Portal de Periódicos da CAPES

Primary Structure, Regioselectivity, and Evolution of the Membrane-bound Fatty Acid Desaturases of Claviceps purpurea

2007; Elsevier BV; Volume: 282; Issue: 28 Linguagem: Inglês

10.1074/jbc.m702196200

1083-351X

Dauenpen Meesapyodsuk, Darwin W. Reed, Patrick S. Covello, Xiao Qiu,

14-3-3 protein interactions

Two cDNAs with sequence similarity to fatty acid desaturase genes were isolated from the phytopathogenic fungus, Claviceps purpurea. The predicted amino acid sequences of the corresponding genes, named CpDes12 and CpDesX, share 87% identity. Phylogenetic analysis indicates that CpDes12 and CpDesX arose by gene duplication of an ancestral Δ12-desaturase gene after the divergence of Nectriaceae and Clavicipitaceae. Functional expression of CpDes12 and CpDesX in yeast (Saccharomyces cerevisiae) indicated that CpDes12 is primarily a "Δ12"-desaturase, whereas CpDesX is a novel desaturase catalyzing "Δ12," "Δ15," and "ω3" types of desaturation with ω3 activity predominating. CpDesX sequentially desaturates both 16:1–9c and 18:1–9c to give 16:3–9c,12c,15c and 18:3–9c,12c,15c, respectively. In addition, it could also act as an ω3-desaturase converting ω6-polyunsaturates 18:3–6c,9c,12c, 20:3–8c,11c,14c, and 20:4–5c,8c,11c,14c to their ω3 counterparts 18:4–6c,9c,12c,15c, 20:4–8c,11c,14c,17c, and 20:5–5c,8c,11c,14c,17c, respectively. By using reciprocal site-directed mutagenesis, we demonstrated that two residues (isoleucine at 152 and alanine at 206) are critical in defining the catalytic specificity of these enzymes and the C-terminal amino acid sequence (residues 302–477) was also found to be important. These data provide insights into the nature of regioselectivity in membrane-bound fatty acid desaturases and the relevant structural determinants. The authors suggest that the regios-electivity of such enzymes may be best understood by considering the relative importance of more than one regioselective preference. In this view, CpDesX is designated as aν + 3(ω3) desaturase, which primarily references an existing double bond (ν + 3 regioselectivity) and secondarily shows preference for ω3 desaturation. Two cDNAs with sequence similarity to fatty acid desaturase genes were isolated from the phytopathogenic fungus, Claviceps purpurea. The predicted amino acid sequences of the corresponding genes, named CpDes12 and CpDesX, share 87% identity. Phylogenetic analysis indicates that CpDes12 and CpDesX arose by gene duplication of an ancestral Δ12-desaturase gene after the divergence of Nectriaceae and Clavicipitaceae. Functional expression of CpDes12 and CpDesX in yeast (Saccharomyces cerevisiae) indicated that CpDes12 is primarily a "Δ12"-desaturase, whereas CpDesX is a novel desaturase catalyzing "Δ12," "Δ15," and "ω3" types of desaturation with ω3 activity predominating. CpDesX sequentially desaturates both 16:1–9c and 18:1–9c to give 16:3–9c,12c,15c and 18:3–9c,12c,15c, respectively. In addition, it could also act as an ω3-desaturase converting ω6-polyunsaturates 18:3–6c,9c,12c, 20:3–8c,11c,14c, and 20:4–5c,8c,11c,14c to their ω3 counterparts 18:4–6c,9c,12c,15c, 20:4–8c,11c,14c,17c, and 20:5–5c,8c,11c,14c,17c, respectively. By using reciprocal site-directed mutagenesis, we demonstrated that two residues (isoleucine at 152 and alanine at 206) are critical in defining the catalytic specificity of these enzymes and the C-terminal amino acid sequence (residues 302–477) was also found to be important. These data provide insights into the nature of regioselectivity in membrane-bound fatty acid desaturases and the relevant structural determinants. The authors suggest that the regios-electivity of such enzymes may be best understood by considering the relative importance of more than one