Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Role of Interferon Regulatory Factor-1 and Mitogen-activated Protein Kinase Pathways in the Induction of Nitric Oxide Synthase-2 in Retinal Pigmented Epithelial Cells

1999; Elsevier BV; Volume: 274; Issue: 8 Linguagem: Inglês

10.1074/jbc.274.8.4794

ISSN

1083-351X

Autores

Violaine Faure, Christiane Hecquet, Yves Courtois, Olivier Goureau,

Tópico(s)

interferon and immune responses

Resumo

Bovine retinal pigmented epithelial cells express an inducible nitric oxide synthase (NOS-2) after activation with interferon-γ (Ifn-γ) and lipopolysaccharide (LPS). Experiments were performed to investigate the involvement of interferon regulatory factor-1 (IRF-1) on NOS-2 induction and its regulation by NOS-2 inhibitors such as pyrrolidine dithiocarbamate (PDTC), an antioxidant, or protein kinase inhibitors. Analysis by transitory transfections showed that LPS, alone or with Ifn-γ, stimulated activity of the murine NOS-2 promoter fragment linked upstream of luciferase and its suppression by PDTC and by the different protein kinase inhibitors, genistein (tyrosine kinase inhibitor), PD98059 (mitogen-actived protein (MAP) kinase kinase inhibitor), and SB 203580 (p38 MAP inhibitor). Using specific antibodies, we have confirmed that extracellular signal-regulated kinases and p38 MAP kinase were activated by LPS and Ifn-γ in retinal pigmented epithelial cells. Analysis by reverse transcriptase-polymerase chain reaction, Western blot, and electrophoretic mobility shift assay demonstrated that Ifn-γ alone or combined with LPS induced an accumulation of IRF-1 mRNA and protein and IRF-1 DNA binding. Transfections assays with the IRF-1 promoter showed an induction of this promoter with Ifn-γ, potentiated by LPS. The decrease of LPS/Ifn-γ-induced IRF-1 promoter activity, IRF-1 synthesis, and IRF-1 activation, by PDTC, genistein, PD98059, and SB 203580, could explained in part the inhibition of the NOS-2 induction by these compounds. Our results demonstrate that IRF-1 is necessary for NOS-2 induction by LPS and Ifn-γ and that its synthesis requires the involvement of a redox-sensitive step, the activation of tyrosine kinases, and extracellular signal-regulated kinases 1/2 and p38 MAP kinases. Bovine retinal pigmented epithelial cells express an inducible nitric oxide synthase (NOS-2) after activation with interferon-γ (Ifn-γ) and lipopolysaccharide (LPS). Experiments were performed to investigate the involvement of interferon regulatory factor-1 (IRF-1) on NOS-2 induction and its regulation by NOS-2 inhibitors such as pyrrolidine dithiocarbamate (PDTC), an antioxidant, or protein kinase inhibitors. Analysis by transitory transfections showed that LPS, alone or with Ifn-γ, stimulated activity of the murine NOS-2 promoter fragment linked upstream of luciferase and its suppression by PDTC and by the different protein kinase inhibitors, genistein (tyrosine kinase inhibitor), PD98059 (mitogen-actived protein (MAP) kinase kinase inhibitor), and SB 203580 (p38 MAP inhibitor). Using specific antibodies, we have confirmed that extracellular signal-regulated kinases and p38 MAP kinase were activated by LPS and Ifn-γ in retinal pigmented epithelial cells. Analysis by reverse transcriptase-polymerase chain reaction, Western blot, and electrophoretic mobility shift assay demonstrated that Ifn-γ alone or combined with LPS induced an accumulation of IRF-1 mRNA and protein and IRF-1 DNA binding. Transfections assays with the IRF-1 promoter showed an induction of this promoter with Ifn-γ, potentiated by LPS. The decrease of LPS/Ifn-γ-induced IRF-1 promoter activity, IRF-1 