Matthew-Wood Syndrome Is Caused by Truncating Mutations in the Retinol-Binding Protein Receptor Gene STRA6
2007; Elsevier BV; Volume: 80; Issue: 6 Linguagem: Inglês
10.1086/518177
ISSN1537-6605
AutoresChristelle Golzio, Jelena Martinovic-Bouriel, Sophie Thomas, Soumaya Mougou-Zrelli, Bettina Grattagliano‐Bessières, Maryse Bonnière, S. Delahaye, Arnold Munnich, Férechté Encha-Razavi, Stanislas Lyonnet, Michel Vekemans, Tania Attié‐Bitach, Heather Etchevers,
Tópico(s)Cell Adhesion Molecules Research
ResumoRetinoic acid (RA) is a potent teratogen in all vertebrates when tight homeostatic controls on its endogenous dose, location, or timing are perturbed during early embryogenesis. STRA6 encodes an integral cell-membrane protein that favors RA uptake from soluble retinol-binding protein; its transcription is directly regulated by RA levels. Molecular analysis of STRA6 was undertaken in two human fetuses from consanguineous families we previously described with Matthew-Wood syndrome in a context of severe microphthalmia, pulmonary agenesis, bilateral diaphragmatic eventration, duodenal stenosis, pancreatic malformations, and intrauterine growth retardation. The fetuses had either a homozygous insertion/deletion in exon 2 or a homozygous insertion in exon 7 predicting a premature stop codon in STRA6 transcripts. Five other fetuses presenting at least one of the two major signs of clinical anophthalmia or pulmonary hypoplasia with at least one of the two associated signs of diaphragmatic closure defect or cardiopathy had no STRA6 mutations. These findings suggest a molecular basis for the prenatal manifestations of Matthew-Wood syndrome and suggest that phenotypic overlap with other associations may be due to genetic heterogeneity of elements common to the RA- and fibroblast growth factor–signaling cascades. Retinoic acid (RA) is a potent teratogen in all vertebrates when tight homeostatic controls on its endogenous dose, location, or timing are perturbed during early embryogenesis. STRA6 encodes an integral cell-membrane protein that favors RA uptake from soluble retinol-binding protein; its transcription is directly regulated by RA levels. Molecular analysis of STRA6 was undertaken in two human fetuses from consanguineous families we previously described with Matthew-Wood syndrome in a context of severe microphthalmia, pulmonary agenesis, bilateral diaphragmatic eventration, duodenal stenosis, pancreatic malformations, and intrauterine growth retardation. The fetuses had either a homozygous insertion/deletion in exon 2 or a homozygous insertion in exon 7 predicting a premature stop codon in STRA6 transcripts. Five other fetuses presenting at least one of the two major signs of clinical anophthalmia or pulmonary hypoplasia with at least one of the two associated signs of diaphragmatic closure defect or cardiopathy had no STRA6 mutations. These findings suggest a molecular basis for the prenatal manifestations of Matthew-Wood syndrome and suggest that phenotypic overlap with other associations may be due to genetic heterogeneity of elements common to the RA- and fibroblast growth factor–signaling cascades. Microphthalmia refers to a clinical spectrum that is characterized by a congenital reduction in the size of the optic globe(s), which may be reduced to a vestige visible only on histological analysis. This most severe form of microphthalmia is sometimes called "secondary" or "clinical" anophthalmia and occurs later in development than primary anophthalmia because of a lack of optic vesicle formation from the embryonic prosencephalon. Isolated severe microphthalmia/anophthalmia demonstrates both genetic and phenotypic heterogeneity in humans, currently implicating genes coding for transcription factors. CHX10 mutations lead to microphthalmia, coloboma, and cataracts1Ferda Percin E Ploder LA Yu JJ Arici K Horsford DJ Rutherford A Bapat B Cox DW Duncan AM Kalnins VI et al.Human microphthalmia associated with mutations in the retinal homeobox gene CHX10.Nat Genet. 