regioselective preference. In this view, CpDesX is designated as aν + 3(ω3) desaturase, which primarily references an existing double bond (ν + 3 regioselectivity) and secondarily shows preference for ω3 desaturation. Membrane-bound fatty acid desaturases are involved in the non-heme di-ironand oxygen-dependent dehydrogenation of fatty acyl chains. The membrane desaturases have a wide range of substrate specificity and regioselectivity (1Shanklin J. Cahoon E.B. Annu. Rev. Plant Physiol Plant Mol. Biol. 1998; 49: 611-641Crossref PubMed Scopus (709) Google Scholar, 2Sperling P. Ternes P. Zank T.K. Heinz E. Prostaglandins Leukot. Essent. Fatty Acids. 2003; 68: 73-95Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar, 3Los D.A. Murata N. Biochim. Biophys. Acta. 1998; 1394: 3-15Crossref PubMed Scopus (422) Google Scholar). These enzymes are typically labeled according to their apparent regioselectivity. For instance, Δx-desaturases introduce a double bond at position x referenced from the carboxyl end; ωy-desaturases introduce a double bond at position y referenced from the methyl end. Less commonly, desaturases are classified as ν + z, indicating the introduction of an additional double bond at carbon z as referenced from a pre-existing double bond (ν) (4Yadav N.S. Wierzbicki A. Aegerter M. Caster C.S. Perez-Grau L. Kinney A.J. Hitz W.D. Booth Jr., J.R. Schweiger B. Stecca K.L. Allen S.M. Blackwell M. Reiter R.S. Carlson T.J. Russell S.H. Feldmann K.A. Pierce J. Browse J. Plant Physiol. 1993; 103: 467-476Crossref PubMed Scopus (225) Google Scholar, 5Hitz W.D. Carlson T.J. Booth Jr., J.R. Kinney A.J. Stecca K.L. Yadav N.S. Plant Physiol. 1994; 105: 635-641Crossref PubMed Scopus (90) Google Scholar). An example of a Δx-desaturase is the Saccharomyces cerevisiae acyl-CoA Δ9-desaturase introducing a Δ9 double bond into palmitoyl and stearoyl thioesters (6Fujimori K. Anamnart S. Nakagawa Y. Sugioka S. Ohta D. Oshima Y. Yamada Y. Harashima S. FEBS Lett. 1997; 413: 226-230Crossref PubMed Scopus (20) Google Scholar). The nematode Caenorhabditis elegans has an ω3-desaturase involved in producing long-chain polyunsaturates (7Meesapyodsuk D. Reed D.W. Savile C.K. Buist P.H. Ambrose S.J. Covello P.S. Biochemistry. 2000; 39: 11948-11954Crossref PubMed Scopus (67) Google Scholar). Although the plant extraplastidial oleate desaturase is often called Δ12-desaturase, strictly speaking it is a ν + 3 enzyme with a preference for introducing double bonds at or near the Δ12 position (8Reed D.W. Schafer U.A. Covello P.S. Plant Physiol. 2000; 122: 715-720Crossref PubMed Scopus (84) Google Scholar). Membrane-bound desaturases are remarkable for their structural similarity and functional diversity. They all contain three conserved histidine motifs, which are believed to be responsible for di-iron binding at the catalytic center, and share similar hydrophobicity profiles that predict a common membrane topology (9Avelange-Macherel M.H. Macherel D. Wada H. Murata N. FEBS Lett. 1995; 361: 111-114Crossref PubMed Scopus (58) Google Scholar, 10Diaz A.R. Mansilla M.C. Vila A.J. de Mendoza D. J. Biol. Chem. 2002; 277: 48099-48106Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). This structural resemblance has provided the basis for the study of structure-function relationships in these enzymes. By using site-directed mutagenesis, Shanklin, Somerville, and colleagues showed that the eight histidine residues in three conserved histidine-rich boxes are essential for the functionality of a rat stearoyl-CoA Δ9-desaturase (11Shanklin J. Whittle E. Fox B.G. Biochemistry. 1994; 33: 12787-12794Crossref PubMed Scopus (638) Google Scholar) and amino acid residues flanking the conserved boxes are critical for the catalytic properties of plant FAD2 desaturases and related enzymes (12Broun P. Shanklin J. Whittle E. Somerville C. Science. 