Analysis of High-Resolution HapMap of DTNBP1 (Dysbindin) Suggests No Consistency between Reported Common Variant Associations and Schizophrenia
2006; Elsevier BV; Volume: 79; Issue: 5 Linguagem: Inglês
10.1086/508942
ISSN1537-6605
AutoresMousumi Mutsuddi, Derek W. Morris, Skye G. Waggoner, Mark J. Daly, Edward M. Scolnick, Pamela Sklar,
Tópico(s)Genetics and Neurodevelopmental Disorders
ResumoDTNBP1 was first identified as a putative schizophrenia-susceptibility gene in Irish pedigrees, with a report of association to common genetic variation. Several replication studies have reported confirmation of an association to DTNBP1 in independent European samples; however, reported risk alleles and haplotypes appear to differ between studies, and comparison among studies has been confounded because different marker sets were employed by each group. To facilitate evaluation of existing evidence of association and further work, we supplemented the extensive genotype data, available through the International HapMap Project (HapMap), about DTNBP1 by specifically typing all associated single-nucleotide polymorphisms reported in each of the studies of the Centre d'Étude du Polymorphisme Humain (CEPH)–derived HapMap sample (CEU). Using this high-density reference map, we compared the putative disease-associated haplotype from each study and found that the association studies are inconsistent with regard to the identity of the disease-associated haplotype at DTNBP1. Specifically, all five "replication" studies define a positively associated haplotype that is different from the association originally reported. We further demonstrate that, in all six studies, the European-derived populations studied have haplotype patterns and frequencies that are consistent with HapMap CEU samples (and each other). Thus, it is unlikely that population differences are creating the inconsistency of the association studies. Evidence of association is, at present, equivocal and unsatisfactory. The new dense map of the region may be valuable in more-comprehensive follow-up studies. DTNBP1 was first identified as a putative schizophrenia-susceptibility gene in Irish pedigrees, with a report of association to common genetic variation. Several replication studies have reported confirmation of an association to DTNBP1 in independent European samples; however, reported risk alleles and haplotypes appear to differ between studies, and comparison among studies has been confounded because different marker sets were employed by each group. To facilitate evaluation of existing evidence of association and further work, we supplemented the extensive genotype data, available through the International HapMap Project (HapMap), about DTNBP1 by specifically typing all associated single-nucleotide polymorphisms reported in each of the studies of the Centre d'Étude du Polymorphisme Humain (CEPH)–derived HapMap sample (CEU). Using this high-density reference map, we compared the putative disease-associated haplotype from each study and found that the association studies are inconsistent with regard to the identity of the disease-associated haplotype at DTNBP1. Specifically, all five "replication" studies define a positively associated haplotype that is different from the association originally reported. We further demonstrate that, in all six studies, the European-derived populations studied have haplotype patterns and frequencies that are consistent with HapMap CEU samples (and each other). Thus, it is unlikely that population differences are creating the inconsistency of the association studies. Evidence of association is, at present, equivocal and