2000; 25: 397-401Crossref PubMed Scopus (230) Google Scholar, 2Bar-Yosef U Abuelaish I Harel T Hendler N Ofir R Birk OS CHX10 mutations cause non-syndromic microphthalmia/anophthalmia in Arab and Jewish kindreds.Hum Genet. 2004; 115: 302-309Crossref PubMed Scopus (62) Google Scholar; mutations in the RAX gene have been identified in an individual with unilateral anophthalmia and sclerocornea in the other eye.3Voronina VA Kozhemyakina EA O'Kernick CM Kahn ND Wenger SL Linberg JV Schneider AS Mathers PH Mutations in the human RAX homeobox gene in a patient with anophthalmia and sclerocornea.Hum Mol Genet. 2004; 13: 315-322Crossref PubMed Scopus (159) Google ScholarPAX6 mutations lead to diverse congenital ocular malformations, the most common of which is aniridia, but a few genotypes have been described to date that engender primary anophthalmia4Glaser T Jepeal L Edwards JG Young SR Favor J Maas RL PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects.Nat Genet. 1994; 7: 463-471Crossref PubMed Scopus (575) Google Scholar or microphthalmia,5Azuma N Yamaguchi Y Handa H Hayakawa M Kanai A Yamada M Missense mutation in the alternative splice region of the PAX6 gene in eye anomalies.Am J Hum Genet. 1999; 65: 656-663Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 6Vincent MC Pujo AL Olivier D Calvas P Screening for PAX6 gene mutations is consistent with haploinsufficiency as the main mechanism leading to various ocular defects.Eur J Hum Genet. 2003; 11: 163-169Crossref PubMed Scopus (74) Google Scholar, 7Azuma N Yamaguchi Y Handa H Tadokoro K Asaka A Kawase E Yamada M Mutations of the PAX6 gene detected in patients with a variety of optic-nerve malformations.Am J Hum Genet. 2003; 72: 1565-1570Abstract Full Text Full Text PDF PubMed Scopus (202) Google Scholar as documented in the PAX Allelic Variant Database. Syndromic microphthalmias (MIM 164180, 206900, 206920, 248450, 300166, 301590, 309801, 600776, 605856, 607932, 610125, 610126, and 601349) can be associated with craniofacial dysmorphic features, heart and vascular malformations, skeletal and limb anomalies, skin or gut defects, mental retardation, and hydrocephalus, or combinations thereof. Although rare, the association of severe microphthalmia and pulmonary hypoplasia (MIM 601186) is a distinct entity known as "Matthew-Wood syndrome" (MWS [MIM 601186]).8Li L Wei J A newborn with anophthalmia and pulmonary hypoplasia (the Matthew-Wood syndrome).Am J Med Genet A. 2006; 140: 1564-1566Crossref PubMed Scopus (79) Google Scholar Most authors have reported further associations of MWS with cardiac and/or diaphragmatic malformations and intrauterine growth retardation (IUGR).9Berkenstadt M Lev D Achiron R Rosner M Barkai G Pulmonary agenesis, microphthalmia, and diaphragmatic defect (PMD): new syndrome or association?.Am J Med Genet. 1999; 86: 6-8Crossref PubMed Scopus (28) Google Scholar, 10Engellenner W Kaplan C Van de Vegte GL Pulmonary agenesis association with nonimmune hydrops.Pediatr Pathol. 1989; 9: 725-730Crossref PubMed Scopus (20) Google Scholar, 11Seller MJ Davis TB Fear CN Flinter FA Ellis I Gibson AG Two sibs with anophthalmia and pulmonary hypoplasia (the Matthew-Wood syndrome).Am J Med Genet. 