1998; 282: 1315-1317Crossref PubMed Scopus (208) Google Scholar, 13Broadwater J.A. Whittle E. Shanklin J. J. Biol. Chem. 2002; 277: 15613-15620Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). Using domain swapping, Napier and colleagues showed that the regions of first two membrane-spanning helices and C terminus of borage front-end desaturases are important for the substrate specificity and/or regioselectivity (14Libisch B. Michaelson L.V. Lewis M.J. Shewry P.R. Napier J.A. Biochem. Biophys. Res. Commun. 2000; 279: 779-785Crossref PubMed Scopus (41) Google Scholar). Despite the above work, our understanding of the structure, function, and evolution of membrane-bound fatty acid desaturases remains fragmentary. In the course of studying desaturases of the fungus Claviceps purpurea (15Mey G. Oeser B. Lebrun M.H. Tudzynski P. Mol. Plant Microbe Interact. 2002; 15: 303-312Crossref PubMed Scopus (75) Google Scholar), we have uncovered two desaturases with very similar structure but differing function, which help to elucidate some of the structure-function-evolution relationships in this class of enzymes. Organisms and Culture Conditions—C. purpurea kindly provided by Dr. Yu Chen, Dept. of Plant Science, University of Manitoba was grown at 25 °C for 14 days in medium C (16Mantle P.G. Nisbet L.J. J. Gen. Microbiol. 1976; 93: 321-334Crossref PubMed Scopus (71) Google Scholar). The S. cerevisiae strain INVSc1 (MATa his3Δ1 leu2 trp1–289 ura3–52 MATα his3Δ1 leu2 trp1–289 ura3–52, Invitrogen) was used as a heterologous host to study the expression of CpDes12 and CpDesX desaturases. The S. cerevisiae strain MKP-0 (MATa canl-100 ade2-1 lys2-1 ura3–52 leu2–3, 112 his3-Δ200 trpl-Δ901), kindly provided by Prof. Wei Xiao, University of Saskatchewan, Canada, was used as a host strain for a Δ9-desaturase gene (ole1) knock-out. The ole1-Δ::TRP1 disruption was made by cloning the EcoRI and NheI fragments of YDp-W (17Berben G. Dumont J. Gilliquet V. Bolle P.A. Hilger F. Yeast. 1991; 7: 475-477Crossref PubMed Scopus (317) Google Scholar) containing TRP1 marker into the SalI and KpnI sites of OLE1 and then introducing the linear recombinant plasmid into the host. The knock-out mutant was selected on the selective medium. The mutant strain named ole1Δ-MKP-0 was used as a heterologous host to study substrate specificity of CpDesX desaturase. Yeast cells were grown at 28 °C either in complex medium (YPD) or synthetic minimal medium (SD). Cloning of CpDes12 and CpDesX cDNAs from C. purpurea— The reverse transcription-polymerase chain reaction was used to clone CpDes12 and CpDesX. The single-stranded cDNA was synthesized by Superscript III reverse transcriptase (Invitrogen) using total RNA from mycelia of C. purpurea. The cDNA was then used as the template for the PCR reaction with two degenerate oligonucleotide primers, DM34 (forward primer) and DM36 (reverse primer) (see Table 1). These primers were designed based on the conserved amino acid regions of Δ12-desaturases and Δ12-desaturase-like enzymes from other fungal species such as Aspergillus nidulans and Neurospora crassa. The forward primer resides in the first conserved histidine box and reverse primer resides outside the histidine boxes corresponding to the amino acid sequences AHECGH(G/Q) AF (DM34) and WV(N/H) HWLVAITY (DM36), respectively. The PCR reaction was carried out for 35 cycles with a program (95 °C for 30 s, 50 °C for 60 s, and 72 °C for 90 s) and final extension at 72 °C for 10 min using denatured first-strand cDNA from C. purpurea as templates. PCR products with the expected size (∼600 bp) were separated by electrophoresis (1.2% agarose gel) and purified using a