unsatisfactory. The new dense map of the region may be valuable in more-comprehensive follow-up studies. Schizophrenia (SCZ [MIM 181500]) is a common psychiatric disorder, with a lifetime morbidity risk of 0.72%,1Saha S Chant D Welham J McGrath J A systematic review of the prevalence of schizophrenia.PLoS Med. 2005; 2: e141Crossref PubMed Scopus (1161) Google Scholar that presents with psychotic symptoms (delusions and hallucinations), thought disorder, and deficit features described as "negative" symptoms. Although SCZ is highly heritable,2Cardno AG Gottesman, II Twin studies of schizophrenia: from bow-and-arrow concordances to Star Wars Mx and functional genomics.Am J Med Genet. 2000; 97: 12-17Crossref PubMed Scopus (619) Google Scholar the genetic etiology is complex, and identification of replicable susceptibility genes has proved difficult.3Owen MJ Craddock N O'Donovan MC Schizophrenia: genes at last?.Trends Genet. 2005; 21: 518-525Abstract Full Text Full Text PDF PubMed Scopus (260) Google Scholar A number of SCZ-susceptibility genes have now been reported (see the review by Owen et al.3Owen MJ Craddock N O'Donovan MC Schizophrenia: genes at last?.Trends Genet. 2005; 21: 518-525Abstract Full Text Full Text PDF PubMed Scopus (260) Google Scholar). One of the most prominent of these genes is the dystrobrevin binding protein 1 gene (DTNBP1 [MIM 607145]) on 6p22.3, which encodes the dysbindin protein. DTNBP1 was first identified as an SCZ-susceptibility gene in SCZ-affected Irish pedigrees.4Straub RE MacLean CJ Ma Y Webb BT Myakishev MV Harris-Kerr C Wormley B Sadek H Kadambi B O'Neill FA Walsh D Kendler KS Genome-wide scans of three independent sets of 90 Irish multiplex schizophrenia families and follow-up of selected regions in all families provides evidence for multiple susceptibility genes.Mol Psychiatry. 2002; 7: 542-559Crossref PubMed Scopus (121) Google Scholar, 5Straub RE Jiang Y MacLean CJ Ma Y Webb BT Myakishev MV Harris-Kerr C Wormley B Sadek H Kadambi B Cesare AJ Gibberman A Wang X O'Neill FA Walsh D Kendler KS Genetic variation in the 6p22.3 gene DTNBP1, the human ortholog of the mouse dysbindin gene, is associated with schizophrenia.Am J Hum Genet. 2002; 71: 337-348Abstract Full Text Full Text PDF PubMed Scopus (692) Google Scholar These data were later reanalyzed, and the association signal was attributed to a haplotype of low frequency (0.058)—defined as G-G-A-A-T-G-C-G on the minus strand of SNPs rs3213207, rs1011313, rs2619528, rs2005976, rs760761, rs2619522, rs1018381, and rs1474605—at the locus (see table 4 in the work of van den Oord et al.6van den Oord EJ Sullivan PF Jiang Y Walsh D O'Neill FA Kendler KS Riley BP Identification of a high-risk haplotype for the dystrobrevin binding protein 1 (DTNBP1) gene in the Irish study of high-density schizophrenia families.Mol Psychiatry. 2003; 8: 499-510Crossref PubMed Scopus (119) Google Scholar). Schwab and colleagues next reported association at DTNBP1 in sib pairs and parents-proband trios from Germany, Hungary, and Israel.7Schwab SG Knapp M Mondabon S Hallmayer J Borrmann-Hassenbach M Albus M Lerer B Rietschel M Trixler M Maier W Wildenauer DB Support for association of schizophrenia with genetic variation in the 6p22.3 gene, dysbindin, in sib-pair families with linkage and in an additional sample of triad families.Am J Hum Genet. 2003; 72: 185-190Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar In that study, the strongest evidence of association came from the most common haplotype across the "associated" region, as determined by van den Oord et al.6van den Oord EJ Sullivan PF Jiang Y Walsh D O'Neill FA Kendler KS Riley BP Identification of a high-risk haplotype for the dystrobrevin binding protein 1 (DTNBP1) gene in the Irish study of high-density schizophrenia families.Mol Psychiatry. 