1996; 62: 227-229Crossref PubMed Scopus (29) Google Scholar, 12Spear GS Yetur P Beyerlein RA Bilateral pulmonary agenesis and microphthalmia.Am J Med Genet Suppl. 1987; 3: 379-382Crossref PubMed Google Scholar, 13Steiner RD Dignan P St J Hopkin RJ Kozielski R Bove KE Combination of diaphragmatic eventration and microphthalmia/anophthalmia is probably nonrandom.Am J Med Genet. 2002; 108: 45-50Crossref PubMed Scopus (15) Google Scholar In two familial cases of MWS, we have excluded mutations in the FGF10 and FGFR2IIIb genes encoding fibroblast growth factor 10 and its specific receptor isoform.14Martinovic-Bouriel J Bernabe-Dupont C Golzio C Grattagliano-Bessieres B Malan V Bonniere M Esculpavit C Fallet-Bianco C Mirlesse V Le Bidois J et al.Matthew-Wood syndrome: report of two new cases supporting autosomal recessive inheritance and exclusion of FGF10 and FGFR2.Am J Med Genet A. 2007; 143: 219-228Crossref PubMed Scopus (11) Google Scholar These proteins are essential for the development of all affected organs in MWS.15Min H Danilenko DM Scully SA Bolon B Ring BD Tarpley JE DeRose M Simonet WS Fgf-10 is required for both limb and lung development and exhibits striking functional similarity to Drosophila branchless.Genes Dev. 1998; 12: 3156-3161Crossref PubMed Scopus (693) Google Scholar, 16Sekine K Ohuchi H Fujiwara M Yamasaki M Yoshizawa T Sato T Yagishita N Matsui D Koga Y Itoh N et al.Fgf10 is essential for limb and lung formation.Nat Genet. 1999; 21: 138-141Crossref PubMed Scopus (939) Google Scholar, 17De Moerlooze L Spencer-Dene B Revest J Hajihosseini M Rosewell I Dickson C An important role for the IIIb isoform of fibroblast growth factor receptor 2 (FGFR2) in mesenchymal-epithelial signalling during mouse organogenesis.Development. 2000; 127: 483-492Crossref PubMed Google Scholar Meanwhile, STRA6 gene mutations were recently implicated in heterogeneous postnatal associations of clinical anophthalmia, pulmonary hypoplasia, diaphragmatic hernia, and cardiac defects.18Pasutto F Sticht H Hammersen G Gillessen-Kaesbach G FitzPatrick DR Nürnberg G Brasch F Schirmer-Zimmermann H Tolmie JL Chitayat D et al.Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation.Am J Hum Genet. 2007; 80: 550-560Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar A molecular analysis of the STRA6 gene was undertaken in the two families with MWS we had described,14Martinovic-Bouriel J Bernabe-Dupont C Golzio C Grattagliano-Bessieres B Malan V Bonniere M Esculpavit C Fallet-Bianco C Mirlesse V Le Bidois J et al.Matthew-Wood syndrome: report of two new cases supporting autosomal recessive inheritance and exclusion of FGF10 and FGFR2.Am J Med Genet A. 2007; 143: 219-228Crossref PubMed Scopus (11) Google Scholar as well as in five other fetuses presenting at least one of the two major signs of clinical anophthalmia or pulmonary hypoplasia and at least one of the two associated signs of diaphragmatic closure defect or cardiopathy. In all seven fetuses examined, the presence of severe malformations was noted on ultrasound examination, and, after genetic counseling, pregnancies were interrupted. Clinical data are summarized in table 1. Chromosome and molecular analyses and pathological examinations were performed in all cases with full parental consent. Genomic DNA was extracted from frozen tissue in fetal cases and from peripheral blood samples for parents in accordance with standard protocols.Table 1Overview of Clinical Features in Cases Undergoing STRA6 Molecular Analysis from Our Series and Pasutto et al.18Pasutto F Sticht H Hammersen G Gillessen-Kaesbach G FitzPatrick DR Nürnberg G Brasch F Schirmer-Zimmermann H Tolmie JL Chitayat D et al.Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation.Am J Hum Genet. 2007; 80: 550-560Abstract Full Text Full Text PDF PubMed Scopus (231) Google ScholarClinical FeaturesaACD = alveolar capillary dysplasia; AO = clinical anophthalmia; ASD = atrial septal defect; bi = bilateral; CC = corpus callosum; CoA = coarctation of aorta; C(L)P = cleft (lip and) palate; DD = developmental delay; eventr = eventration; Fallot = tetralogy of Fallot; hypo = hypoplasia; L = left; MO = microphthalmia; MR = mental retardation; PA = pulmonary artery; PDA = patent ductus arteriosus; PSt = pulmonary valve stenosis; PTB = preterm birth; R = right; RAA = right aortic arch; SS = postnatal short stature; SUA = single umbilical artery; TA = truncus arteriosus; uni = unilateral; VSD = ventricular septal defect; wg = weeks gestation.CaseSTRA6 Mutation(s)EyesLungsDiaphragmCardiovascularFaceOtherGrowthAge at DeathConsanguinityFetus 1bCases given diagnosis of Matthew-Wood syndrome.p.D17A fsX55Bi AOBi agenesisBi eventrBi absence of PA branchesMild dysmorphismDuodenal stenosis, annular pancreasIUGR31 wgYes, recurrenceFetus 2bCases given diagnosis of Matthew-Wood syndrome.p.G176G fsX59Bi AOBi agenesisBi eventrPulmonary trunk and PA absence, VSDMild dysmorphismDuodenal stenosis, absent pancreas, polylobed spleenIUGR28 wgYesFam2-IV:1p.G50A fsX22Bi AO…CDHASD, VSDMild dysmorphismMRSSAlive at 14 yearsYes, recurrenceFam2-IV:3 (sib)p.G50A fsX22Bi AONACDHNAMild dysmorphismNA…23 wg…MWS4-BEp.T644MBi AOHypoCDH……Bi hydronephrosis…Alive at 3 moNo, recurrenceBrother MWS4-BENANAHypo unilobar…Fallot, PDA…Horseshoe kidney, undescended testes…1 d…Sister MWS4-BENABi AOHypo unilobar…PDA, CoA…Uterine dysplasia…1 d…MWS1-EEp.R655CBi AOHypoUni eventr……Hypotonia uni inguinal hernia…3 moYes, recurrenceBrother MWS1-EENABi AO……TA, RAA, PDA, PA atresia……SS22 mo…MWS6-BKp.P90L, p.T321PBi AOHypoCDH, uni eventrPDA…Hypo kidneys, bicornuate uterusPTB (36 wg)1 dYes, recurrence?Fam1-IV:2p.P293LBi AOACD…PSt, PDAMild dysmorphismEctopic kidney, DDPTB (33 wg)6 moYes, recurrenceFam1-IV:4 (cousin)NABi AONA…Single ventricle PA atresiaNA……2 d…CD50396bCases given diagnosis of Matthew-Wood syndrome.…Bi AOHypoUni eventrVSDCP hypo alae nasiHypo bicornuate uterus, hypo spleen…1 dNoFetus 3cCases given diagnosis of Fryns syndrome.…Bi AOHypoBi CDHHypo L ventricle and aorta, mitral valve atresia, VSDCPCC agenesis, arhinencephaly, Dandy-Walker…16 wgNoFetus 4…Uni AO……Single ventricle tricuspid valve atresia, ASD…Arhinencephaly…22 wgNoMWS3-KH…Bi MO/AO…CDH…………NANoRHP006.070…Bi MO/AO…Bi eventr……MR…NANoPB-E03_053…Bi MO/AO…CDH…BrachycephalyMR, sparse hair, bi inguinal hernia…Alive at 10 yearsNoGM23728…Bi MO, abnormal cornea and irisHypo unilobarHypo, uni eventrHypo PA CoA…Renal dysplasia…NeonatalNoAS20861-FF264…Uni MO…CDH……Ocular cyst, DD…Alive at 13 moNoMWS2-FA…Bi coloboma…CDH……Skin patches, brittle hair…NAYesMWS5-LR…Coloboma…CDH…………NANoFetus 5……HypoUni CDHDextroposed aorta over VSD…SUA…32 wgNoAvdW22260……HypoCDH………PTB (28 wg)1 dNoTwin 2 AvdW22260……HypoCDH…CP…PTB (28 wg)1 d…PM22479dCases with suspected Donnai-Barrow syndrome.………CDH…HypertelorismHypo CC omphalocoele…NeonatalYes, recurrenceBrotherdCases with suspected Donnai-Barrow syndrome. PM22479NA……CDHASDBi CLP, hypertelorismHypo CC…Neonatal…Fetus 6……Bi hypoL agenesis, R eventrHypo L heart…Polysplenia renal dysplasia, SUAIUGR30 wgNoFetus 7……Bi agenesis…L atrial isomerism, R ventricular anomaly…Polysplenia renal agenesis…24 wgNoNote.