QIAquick gel extraction kit (Qiagen). The products were ligated into a pCR4-TOPO vector (Invitrogen) and sequenced.TABLE 1Primers used in this studyPrimer nameSequence (5′ to 3′)DM34GCICAYGARTGYGGICAYSRIGCITTDM36TAIGTDATIGCIACIARCCARTGRTKIACCCADM37CCCAGCCGAACCGGTTGCCGAGGDM38AGCCCAGCCGAAACGGTTGCCAAGATACDM39CACAGTGCTCATCACAAGGCCACCGGACDM40CCACAGTGCGCATCACAAAGGAACTGGAAACDM41TGTCGGGCTTCGAAAATAGGGCTGCGADM42TGTTTGTCATCGAAAATAGGGCTGCGGDM43GGAATCGAAGCTTTTCTTCCAACDM44GGAACCAACGCCGTTGTCGDM45GCGGATCCAGGATGGCTGCTGCTACCTCTGDM46GCGAATTCCTAATTCTTCATCGAAATGGGCDM47GCCTGGAATCGAAGCTACGTATCCDM48GACCGTCTTTAGCTACTTCGAGACAGDM49GCGAATTCAGGATGGCTGCTACCACTTCTGCDM50GCGAATTCCTACTGAGTTCTCATCGAAATGGDM73CTCTCTGACATCGGCCTGGGTCTTDM74AAGACCCAGGCCGATGTCAGAGAGDM75CCGGACTTTGGATTATTGCCCACGADM76TCGTGGGCAATAATCCAAAGTCCGGDM77AGCGCGACATGGCTTTTCTTCCCCGDM78CGGGGAAGAAAAGCCATGTCGCGCTDM87CTGGACTCTGGGTCATTGCCCACGADM88TCGTGGGCAATGACCCAGAGTCCAGDM89AGCGCGACATGGTTTTCCTTCCCCGDM90CGGGGAAGGAAAACCATGTCGCGCT Open table in a new tab To obtain the entire sequences of CpDes12 and CpDesX cDNAs, the 5′ and 3′ regions were amplified separately using the Marathon cDNA amplification kit (BD Biosciences, Clontech) according to the manufacturer's instructions. The primers DM39 and DM40 were used to amplify the 3′ regions of CpDes12 and CpDesX, respectively. For amplification of the 5′ region, primers DM37 and DM41 were used for CpDes12 and DM38 and DM42 were used for CpDesX. The complete sequences, including untranslated and coding regions, were then amplified using specific primers DM43 and DM44 for CpDes12, and DM47 and DM48 for CpDesX, by Pfx50 DNA polymerase (Invitrogen). The resulting PCR products were gelpurified and ligated into a pCR4-TOPO-TA cloning vector to give plasmids pDM11 and pDM12 for CpDes12 and CpDesX, respectively. Phylogenetic Analysis—Selected fungal fatty acid desaturase amino acid sequences were aligned with ClustalW as hosted at the European Bioinformatics Institute (18Chenna R. Sugawara H. Koike T. Lopez R. Gibson T.J. Higgins D.G. Thompson J.D. Nucleic Acids Res. 2003; 31: 3497-3500Crossref PubMed Scopus (3997) Google Scholar) using default parameters, including the Gonnet scoring matrix, a gap penalty of 10, and a gap extension penalty of 0.2. The resulting alignment was used to generate a distance-based unrooted phylogram using the neighbor-joining method performed using PROTDIST and NEIGHBOR in the PHYLIP software suite, version 3.6 (19Felsenstein J. Cladistics. 1989; 5: 164-166Google Scholar) as hosted by the Institute Pasteur, Paris, France. Parameters for PROTDIST included the use of the Dayhoff PAM matrix and George/Hunt/Barker amino acid categories. The tree was visualized using TREEVIEW (20Page R.D. Comput. Appl. Biosci. 1996; 12: 357-358PubMed Google Scholar). The analysis was repeated with bootstrap analysis using 100 iterations and an extended majority rule tree was constructed using CONSENSE. Functional Expression and Site-directed Mutagenesis of the CpDes12 and CpDesX Desaturases—The primers DM45 and DM46 for CpDes12 and DM49 and DM50 for CpDesX, respectively, were used to amplify coding regions using Pfx50 DNA polymerase. Fragments were then ligated into the vector pYES2.1/V5-His-TOPO (Invitrogen) to yield plasmids pDM13 for CpDes12 and pDM14 for CpDesX. The sequence of the inserts was confirmed to be identical to the original cDNA and in the sense orientation relative to the GAL1 promoter. For mutagenesis, oligonucleotide primers were used to introduce nucleotide substitutions into CpDes12 and CpDesX through the use of the overlap extension PCR technique (21Horton R.M. Cai Z.L. Ho S.N. Pease L.R. BioTechniques. 