2003; 8: 499-510Crossref PubMed Scopus (119) Google Scholar Although not formally tested, the low-frequency haplotype that was associated in the study by van den Oord et al.6van den Oord EJ Sullivan PF Jiang Y Walsh D O'Neill FA Kendler KS Riley BP Identification of a high-risk haplotype for the dystrobrevin binding protein 1 (DTNBP1) gene in the Irish study of high-density schizophrenia families.Mol Psychiatry. 2003; 8: 499-510Crossref PubMed Scopus (119) Google Scholar shows evidence of undertransmission in the sample of Schwab et al.7Schwab SG Knapp M Mondabon S Hallmayer J Borrmann-Hassenbach M Albus M Lerer B Rietschel M Trixler M Maier W Wildenauer DB Support for association of schizophrenia with genetic variation in the 6p22.3 gene, dysbindin, in sib-pair families with linkage and in an additional sample of triad families.Am J Hum Genet. 2003; 72: 185-190Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar A series of subsequent studies also purported to replicate association between DTNBP1 and SCZ in family-based8Tang JX Zhou J Fan JB Li XW Shi YY Gu NF Feng GY Xing YL Shi JG He L Family-based association study of DTNBP1 in 6p22.3 and schizophrenia.Mol Psychiatry. 2003; 8: 717-718Crossref PubMed Scopus (122) Google Scholar, 9Kirov G Ivanov D Williams NM Preece A Nikolov I Milev R Koleva S Dimitrova A Toncheva D O'Donovan MC Owen MJ Strong evidence for association between the dystrobrevin binding protein 1 gene (DTNBP1) and schizophrenia in 488 parent-offspring trios from Bulgaria.Biol Psychiatry. 2004; 55: 971-975Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar and population-based samples.10Van Den Bogaert A Schumacher J Schulze TG Otte AC Ohlraun S Kovalenko S Becker T Freudenberg J Jönsson EG Mattila-Evenden M Sedvall GC Czerski PM Kapelski P Hauser J Maier W Rietschel M Propping P Nöthen MM Cichon S The DTNBP1 (dysbindin) gene contributes to schizophrenia, depending on family history of the disease.Am J Hum Genet. 2003; 73: 1438-1443Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar, 11Williams CC Allison JG Vidal GA Burow ME Beckman BS Marrero L Jones FE The ERBB4/HER4 receptor tyrosine kinase regulates gene expression by functioning as a STAT5A nuclear chaperone.J Cell Biol. 2004; 167: 469-478Crossref PubMed Scopus (210) Google Scholar, 12Funke B Finn CT Plocik AM Lake S DeRosse P Kane JM Kucherlapati R Malhotra AK Association of the DTNBP1 locus with schizophrenia in a US population.Am J Hum Genet. 2004; 75: 891-898Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 13Numakawa T Yagasaki Y Ishimoto T Okada T Suzuki T Iwata N Ozaki N Taguchi T Tatsumi M Kamijima K Straub RE Weinberger DR Kunugi H Hashimoto R Evidence of novel neuronal functions of dysbindin, a susceptibility gene for schizophrenia.Hum Mol Genet. 2004; 13: 2699-2708Crossref PubMed Scopus (303) Google Scholar, 14Li T Stefansson H Gudfinnsson E Cai G Liu X Murray RM Steinthorsdottir V Januel D Gudnadottir VG Petursson H Ingason A Gulcher JR Stefansson K Collier DA Identification of a novel neuregulin 1 at-risk haplotype in Han schizophrenia Chinese patients, but no association with the Icelandic/Scottish risk haplotype.Mol Psychiatry. 