—NA = not available. Fetuses 1–7 from our series are highlighted in bold.a ACD = alveolar capillary dysplasia; AO = clinical anophthalmia; ASD = atrial septal defect; bi = bilateral; CC = corpus callosum; CoA = coarctation of aorta; C(L)P = cleft (lip and) palate; DD = developmental delay; eventr = eventration; Fallot = tetralogy of Fallot; hypo = hypoplasia; L = left; MO = microphthalmia; MR = mental retardation; PA = pulmonary artery; PDA = patent ductus arteriosus; PSt = pulmonary valve stenosis; PTB = preterm birth; R = right; RAA = right aortic arch; SS = postnatal short stature; SUA = single umbilical artery; TA = truncus arteriosus; uni = unilateral; VSD = ventricular septal defect; wg = weeks gestation.b Cases given diagnosis of Matthew-Wood syndrome.c Cases given diagnosis of Fryns syndrome.d Cases with suspected Donnai-Barrow syndrome. Open table in a new tab Note.— NA = not available. Fetuses 1–7 from our series are highlighted in bold. Polymorphic markers D15S188, D15S160, D15S991, and D15S114, flanking the STRA6 gene, were chosen using the UCSC Genome Browser and were examined in fetal cases 1 and 2 (fig. 1). The parents of case 1 are a consanguineous couple of Romanian origin, and the parents of case 2 are a consanguineous couple of Portuguese origin.14Martinovic-Bouriel J Bernabe-Dupont C Golzio C Grattagliano-Bessieres B Malan V Bonniere M Esculpavit C Fallet-Bianco C Mirlesse V Le Bidois J et al.Matthew-Wood syndrome: report of two new cases supporting autosomal recessive inheritance and exclusion of FGF10 and FGFR2.Am J Med Genet A. 2007; 143: 219-228Crossref PubMed Scopus (11) Google Scholar Homozygous haplotypes were demonstrated in each fetus, although the clinically unaffected parents of case 1 had a heterozygous haplotype with an allele presumably inherited from a common ancestor (DNA was unavailable from the other family members of case 2). Primers were subsequently designed to cover the 20 exons and exon-intron junctions of the STRA6 gene (UCSC Genome Browser reference sequence NM_022369), including exons 1A and 1B (the first noncoding exon may be alternatively spliced), with the use of Primer3 software19Rozen S Skaletsky H Primer3 on the WWW for general users and for biologist programmers.Methods Mol Biol. 2000; 132: 365-386Crossref PubMed Google Scholar (table 2). PCRs were treated with the ExoSAP enzyme mix as per the manufacturer's instructions (GE-Amersham). Sequencing was performed for all seven fetal DNA samples with the use of Big Dye v3.1 Terminator Cycle Sequencing Reactions on an ABI 3130 (Applied Biosystems). Both the sense and antisense strands of the PCR-amplified fragments were analyzed with Sequence Analysis software (Applied Biosystems).Table 2STRA6 Oligonucleotides Used for SequencingOligonucleotide Sequences (5′→3′)Exon(s)ForwardReverse1aGGGGTGGGTTCCTCTGATCACCCCAGGTCTCCAAACT1bGCTGAAGGCAGGTATGTGTGCCTCTCGTGTCCCCTCCT2AAGCCTCTTTTCACATCTGTAGTGCAGTTGCAACCTCTGCCATC3TGGGTAAAGCCTCAGTGTGAGTTGGACTTGCATCCTGGTT4CAAGCCCTCAAACTCAGACCTGGGGGTCCTGACTAAACCT5CCACCTCCTTGATTTATGGAAGCATCGTTGTAAAGACTGGATG6 and 7ACCTTCTCATTTTGCCCTTGCTCAAAGGAGGCACTGTGGT8GCAACGGATTCTGGTTCTTGGGAGTAGGGCTGTCTTGGG9 and 10ACGAATGGGTCGAGGCAGTCTGTGCAAGGGAGGGTAAC11CTTGGGAGGGAGGAGGGGGTTGAGGGCAGGGCTC12CCAGCGTCTCCCCTGTTAGCATAGACCTTGGGTCTCCCC13TGGCAGGGGTTCTGAGGCACAGGACTCCCACTCCTTC14TGGCCCAGAGGAGGATTTAGCCAACTGAGGCCAGTGTCTG15 and 16AAAGCCCTTGGTTCTGGGACACCGAAGAAGAGGCGAG17AGGTCTGACACTGACCCTGGGATGCCTTCCTCACTGCTTG18TGGATGCCTCCAGTGTGGAGGGGCACACATCCTTCC19GATCAGGTCTGAGGGCCAGGAGGAGGATGGTAGGCAGGNote.—The annealing temperature for PCR was 60°C for all primers. For QMPSF, fluorescent primers corresponding to STRA6 exon 13 were used, and MLH1 was chosen as a reference (GTAGTCTGTGATCTCCGTTT, 5′; ATGTATGAGGTCCTGTCCT, 3′). Coamplification was performed for 21 cycles, and the peaks were integrated and proportional DNA copy numbers were estimated with the use of Genotyper 3.7 software (Applied Biosystems). Open table in a new tab Note.