1990; 8: 528-535PubMed Google Scholar). For the first step, two overlapping fragments were synthesized in separate PCR reactions with Pfx50 DNA polymerase using mutagenic primer pairs as shown in Table 1. The pDM13 was used as a template to generate CpDes12 mutants (CpDes12[V152I] and CpDes12[V206A]), and the pDM14 was used to generate CpDesX mutants (CpDesX[I152V] and CpDesX[A206V]). The appropriate gel-purified products were combined and then used as templates for the second step PCR using primers DM45 and DM46 for CpDes12 mutants and DM49 and DM50 for CpDesX mutants for full-length amplification. For chimera construction (CpDes12[AcB]), 175 amino acids at the C terminus domain of CpDes12 were substituted by 176 amino acids of equivalent position of CpDesX. The double mutants CpDes12[V152I,V206A] and CpDesX[I152V,A206V] were generated using constructs CpDes12[V206A] and CpDesX[A206V] as templates, respectively. All variant fragments were gel-purified and ligated into pYES2.1/V5-His-TOPO. The sequences of all mutant constructs were confirmed by sequencing. Yeast Transformation and Growth Conditions—S. cerevisiae strain INVSc1 or ole1Δ/MKP-0 was transformed with each construct using the S. C. EasyComp transformation kit (Invitrogen) with selection on uracil-deficient medium and supplemented with 17:1–10c in the case of ole1Δ-MKP-0. For assessment of desaturase activity, recombinant yeast cells were grown to saturation in 10-ml cultures for 2 days at 28 °C on minimal medium (synthetic dropout) lacking uracil. Yeast cells were then washed and used to inoculate 10 ml of induction medium containing 2% galactose supplemented with or without 0.1 mm substrate fatty acids (Nu-Chek) in the presence of 0.1% Tergitol (Nonidet P-40, Sigma). Cultures were incubated at 20 °C for 2 days. INVSc1 or ole1Δ-MKP-0 yeast containing the empty plasmid vector pYES2.1 was used as a negative control. The conversion efficiency (%) was calculated as (product(s)/(substrate + product(s)) × 100), where the one or more products include those derived from further desaturation. Fatty Acid Analysis—For fatty acid analysis, yeast cells were pelleted by centrifugation, washed once with 1% Tergitol, and washed once with water, and FAMEs 2The abbreviations used are: FAME, fatty acid methyl ester; 16:2–9c,12t, a fatty acid containing 16 carbons with 2 double bonds at position 9 and 12, counted from the C terminus with cis configuration at position 9 and trans configuration at position 12; 18C, fatty acid(s) containing 18 carbons; DMOX, 4,4-dimethyloxazoline; GC, gas chromatography; MS, mass spectrometry. were prepared as previously described (8Reed D.W. Schafer U.A. Covello P.S. Plant Physiol. 2000; 122: 715-720Crossref PubMed Scopus (84) Google Scholar). The FAME samples were analyzed on an Agilent 6890N gas chromatograph equipped with a DB-23 column (30-m × 0.25-mm) with 0.25-μm film thickness (J&W Scientific). The column temperature was maintained at 160 °C for 1 min, then raised to 240 °C at a rate of 4 °C/min. The position of newly introduced double bonds in desaturated products was determined by the analysis of the 4,4-dimethyloxazoline (DMOX) and/or the fatty acyl diethylamide derivatives as described previously (7Meesapyodsuk D. Reed D.W. Savile C.K. Buist P.H. Ambrose S.J. Covello P.S. Biochemistry. 2000; 39: 11948-11954Crossref PubMed Scopus (67) Google Scholar, 22Luthria D.L. Sprecher H. Lipids. 