2004; 9: 698-704PubMed Google Scholar In our "Material and Methods" section, we detail the association findings from these studies. To date, these association studies, either individually or in combination, have not identified the causal variant(s) at DTNBP1 that contribute to SCZ risk. However, there is some evidence to suggest that DTNBP1 expression is altered in the brain of patients with SCZ, although no consistent haplotype has been associated with these changes.15Talbot K Eidem WL Tinsley CL Benson MA Thompson EW Smith RJ Hahn CG Siegel SJ Trojanowski JQ Gur RE Blake DJ Arnold SE Dysbindin-1 is reduced in intrinsic, glutamatergic terminals of the hippocampal formation in schizophrenia.J Clin Invest. 2004; 113: 1353-1363Crossref PubMed Scopus (375) Google Scholar, 16Weickert CS Straub RE McClintock BW Matsumoto M Hashimoto R Hyde TM Herman MM Weinberger DR Kleinman JE Human dysbindin (DTNBP1) gene expression in normal brain and in schizophrenic prefrontal cortex and midbrain.Arch Gen Psychiatry. 2004; 61: 544-555Crossref PubMed Scopus (299) Google Scholar A major difficulty in interpretation of the results from DTNBP1-association studies is that the same SNPs have not been genotyped in all studies, which precludes direct comparison of risk alleles and haplotypes. Furthermore, where positive findings have been reported using the same SNP, there are instances in which the associated allele differs among samples. This has been attributed to potential differences in the genetic architecture of the sampled populations. Here, we sought to address these problems by using data generated as part of the International HapMap Project (HapMap).17The International HapMap Consortium The International HapMap Project.Nature. 2003; 426: 789-796Crossref PubMed Scopus (4665) Google Scholar To make studies directly comparable, we genotyped all SNPs from the DTNBP1-association studies in the CEPH-derived trios employed by HapMap, and we made a composite haplotype map for this locus, to evaluate the similarity of SNP and haplotype frequencies in the populations that were sampled in the DTNBP1 studies. We have considered only data from studies of samples ascertained from populations of European ancestry. This allows appraisal of the degree of similarity of local linkage-disequilibrium (LD) structure at DTNBP1 among the different European samples and determination of whether this is a contributing factor to the differences observed in reported associations. SNPs were selected from three sources: previous association studies of DTNBP1, dbSNP, and phase II of HapMap. We identified all SNPs reported in six association studies of DTNBP1 and SCZ that used samples of European-derived ancestry (n=31 SNPs).5Straub RE Jiang Y MacLean CJ Ma Y Webb BT Myakishev MV Harris-Kerr C Wormley B Sadek H Kadambi B Cesare AJ Gibberman A Wang X O'Neill FA Walsh D Kendler KS Genetic variation in the 6p22.3 gene DTNBP1, the human ortholog of the mouse dysbindin gene, is associated with schizophrenia.Am J Hum Genet. 2002; 71: 337-348Abstract Full Text Full Text PDF PubMed Scopus (692) Google Scholar, 6van den Oord EJ Sullivan PF Jiang Y Walsh D O'Neill FA Kendler KS Riley BP Identification of a high-risk haplotype for the dystrobrevin binding protein 1 (DTNBP1) gene in the Irish study of high-density schizophrenia families.Mol Psychiatry. 2003; 8: 499-510Crossref PubMed Scopus (119) Google Scholar, 7Schwab SG Knapp M Mondabon S Hallmayer J Borrmann-Hassenbach M Albus M Lerer B Rietschel M Trixler M Maier W Wildenauer DB Support for association of schizophrenia with genetic variation in the 6p22.3 gene, dysbindin, in sib-pair families with linkage and in an additional sample of triad families.Am J Hum Genet. 2003; 72: 185-190Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar, 9Kirov G Ivanov D Williams NM Preece A Nikolov I Milev R Koleva S Dimitrova A Toncheva D O'Donovan MC Owen MJ Strong evidence for association between the dystrobrevin binding protein 1 gene (DTNBP1) and schizophrenia in 488 parent-offspring trios from Bulgaria.Biol Psychiatry. 