— The annealing temperature for PCR was 60°C for all primers. For QMPSF, fluorescent primers corresponding to STRA6 exon 13 were used, and MLH1 was chosen as a reference (GTAGTCTGTGATCTCCGTTT, 5′; ATGTATGAGGTCCTGTCCT, 3′). Coamplification was performed for 21 cycles, and the peaks were integrated and proportional DNA copy numbers were estimated with the use of Genotyper 3.7 software (Applied Biosystems). Cases 1 and 2 both presented homozygous mutations in the coding sequence of STRA6 (fig. 1). A homozygous insertion/deletion in exon 2 (c.50_52delACTinsCC) for fetus 1 causes a frameshift and the appearance of a premature stop codon (p.Asp17Ala fsX55). An older brother with isolated bilateral coloboma of the retina and iris was heterozygous for this mutation, as were the clinically unaffected parents. Case 2 presented a homozygous single-base insertion in exon 7 (c.527_528insG) that also predicts a premature stop codon (p.Gly176Gly fsX59). Case 4 had six intronic variations and one conservative amino acid substitution (table 3), all of which were homozygous and documented SNPs in the general population (dbSNP). Parental samples for fetus 4 were not available for analysis. Since the fetus was not known to come from a consanguineous background and had a normal karyotype, the hypothesis of a small, heterozygous deletion was considered. Quantitative multiplex PCR of small fluorescent fragments (QMPSF)20Saugier-Veber P Goldenberg A Drouin-Garraud V de La Rochebrochard C Layet V Drouot N Le Meur N Gilbert-Du-Ssardier B Joly-Helas G Moirot H et al.Simple detection of genomic microdeletions and microduplications using QMPSF in patients with idiopathic mental retardation.Eur J Hum Genet. 2006; 14: 1009-1017Crossref PubMed Scopus (34) Google Scholar was undertaken to measure the number of genomic STRA6 copies for case 4. The results indicated that this fetus did not present a deletion of the STRA6 gene that would explain the observed homozygosity of the SNPs (data not shown).Table 3Sequence Variations in STRA6Fetal Case and Nucleotide Change versus NM_022369Predicted Effect on ORFdbSNP Reference NumberStatus1: c.50_52delACTinsCCp.Asp17Ala fsX55…Homozygous2: c.527_528insGp.Gly176Gly fsX59…Homozygous4: c.331C→Tp.Leu111Leurs11857410Homozygous c.406+97A→G…rs34147822Homozygous c.406+111A→G…rs35255788Homozygous c.430+24T→A…rs971756Homozygous c.431−37C→T…rs971757Homozygous c.1685−24T→C…rs12913041Homozygous c.1840+50T→C…rs12912578Homozygous5: c.596+9T→G…rs28541560Heterozygous c.1301−43A→Cp.Ser472Serrs351240Heterozygous c.1416G→A…rs351241Heterozygous6: c.1166+32G→A……Heterozygous7: c.1167−10C→G…rs2277608HeterozygousNote.—Case 3 had no sequence variations. Open table in a new tab Note.— Case 3 had no sequence variations. A single heterozygous variation located in intron 13 (c.1407+32G→A) that was observed in case 5 has not been identified to date in dbSNP (table 3). We screened 260 control chromosomes without observing the c.1407+32G→A variation. The only tissue available from fetus 5 for expression analysis was a frozen lung sample. STRA6 transcripts were not observed in either total lung RNA extracted from an age-matched fetus affected with an unrelated disorder or from the case 5 tissue sample (data not shown). Therefore, the consequence of this variation on STRA6 transcription remains to be determined. We report homozygous mutations in the STRA6 gene in two fetuses presenting the principal features of MWS, including bilateral severe microphthalmia and pulmonary agenesis. Both