1993; 28: 561-564Crossref PubMed Scopus (54) Google Scholar). GC-MS analysis was accomplished using an Agilent 5973 mass selective detector coupled to an Agilent 6890N gas chromatograph using the same column and conditions described above. The mass selective detector was run under standard electron impact conditions (70 eV), scanning an effective m/z range of 40–700 at 2.26 scans/s. Purification of 16:2–9c,12c from isolated yeast FAMEs was accomplished by high-performance liquid chromatography fractionation using an Agilent 1100 Series high-performance liquid chromatography with the fraction collector connected to 2 × 12.5 cm Whatman Partisphere C18 columns connected in series. A linear solvent elution gradient was used starting at 90% acetonitrile, 10% water with increasing acetone from 0 to 30% in 20 ml. Collected eluate fractions containing pure 16:2–9c,12c (>98% by GC) were pooled and saponified to the free fatty acid (8Reed D.W. Schafer U.A. Covello P.S. Plant Physiol. 2000; 122: 715-720Crossref PubMed Scopus (84) Google Scholar) for use in yeast medium supplementation experiments. Topology Prediction—The topology of C. purpurea desaturases were predicted using the combination software of TOPPRED (23Claros M.G. von H.G. Comput. Appl. Biosci. 1994; 10: 685-686PubMed Google Scholar), TMHMM (24Krogh A. Larsson B. von H.G. Sonnhammer E.L. J. Mol. Biol. 2001; 305: 567-580Crossref PubMed Scopus (8747) Google Scholar), HMMTOP (25Tusnady G.E. Simon I. J. Mol. Biol. 1998; 283: 489-506Crossref PubMed Scopus (942) Google Scholar), and ConPred II (26Arai M. Mitsuke H. Ikeda M. Xia J.X. Kikuchi T. Satake M. Shimizu T. Nucleic Acids Res. 2004; 32: W390-W393Crossref PubMed Scopus (188) Google Scholar). Isolation of Two C. purpurea cDNAs Encoding Δ12 Desaturase-like Enzymes (CpDes12 and CpDesX)—By using degenerate oligonucleotide primers targeted to conserved histidine motifs of known Δ12-desaturases, and total RNA isolated from mycelia of C. purpurea as the template for reverse transcription-PCR, two cDNA fragments of ∼600 bp showing sequence similarity to fungal Δ12-desaturases were amplified. Subsequently, full-length cDNAs corresponding to the genes, given the names CpDesX and CpDes12, were obtained by 5′ and 3′ rapid amplification of cDNA ends. Sequence analysis indicated that CpDesX encodes a polypeptide with 477 amino acids, whereas CpDes12 codes for a protein with one amino acid shorter than the CpDesX polypeptide. CpDesX and CpDes12 share 87% amino acid identity and 86% nucleotide identity. Both CpDes12 and CpDesX possess three histidine motifs, which are believed to be involved in di-iron binding at the active site of membrane-bound fatty acid desaturases (11Shanklin J. Whittle E. Fox B.G. Biochemistry. 1994; 33: 12787-12794Crossref PubMed Scopus (638) Google Scholar). BLAST searches showed that CpDesX and CpDes12 have high amino acid sequence identity to Δ12-desaturases from Fusarium moniliforme (69% for CpDesX and 73% for CpDes12), Aspergillus nidulans (64% for CpDesX and 65% for CpDes12), Neurospora crassa (64% for CpDesX and 68% for CpDes12), and Arabidopsis thaliana (38% for CpDesX and 39% for CpDes12), as well as to recently identified "bifunctional Δ12/Δ15" desaturases from F. moniliforme and Magnaporthe grisea (45–46%). As might be expected from inspection of the above sequence similarities, phylogenetic analysis supports the recent divergence of CpDes12 and CpDesX (Fig. 1). Both sequences cluster together with fungal Δ12-desaturases from F. graminearum, F. moniliforme, M. grisea, N. crassa, and A. nidulans, which form a group that has been classified as subfamily 2 by Damude and coworkers (27Damude H.G. Zhang H. Farrall L. Ripp K.G. Tomb J.F. Hollerbach D. Yadav N.S. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 9446-9451Crossref PubMed Scopus (136) Google Scholar). A separate group includes the fungal bifunctional desaturases from F. graminearum, F. moniliforme, M. grisea, and N. crassa (27Damude H.G. Zhang H. Farrall L. Ripp K.G. Tomb J.F. Hollerbach D. Yadav N.S. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 9446-9451Crossref PubMed Scopus (136) Google Scholar). Thus, both CpDes12 and CpDesX appear to have evolved from an ancestral subfamily 2 type gene (probably a Δ12-desaturase) (27Damude H.G. Zhang H. Farrall L. Ripp K.G. Tomb J.F. Hollerbach D. Yadav N.S. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 9446-9451Crossref PubMed Scopus (136) Google Scholar) after the divergence of the Clavicipitaceae (including Claviceps) and Nectriaceae (including Fusarium). Functional Characterization of CpDes12 in S. cerevisiae—To determine the function of CpDes12 and CpDesX, the coding regions of two cDNAs were cloned into the yeast expression vector pYES2.1 under control of GAL1 promoter, and the recombinant plasmids were then introduced into S. cerevisiae INVSc1. The empty vector (pYES2.1) and the vector containing Arabidopsis AtFAD2 (28Covello P.S. Reed D.W. Plant Physiol. 1996; 111: 223-226Crossref PubMed Scopus (101) Google Scholar) were used as the negative and positive controls, respectively. The analysis of total FAMEs showed that, compared with the yeast negative control (pYES2.1/INVSc1), the yeast strain AtFAD2/INVSc1 expressing Arabidopsis FAD2 produced significant quantities of two additional fatty acids as previously described and identified as 16:2–9c,12c and 18:2–9c,12c (28Covello P.S. Reed D.W. Plant Physiol. 1996; 111: 223-226Crossref PubMed Scopus (101) Google Scholar). The yeast strain CpDes12/INVSc1 expressing CpDes12 also produced two new fatty acids with the same retention time as 16:2–9c,12c and 18:2–9c,12c standards (Fig. 2A, chromatogram 1). Their identities were confirmed by GC/MS analysis of the FAMEs (see supplemental Fig. S1). In addition, CpDes12 could also use 19:1–10c and 18:2–9c,12c as substrates, albeit to a much lesser extent, producing 19:2–10c,13c (see supplemental Fig. S2) and 18:3–9c,12c,15c (see below), respectively. When supplied with 19:1–10c substrate, the yeast strain CpDes12/INVSc1 expressing CpDes12 produced 19:2–10c,13c at a level of 0.4% of total fatty acids. These results indicated CpDes12 is primarily a Δ12-desaturase with ν + 3 regioselectivity. We propose the common name ν + 3 (Δ12) fatty acid desaturase for this enzyme (see "Discussion"). Functional Characterization of CpDesX in S. cerevisiae—The yeast strain CpDesX/INVSc1 expressing CpDesX produced five new peaks compared with the negative control (pYES2.1/ INVSc1) (Fig. 2A, chromatogram 2). The two FAMEs with longer retention times were identified as 18:2–9c,12c and 18:3–9c,12c,15c (Fig. 2A, chromatogram 2) based on their retention times and mass spectra being identical to that of authentic standards. The mass spectra of two FAMEs with lower retention times were consistent with 16:2 isomers (molecular ion m/z = 266), whereas the mass spectrum of a third peak with an intermediate retention time was consistent with 16:3 (molecular ion m/z = 264). The exact position of the double bonds of three novel 16C fatty acids was provided by GC-MS analysis of their DMOX (Fig. 3) and diethylamide derivatives (see supplemental Fig. S3). Fig. 3 (A and B) show the mass spectra of the DMOX derivatives of two 16C dienoic acids. Comparison of the mass spectra of the derivatives indicates that they have identical molecular ion and fragmentation patterns. The diagnostic fragment pairs of DMOX derivatives at m/z 196 and 208, and 236 and 248, with gaps of 12 atomic mass units indicate that both fatty acids are 16C dienes with double bonds at the Δ9 and Δ12 positions. The mass spectra of diethylamide derivatives confirmed the result of DMOX derivatives (see supplemental Fig. S3). One of the 16C dienoic acids was eluted at the same retention time as authentic 16:2–9c,12c standard and was thus identified as 16:2–9c,12c. The earlier eluting 16C diene, as found in a similar study by Cahoon and colleagues (29Cahoon E.B. Kinney A.J. J. Biol. Chem. 2004; 279: 