2004; 55: 971-975Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar, 10Van Den Bogaert A Schumacher J Schulze TG Otte AC Ohlraun S Kovalenko S Becker T Freudenberg J Jönsson EG Mattila-Evenden M Sedvall GC Czerski PM Kapelski P Hauser J Maier W Rietschel M Propping P Nöthen MM Cichon S The DTNBP1 (dysbindin) gene contributes to schizophrenia, depending on family history of the disease.Am J Hum Genet. 2003; 73: 1438-1443Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar, 12Funke B Finn CT Plocik AM Lake S DeRosse P Kane JM Kucherlapati R Malhotra AK Association of the DTNBP1 locus with schizophrenia in a US population.Am J Hum Genet. 2004; 75: 891-898Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 18Williams NM Preece A Morris DW Spurlock G Bray NJ Stephens M Norton N Williams H Clement M Dwyer S Curran C Wilkinson J Moskvina V Waddington JL Gill M Corvin AP Zammit S Kirov G Owen MJ O'Donovan MC Identification in 2 independent samples of a novel schizophrenia risk haplotype of the dystrobrevin binding protein gene (DTNBP1).Arch Gen Psychiatry. 2004; 61: 336-344Crossref PubMed Scopus (155) Google Scholar Of those SNPs, 26 were genotyped in our lab, 3 SNPs (rs2619539,rs1474605, and rs1997679) had already been genotyped as part of phase I of HapMap, 1 marker (SNP N) was a rare 1-base insertion/deletion not associated with SCZ in the original study,18Williams NM Preece A Morris DW Spurlock G Bray NJ Stephens M Norton N Williams H Clement M Dwyer S Curran C Wilkinson J Moskvina V Waddington JL Gill M Corvin AP Zammit S Kirov G Owen MJ O'Donovan MC Identification in 2 independent samples of a novel schizophrenia risk haplotype of the dystrobrevin binding protein gene (DTNBP1).Arch Gen Psychiatry. 2004; 61: 336-344Crossref PubMed Scopus (155) Google Scholar and 1 SNP (SNP O) was rare and also was not associated with SCZ in the original paper.18Williams NM Preece A Morris DW Spurlock G Bray NJ Stephens M Norton N Williams H Clement M Dwyer S Curran C Wilkinson J Moskvina V Waddington JL Gill M Corvin AP Zammit S Kirov G Owen MJ O'Donovan MC Identification in 2 independent samples of a novel schizophrenia risk haplotype of the dystrobrevin binding protein gene (DTNBP1).Arch Gen Psychiatry. 2004; 61: 336-344Crossref PubMed Scopus (155) Google Scholar Of the associated SNPs that were genotyped in our lab, 12 (rs12524251, rs2005976, rs909706, rs2743852,rs742105, rs16876738, rs13198335, rs13198195, rs2619542,rs2619550, rs2619537, and rs12204704) were not available as part of the HapMap data release 19 (HapMap). Before the availability of phase II of the HapMap data, we selected an additional 63 SNPs from across the DTNBP1 gene and 10 kb upstream and downstream from those included in dbSNP (see CHIP Bioinformatics Tools Web site). Thus, there was a total of 89 SNPs genotyped. These SNPs were genotyped in the CEPH-derived HapMap (CEU) trio samples (n=30 trios) used as part of the HapMap Project (Coriell Institute Cell Repository). Subsequently, all SNPs available from HapMap phase II (HapMap data release 19; phase II of the October 2005 National Center for Biotechnology Information [NCBI] build 34 assembly; dbSNP build 124) across the DTNBP1 gene and 10 kb upstream and downstream were selected. There was a total of 214 SNPs. Of those, 61 were monomorphic, 5 had genotyping call rates 90% of DNA samples attempted for genotyping per SNP were obtained, (2) 1%. SNP primer sequences are listed in table 1.Table 1SNP Amplification and Extension-Primer SequencesAmplification Primer (5′→3′)SNPMarkerForwardReverseIncluded in HapMap Release #191rs1474605AGCGGATAACATAGTGTGGTATGTGAGTCCAGCGGATAACAACCCCTTCCTCTTTGAAGCYes2rs11757499AGCGGATAACGGGTCAAGTTTAGCCCTAACAGCGGATAACGGCTCTGAGTTTCACATATCYes3rs1011313AGCGGATAACATTCACAGGCTACAGAATGGAGCGGATAACGCCAAGTTACTGCACACAAGYes4rs1988856AGCGGATAACCGCCAACTGACTACTACTTCAGCGGATAACCATTTTCTGCATCCTCCTGGYes5rs17470454AGCGGATAACCAGGGCTTTTTCTTCCCTACAGCGGATAACTTGGAACCTGGAGGGTAATCYes6rs1018382AGCGGATAACTGTGATCAGATAAGCTCCAGAGCGGATAACGAACCTTTAGCACGCTGATGYes7rs12213676AGCGGATAACAGATCTAGGCCAAGGTTTCCAGCGGATAACCAGCTTCCACATGCTGTTAGNo8rs12204704AGCGGATAACGCCAGTGAGGTAAGTAGCACAGCGGATAACTCACTGTTTTCATTGCTGGGNo9rs12203173AGCGGATAACAAGCAAGGACTGAGCTGATGAGCGGATAACGTTCTCGATAAATGTTGCCCYes10rs2252470AGCGGATAACACGCACACACACCACAAAACAGCGGATAACGGAGAGCCAGACACTTAAAGYes11rs13217513AGCGGATAACGTAGTAGCCTAAAAGGTGTCAGCGGATAACTGTCCAGGTTCCTTTCTGAGYes12rs2619553AGCGGATAACAGGTGTCAGTTCTTAGAGCCAGCGGATAACGGGTCCTTGGTTATGGATAGNo13rs9296978AGCGGATAACTTGCCATGACTCTTCTTGGGAGCGGATAACCCGCTCAAACTGTAGACAAGYes14rs2743867AGCGGATAACGTTGTTTGCTTAATACCACTCAGCGGATAACGAGACTGCATTTTCTAAACAGYes15rs9370822AGCGGATAACACTCACACAGTGATGATGGGAGCGGATAACCGGTTTTGAAAGGAACTGCCYes16rs2619535AGCGGATAACTAAAACTGTCCTTGCCCACCAGCGGATAACGCCTAGACTTAATCCTAGACYes17rs7760564AGCGGATAACTGAAAGTGCCTCTCAGGAAGAGCGGATAACCTACTTCATCATCCTCTCGGYes18rs2619536AGCGGATAACAGAGAGGAACTATGGAGTGCAGCGGATAACCTCAGTGGCTTTCAATGCAGYes19rs2743854AGCGGATAACAAGGGAGAGACAAGGCAAACAGCGGATAACCCACATATATCCATTGCTGAGYes20rs2743548AGCGGATAACCCACAAAAAGAAATCTTTGAAGCGGATAACGCTCCATATGAATTCAACAGNo21rs909706AGCGGATAACGTCAAGTCAGTTTCCAAGGGAGCGGATAACAGATCAGGGTAACCCTAAACNo22rs9476837AGCGGATAACCTGGAAGCACACAGCATTTGAGCGGATAACAACTTGGATGAACCTGGAGCYes23rs9476844AGCGGATAACCCTTTCCTAAGCCTAATTCCAGCGGATAACATCTAATACGCCACAGTGCCNo24rs2743550AGCGGATAACGCGGTATAGAAAGAGAATGGAGCGGATAACGAGTTTCCATAGTGTTCAGTGYes25rs4715986AGCGGATAACTGTTGGCTACAATATCTTGGAGCGGATAACGTGGGAAGGTAAAGAGCTTGNo26rs2619533AGCGGATAACGAAGATCTTCGTCCTCATTGAGCGGATAACTTCCACCTCCTCTACCTTTGNo27rs2619538AGCGGATAACTCACTGTTTTCATTGCTGGGAGCGGATAACAGTGAGGTAAGTAGCACAAGYes28rs9476860AGCGGATAACAGTAAAACCTGGACTGCAAGAGCGGATAACGTACTAATGAGTAATTTTGAGGYes29rs9464795AGCGGATAACTAACGGCATGGAGAGGCCTGAGCGGATAACAGGCTCTCAGGCTTGAGGACYes30rs734129AGCGGATAACCCAGGAAGAGGAAAGAACAGAGCGGATAACGTGGCTCCTTCAATAAATAAGYes31rs9464807AGCGGATAACGACTCCTTTTCCATCTCCAGAGCGGATAACCCTAATTCAGTTAGTGCTTTGYes32rs9476887AGCGGATAACCCGCCGAGGAAAGTAACGAAGCGGATAACGGGACCTAAGTTACTTTGCGNo33rs9296981AGCGGATAACGGGACTATTCTGTACTGGAGAGCGGATAACGATTACAAACACAAATTATGCYes34rs2056942AGCGGATAACCTCTCTATTAAAGATTAAGAGCAGCGGATAACCACCTGAATTGTAAATATTGYes35rs2743858AGCGGATAACTCCTAAGTATTTTTTGATGCAGCGGATAACCAGTTGTTTCTATATACTACCNo36rs1474588AGCGGATAACAGGGTTGCTGAAGGAAAGACAGCGGATAACAAGGAACAAGGAGGGATGACYes37rs2743852AGCGGATAACTATAAGGAGCCAGACAAGGGAGCGGATAACGTGTTCTTAGAAAATTCCAGGNo38rs3213207AGCGGATAACGTATTAGGGAACTTTTCTTTGAGCGGATAACCTACCACTAACAACCAAAAAGYes39rs3829893AGCGGATAACCTCTACCTCCTCAAAACTCGAGCGGATAACGAGGATTCTGACTTTTGAGGYes40rs742106AGCGGATAACCAAGGAGCAGACTCAAATGGAGCGGATAACCCGGTAACTTTGGTGAGTTGYes41rs1018381AGCGGATAACGTAAATGAAACGTCATGCAGGAGCGGATAACGAGTACTACAATGACTGCTGYes42rs742105AGCGGATAACCTCACTGCACCTTCAACCTCAGCGGATAACGTGCATACCTGTAGTCCAAGNo43rs760761AGCGGATAACGGTCTTTTTAGATATAACATCAGCGGATAACTTGACCAAGTCCATTGTGTCYes44rs12525702AGCGGATAACACCAGGTTTTAGGCACAAAGAGCGGATAACAATCTCTACTGAGTAGAGGGYes45rs1047631AGCGGATAACGTTTACCGTCCTCACACTTTAGCGGATAACGCCAGGTTGTTTTATAGAGGYes46rs2619528AGCGGATAACGGTACAGAGTTTCCATTTTGCAGCGGATAACCATTCTTAAGCTTAGTAGTGCYes47rs885773AGCGGATAACACTGTTGCCTTCAGAACCAGAGCGGATAACATTCAAACAGGCACTAGCCCNo48rs2619522AGCGGATAACGCTCTTATGTCTACCTTTCCAGCGGATAACAATAGCTGGCAGAAGCAGTGYes49rs16876738AGCGGATAACAATTACACCAAACCCTGCCCAGCGGATAACCAGCAAATCTGAGTAAGTCCNo50rs760666AGCGGATAACCCAGTGAGTACTCGTCATTCAGCGGATAACAATAAGTACACTAAGGTGGGYes51rs2619537AGCGGATAACGAAGAACTGTCTGTGTTCCCAGCGGATAACCTGGAACCTCCTTCTCTTTCNo52rs12527496AGCGGATAACAGACTTCCTTTCGTAAAGCCAGCGGATAACCTACCACTAACAACCAAAAAGYes53rs12524251AGCGGATAACCAAAGGAAGTGAGGCTGAAGAGCGGATAACTATCTGCTTAAGCCATCAGCNo54SNP_H-CardiffaSee