also had bilateral diaphragmatic eventration, and one had a cardiac malformation. The observation that both fetuses came from consanguineous families—and, moreover, that one family demonstrated sibling recurrence—had already evoked a recessive model of inheritance for MWS.14Martinovic-Bouriel J Bernabe-Dupont C Golzio C Grattagliano-Bessieres B Malan V Bonniere M Esculpavit C Fallet-Bianco C Mirlesse V Le Bidois J et al.Matthew-Wood syndrome: report of two new cases supporting autosomal recessive inheritance and exclusion of FGF10 and FGFR2.Am J Med Genet A. 2007; 143: 219-228Crossref PubMed Scopus (11) Google Scholar Since the molecular anomaly has been found, it is now possible to affirm that MWS is indeed an autosomal recessive disorder that can be ascribed to mutations in the STRA6 gene. These two fetuses with the STRA6 mutation would not have survived postnatally. In both cases, the mutations would have led to a truncated protein if translated. Homozygous STRA6 mutations have also been observed in peri- and postnatal patients from two other families, as well as in three sporadic cases with a similar phenotypic spectrum.18Pasutto F Sticht H Hammersen G Gillessen-Kaesbach G FitzPatrick DR Nürnberg G Brasch F Schirmer-Zimmermann H Tolmie JL Chitayat D et al.Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation.Am J Hum Genet. 2007; 80: 550-560Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar However, four missense mutations were found to be associated with a severe clinical phenotype, whereas two cases with a truncating mutation had milder clinical signs with no growth retardation nor apparent pulmonary anomalies. Indeed, one of those patients has survived into his teens. Comparison of all reported patients with STRA6 mutations (table 1) thus demonstrates that there is no correlation to date between the nature of a coding mutation and the severity of the phenotype. The recent functional study of 50 random missense mutations introduced into bovine Stra6 has shown that a few of these are sufficient to prevent cell surface expression and that one, although allowing protein insertion into the membrane, abrogates vitamin A entry into the cell.21Kawaguchi R Yu J Honda J Hu J Whitelegge J Ping P Wiita P Bok D Sun H A membrane receptor for retinol binding protein mediates cellular uptake of vitamin A.Science. 2007; 315: 820-825Crossref PubMed Scopus (541) Google Scholar Similar studies will now need to be conducted with documented human mutations to draw conclusions, but it is probable that phenotypic severity is a result of the reduction in perceived retinoic acid (RA) dose within sensitive target tissues, rather than a simple distinction between missense and nonsense mutations. We also undertook molecular analysis of STRA6 in five other fetuses with pulmonary and ocular or cardiac malformations, but no other patent mutations were identified, despite some intriguing variations (table 3). The clinical diversity of patients with STRA6 mutations, and the large phenotypic overlap with those who do not have the mutations, strongly suggests that MWS and related syndromes are not only clinically but genetically heterogeneous. The only necessary diagnostic criterion predicting the involvement of STRA6, on the basis of the patients currently reported here and in the previous study,18Pasutto F Sticht H Hammersen G Gillessen-Kaesbach G FitzPatrick DR Nürnberg G Brasch F Schirmer-Zimmermann H Tolmie JL Chitayat D et al.Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation.Am J Hum Genet. 