some cases cells were pretreated with 10 ng/ml pertussis toxin (PT) for 4 h prior to the addition of C5L2 ligands. Results are shown as a percentage of the release stimulated by 100 ng/ml HSA-DNP in the absence of anaphylatoxin (control = 100) and are means of three to six separate experiments performed in triplicate ± S.E. Significantly different from untransfected RBL cell response:ns, p > 5%; *, p < 5%; **, p < 0.5% (t test).View Large Image Figure ViewerDownload Hi-res image Download (PPT) CD88 and C3aR both undergo ligand-dependent internalization (25Lienenklaus S. Ames R.S. Tornetta M.A. Sarau H.M. Foley J.J. Crass T. Sohns B. Raffetseder U. Grove M. Holzer A. Klos A. Kohl J. Bautsch W. J. Immunol. 1998; 161: 2089-2093PubMed Google Scholar) when expressed in RBL cells, and so the ability of ligands (100 nm C5a, C5adR74, C4a, and C3a) to stimulate C5L2 internalization was investigated using anti-HA antibody to measure surface expression. None of the C5L2 ligands induced internalization after a 10-min incubation at 37 °C, although 55% of surface CD88 and 75% of surface C3aR internalized after 10 min of treatment by 100 nm C5a/C5adR74 or C3a, respectively (Fig.5). The broad expression pattern and ligand preference of C5L2 initially suggested the possibility that C5L2 may act as a “sink” for excess anaphylatoxin following activation of the complement cascade, analogous to the Duffy and D6 promiscuous chemokine-binding proteins that may function in the buffering and presentation of chemokines (31Murphy P.M. Baggiolini M. Charo I.F. Hebert C.A. Horuk R. Matsushima K. Miller L.H. Oppenheim J.J. Power C.A. Pharmacol. Rev. 2000; 52: 145-176PubMed Google Scholar). As it is not rapidly internalized, C5L2 is unlikely to be involved in anaphylatoxin clearance but might act as a reservoir of cell surface-associated anaphylatoxin to aid chemotaxis or to buffer anaphylatoxin concentrations during an inflammatory response. Alternatively, although internalization and receptor desensitization are not directly correlated, the retention of ligated C5L2 at the cell surface may be involved in prolonging signaling beyond the rapid responses normally stimulated by C5a. In conclusion, we have shown that C5L2 has high affinity binding sites for C5a and C5adR74 and also binds C3a and C4a with a similar affinity to C3aR. However, C5L2 couples poorly to the intracellular signaling and internalization machinery used by other chemoattractant receptors. The functions of this novel anaphylatoxin-binding protein remain to be defined.

Referência(s)