table 3 of Williams et al.18AGCGGATAACGTTCCCTAATACATTTAGAAAGCGGATAACGCCAGTTTCCTCAAAATTCCNo55rs2005976AGCGGATAACTGTCAGTCTTCAGGGAAACGAGCGGATAACCAAAGTGCTGGGATTATAGGNoa See table 3 of Williams et al.18Williams NM Preece A Morris DW Spurlock G Bray NJ Stephens M Norton N Williams H Clement M Dwyer S Curran C Wilkinson J Moskvina V Waddington JL Gill M Corvin AP Zammit S Kirov G Owen MJ O'Donovan MC Identification in 2 independent samples of a novel schizophrenia risk haplotype of the dystrobrevin binding protein gene (DTNBP1).Arch Gen Psychiatry. 2004; 61: 336-344Crossref PubMed Scopus (155) Google Scholar Open table in a new tab Of the 89 SNPs we genotyped, 36 were not included in the subsequent analyses (minor-allele frequency <1% [n=26]; genotyping call rate <90% [n=5]; Hardy-Weinberg violation [n=4]). One further SNP (rs1988856) was eliminated, since 35% of the genotypes differed from those in HapMap. (None of the 26 SNPs from the literature failed.) Of the remaining 53 SNPs, the average genotyping success rate was 98.9%. There were only two SNPs with genotyping success rates between 90% and 95%. Since a number of these SNPs were genotyped independently by HapMap, we were able to compare genotypes, to estimate a concordance rate of our genotyping with that of HapMap. A total of 3,059 SNP genotypes in 36 SNPs were available for comparison, in which there were 5 discordant genotypes (0.163%). Genotypes from the 53 SNPs were joined with genotypes from phase II of HapMap. When a SNP was genotyped in our lab, it was used in the final analysis, to avoid errors in strandedness. A total of 166 SNPs were used to build the LD map and to determine tagging SNPs (tSNPs) for the entire region, with use of Haploview version 3.3220Barrett JC Fry B Maller J Daly MJ Haploview: analysis and visualization of LD and haplotype maps.Bioinformatics. 2005; 21: 263-265Crossref PubMed Scopus (11415) Google Scholar and the Tagger implementation therein. For this study, we concentrated on association studies of DTNBP1 and SCZ in European-derived samples (table 2). Within each study, we identified the single-marker or multimarker haplotype result that best captured the association signal in each sample. We paid particular attention to determining which SNPs tagged the associated haplotypes reported in the original study; this would later simplify the task of amalgamating independent findings for a common analysis. Across the six studies, only 11 SNPs were required to define all associated alleles or haplotypes (table 3). Associated haplotypes from each of the studies are shown in bold type in table 3, with tSNPs identified by shading. These tSNPs are shown in figure 1. For each of the studies, we identified the strongest evidence of association for the following alleles or haplotypes: Kirov et al.9Kirov G Ivanov D Williams NM Preece A Nikolov I Milev R Koleva S Dimitrova A Toncheva D O'Donovan MC Owen MJ Strong evidence for association between the dystrobrevin binding protein 1 gene (DTNBP1) and schizophrenia in 488 parent-offspring trios from Bulgaria.Biol Psychiatry. 