12495-12502Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar), was identified as 16:2–9c,12t. Chemically speaking, the data are also consistent with 16:2–9t,12c and 16:2–9t,12t isomers, but, given the likelihood that the isomer is derived from 16:1–9c (see below), we consider those possible structures improbable. Under the growth conditions used, 16:2–9c,12t isomer was not detected in C. purpurea. Fig. 3C shows the mass spectrum of the DMOX derivative of the 16C trienoic acid. The derivative has a molecular ion at m/z 303 and diagnostic fragments at m/z 182, 196, 208, 222, 236, 248, 274, and 288, identical to the pattern of 16:3–9c,12c,15c, a product of a recently identified "bifunctional" desaturase from Acanthamoeba castellanii (30Sayanova O. Haslam R. Guschina I. Lloyd D. Christie W.W. Harwood J.L. Napier J.A. J. Biol. Chem. 2006; 281: 36533-36541Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). To verify the substrates of CpDesX for the biosynthesis of the 16C and 18C polyunsaturates, a Δ9-desaturase knock-out mutant (ole1Δ) of the yeast strain MKP-0 was generated using the one-step gene disruption approach (31Baudin A. Ozier-Kalogeropoulos O. Denouel A. Lacroute F. Cullin C. Nucleic Acids Res. 1993; 21: 3329-3330Crossref PubMed Scopus (1107) Google Scholar). When CpDesX was expressed in the mutant strain (ole1Δ-MKP-0) in the presence of 16:1–9t, no new fatty acid was detected. On the other hand, supply of 16:1–9c to CpDesX/ole1Δ-MKP-0 yielded two new fatty acids, 16:2–9c,12t and 16:2–9c,12c. Supply of 16:2–9c,12c to the strain produced 16:3–9c,12c,15c (see supplemental Fig. S4). These results provided further evidence that the 16C diene with the lower retention time described above is 16:2–9c,12t and that CpDesX catalyzes desaturation of 16C fatty acids at both Δ12 and Δ15 positions. The Δ12 desaturation of 16:1–9c produced two 16C dienes, 16:2–9c,12c and 16:2–9c,12t. The ratio of the two isomers was ∼2.6:1, with 16:2–9c,12c predominating. In addition, CpDesX also has Δ12- and Δ15-desaturase activities on 18:1–9c for the sequential synthesis of Δ12- and Δ15-polyunsaturates (18:2–9c,12c and 18:3–9c,12c,15c) in yeast. It was noted, however, that the Δ12 activity of CpDesX on 18C monoene was much lower compared with its Δ15 activity on the 18C diene (see Table 2).TABLE 2Effects of the mutagenesis on Δ12 and Δ15 desaturation of 18C fatty acids by CpDes12 and CpDesXEnzymeAccumulationConversionΔ15/Δ12 ratio relative to wild type18:1-9c18:2-9c,12c18:3-9c,12c,15cΔ12Δ15Δ15/Δ12%TFAa%TFA, weight percent of the total fatty acids.%RatioCpDes12 wild type10.4 ± 0.5516.4 ± 0.970.06 ± 0.061.3 ± 0.40.37 ± 0.020.006 ± 0.01.0CpDes12[V152I]10.8 ± 0.1815.6 ± 0.250.40 ± 0.0259.7 ± 0.72.52 ± 0.110.042 ± 0.0027.0CpDes12[V206A]9.5 ± 0.2315.0 ± 0.151.97 ± 0.1364.1 ± 0.911.57 ± 0.590.180 ± 0.00729.9CpDes12[V152I,V206A]11.6 ± 0.9010.8 ± 0.953.15 ± 0.5454.6 ± 4.222.4 ± 1.90.411 ± 0.00268.2CpDes12[AcB]19.1 ± 0.328.3 ± 0.710.12 ± 0.0130.5 ± 1.51.42 ± 0.050.047 ± 0.0027.7CpDesX wild type24.8 ± 0.290.11 ± 0.010.23 ± 0.011.35 ± 0.0667.5 ± 1.850.0 ± 2.11.0CpDesX[I152V]24.5 ± 0.650.84 ± 0.061.46 ± 0.058.54 ± 0.2163.5 ± 1.07.4 ± 0.20.149CpDesX[A206V]27.0 ± 0.820.73 ± 0.020.47 ± 0.024.28 ± 0.0839.3 ± 0.99.2 ± 0.30.184CpDesX[1152V,A206V]23.6 ± 1.61.8 ± 0.230.21 ± 0.027.78 ± 0.5010.7 ± 0.41.4 ± 0.10.028a %TFA, weight percent of the total fatty acids. Open table in a new tab To define the substrate specificity of the CpDesX, a range of possible substrates from 16C to 22C fatty acids were exogenously supplied to CpDesX/ole1Δ-MKP-0 or CpDesX/ INVSc1. Among 14 fatty acids tested, 16:1–9c, 16:2–9c,12c, 18:1–9c, 18:2–9c,12c, 18:3–6c,9c,12c, 20:2–11c,14c, 20:3–8c,11c,14c, and 20:4–5c,8c,11c,14c could be used by CpDesX as substrates, whereas desaturati