2007; 80: 550-560Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar is severe microphthalmia (clinical anophthalmia). Microphthalmia with any macroscopically residual presence of the ocular globe does not correlate with STRA6 mutations in either series (table 1). Obviously, since many genes have previously been identified in both isolated and syndromic microphthalmia, this feature is not sufficient to direct molecular testing. The severe eye malformations subsequent to STRA6 mutations are always observed in association with one or more of the three following signs: pulmonary defects, congenital diaphragmatic eventration/hernia, or cardiovascular malformation involving the common aorticopulmonary trunk or pulmonary arteries. Furthermore, according to our two MWS cases and descriptions of MWS in the literature, pancreatic malformations and IUGR may also be secondary diagnostic criteria. Pulmonary defects range from agenesis (this report) to hypoplasia or unilobar lung (among families with MWS mutations) to no obvious lung problems (in either member of family 2 examined by Pasutto et al).18Pasutto F Sticht H Hammersen G Gillessen-Kaesbach G FitzPatrick DR Nürnberg G Brasch F Schirmer-Zimmermann H Tolmie JL Chitayat D et al.Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation.Am J Hum Genet. 2007; 80: 550-560Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar Pulmonary and diaphragmatic malformations (eventration/hernia) are not always associated and occur separately or in combination even among members of the same family.18Pasutto F Sticht H Hammersen G Gillessen-Kaesbach G FitzPatrick DR Nürnberg G Brasch F Schirmer-Zimmermann H Tolmie JL Chitayat D et al.Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation.Am J Hum Genet. 2007; 80: 550-560Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar This observation leads us to conclude that, in the context of STRA6 mutations, the pulmonary phenotype of patients with mutations is a primary malformation and is not a consequence of diaphragmatic hernia. However, the joint presence of clinical anophthalmia and pulmonary and/or diaphragmatic anomalies is still not sufficient to guarantee STRA6 involvement, because other cases with bilateral anophthalmia and hypoplastic lungs (patients with MWS GM23728 and CD50396 from Pasutto et al.18Pasutto F Sticht H Hammersen G Gillessen-Kaesbach G FitzPatrick DR Nürnberg G Brasch F Schirmer-Zimmermann H Tolmie JL Chitayat D et al.Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation.Am J Hum Genet. 2007; 80: 550-560Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar and our case 4) do not present coding-sequence mutations (table 1). Cardiovascular involvement is frequent but inconstant. Case 2 had a ventricular septal defect and pulmonary trunk agenesis, whereas case 1 presented isolated agenesis of the pulmonary arteries. Furthermore, STRA6 mutations described by Pasutto et al. also give rise to conotruncal or great-artery malformations (i.e., truncus arteriosus, tetralogy of Fallot, pulmonary valve or arterial stenosis, and right aortic arch) in at least some family members.18Pasutto F Sticht H Hammersen G Gillessen-Kaesbach G FitzPatrick DR Nürnberg G Brasch F Schirmer-Zimmermann H Tolmie JL Chitayat D et al.Mutations in STRA6 cause a broad spectrum of malformations including anophthalmia, congenital heart defects, diaphragmatic hernia, alveolar capillary dysplasia, lung hypoplasia, and mental retardation.Am J Hum Genet. 2007; 80: 550-560Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar Other affected members with identical mutations had no cardiovascular signs (cf. MWS4-BE). Cases of MWS described elsewhere9Berkenstadt M Lev D Achiron R Rosner M Bark
Referência(s)