2004; 55: 971-975Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar (study A) found strongest association, in their sample, with allele A of SNP 2 (rs3213207). The associated haplotype reported by Williams et al.18Williams NM Preece A Morris DW Spurlock G Bray NJ Stephens M Norton N Williams H Clement M Dwyer S Curran C Wilkinson J Moskvina V Waddington JL Gill M Corvin AP Zammit S Kirov G Owen MJ O'Donovan MC Identification in 2 independent samples of a novel schizophrenia risk haplotype of the dystrobrevin binding protein gene (DTNBP1).Arch Gen Psychiatry. 2004; 61: 336-344Crossref PubMed Scopus (155) Google Scholar (study B) in their United Kingdom and Ireland sample was later redefined by Bray et al.21Bray NJ Buckland PR Owen MJ O'Donovan MC Cis-acting variation in the expression of a high proportion of genes in human brain.Hum Genet. 2003; 113: 149-153Crossref PubMed Scopus (194) Google Scholar as A-A-T at SNPs 1-2-11. This haplotype can effectively be tagged by allele T at SNP 11 (rs2619538). Schwab et al.7Schwab SG Knapp M Mondabon S Hallmayer J Borrmann-Hassenbach M Albus M Lerer B Rietschel M Trixler M Maier W Wildenauer DB Support for association of schizophrenia with genetic variation in the 6p22.3 gene, dysbindin, in sib-pair families with linkage and in an additional sample of triad families.Am J Hum Genet. 2003; 72: 185-190Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar (study C) reported their strongest finding from the A-G-G-C-T-C haplotype at SNPs 2-3-4-6-7-8. This haplotype can be tagged by the G-C haplotype from SNPs 3–6 (rs1011313–rs760761). The data from the original study by Straub et al.5Straub RE Jiang Y MacLean CJ Ma Y Webb BT Myakishev MV Harris-Kerr C Wormley B Sadek H Kadambi B Cesare AJ Gibberman A Wang X O'Neill FA Walsh D Kendler KS Genetic variation in the 6p22.3 gene DTNBP1, the human ortholog of the mouse dysbindin gene, is associated with schizophrenia.Am J Hum Genet. 2002; 71: 337-348Abstract Full Text Full Text PDF PubMed Scopus (692) Google Scholar (study D) was later reanalyzed by van den Oord et al.,6van den Oord EJ Sullivan PF Jiang Y Walsh D O'Neill FA Kendler KS Riley BP Identification of a high-risk haplotype for the dystrobrevin binding protein 1 (DTNBP1) gene in the Irish study of high-density schizophrenia families.Mol Psychiatry. 2003; 8: 499-510Crossref PubMed Scopus (119) Google Scholar who identified the strongest evidence of association as coming from the G-G-A-A-T-G-C-G haplotype at SNPs 2-3-4-5-6-7-8-9. This haplotype can be tagged by the A-C haplotype from SNPs 5–8 (rs2005976–rs1018381). Van Den Bogaert et al.10Van Den Bogaert A Schumacher J Schulze TG Otte AC Ohlraun S Kovalenko S Becker T Freudenberg J Jönsson EG Mattila-Evenden M Sedvall GC Czerski PM Kapelski P Hauser J Maier W Rietschel M Propping P Nöthen MM Cichon S The DTNBP1 (dysbindin) gene contributes to schizophrenia, depending on family history of the disease.Am J Hum Genet. 2003; 73: 1438-1443Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar (study E) reported their strongest finding with the A-G-A-T-T haplotype from SNPs 2-3-5-6-8. This haplotype can be tagged by allele T at SNP 8 (rs1018381). Funke et al.12Funke B Finn CT Plocik AM Lake S DeRosse P Kane JM Kucherlapati R Malhotra AK Association of the DTNBP1 locus with schizophrenia in a US population.Am J Hum Genet. 2004; 75: 891-898Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar (study F) reported their strongest finding with the G-A-G-T-G-T-G haplotype from SNPs 2-3-4-5-6-7-9. This haplotype can be tagged by allele T at SNP 8 (rs1018381). Haplotype frequencies for table 3 in the CEU were calculated using Haploview.20Barrett JC Fry B Maller J Daly MJ Haploview: analysis and visualization of LD and haplotype maps.Bioinformatics. 2005; 21: 263-265Crossref PubMed Scopus (11415) Google Scholar For these haplotype frequencies, the 9
Referência(s)