synthesis, and IRF-1 activation, by PDTC, genistein, PD98059, and SB 203580, could explained in part the inhibition of the NOS-2 induction by these compounds. Our results demonstrate that IRF-1 is necessary for NOS-2 induction by LPS and Ifn-γ and that its synthesis requires the involvement of a redox-sensitive step, the activation of tyrosine kinases, and extracellular signal-regulated kinases 1/2 and p38 MAP kinases. The enzyme nitric oxide synthase (NOS) 1The abbreviations NOSnitric oxide synthaseNOnitric oxideRPEretinal pigmented epithelialLPSlipopolysaccharideIfn-γinterferon-γNF-κBnuclear factor κBPDTCpyrrolidine dithiocarbamateIRFinterferon regulatory factorERKextracellular signal-regulated kinaseMAPmitogen-activated proteinDMEMDulbecco's modified Eagle's mediumRMGretinal Müller glialEMSAelectrophoretic mobility shift assayPCRpolymerase chain reactionGAPDHglyceraldehyde-3-phosphate dehydrogenase transformsl-arginine into nitric oxide (NO) andl-citrulline in the presence of oxygen, NADPH, tetrahydrobiopterin, flavin mononucleotide, and FAD (1Marletta M.A. Cell. 1994; 78: 927-930Abstract Full Text PDF PubMed Scopus (815) Google Scholar, 2Knowles R.G. Moncada S. Biochem. J. 1994; 298: 249-258Crossref PubMed Scopus (2506) Google Scholar). Three isoforms of NOS have been identified. Two isoforms are expressed continuously: NOS-1 is present essentially in neurons of the central and peripheral nervous system (3Christopherson K.S. Bredt D.S. J. Clin. Invest. 1997; 100: 2424-2429Crossref PubMed Scopus (274) Google Scholar), and NOS-3 is localized originally in the plasma membrane of vascular endothelial cells (4Förstermann U. Closs E.I. Pollock J.S. Nakane M. Schwarz P. Gath I. Kleinert H. Hypertension. 1994; 23: 1121-1131Crossref PubMed Scopus (998) Google Scholar). These enzymes, via an increase of the intracellular calcium concentration, produce small amounts of NO, which are involved in neurotransmission and vasorelaxation (3Christopherson K.S. Bredt D.S. J. Clin. Invest. 1997; 100: 2424-2429Crossref PubMed Scopus (274) Google Scholar, 4Förstermann U. Closs E.I. Pollock J.S. Nakane M. Schwarz P. Gath I. Kleinert H. Hypertension. 1994; 23: 1121-1131Crossref PubMed Scopus (998) Google Scholar). On the other hand, the inducible isoform, NOS-2, whose expression requires protein synthesis, is calcium- and calmodulin-independent and is generally expressed in different cell types only after transcriptional activation by endotoxins or cytokines (5MacMicking J. Xie Q. Nathan C. Annu. Rev. Immunol. 1997; 15: 323-350Crossref PubMed Scopus (3483) Google Scholar, 6Nathan C. J. Clin. Invest. 1997; 100: 2417-2423Crossref PubMed Scopus (838) Google Scholar). NO produced by NOS-2 plays a role in immunological defenses as an antitumoral, antimicrobial, and antiviral agent (5MacMicking J. Xie Q. Nathan C. Annu. Rev. Immunol. 1997; 15: 323-350Crossref PubMed Scopus (3483) Google Scholar, 6Nathan C. J. Clin. Invest. 1997; 100: 2417-2423Crossref PubMed Scopus (838) Google Scholar, 7Fang F.C. J. Clin. Invest. 1997; 99: 2818-2825Crossref PubMed Google Scholar). NO is also considered to be a mediator of autoimmune and inflammatory responses (5MacMicking J. Xie Q. Nathan C. Annu. Rev. Immunol. 1997; 15: 323-350Crossref PubMed Scopus (3483) Google Scholar). nitric oxide synthase nitric oxide retinal pigmented epithelial lipopolysaccharide interferon-γ nuclear factor κB pyrrolidine dithiocarbamate interferon regulatory factor extracellular signal-regulated kinase mitogen-activated protein Dulbecco's modified Eagle's medium retinal Müller glial electrophoretic mobility shift assay polymerase chain reaction glyceraldehyde-3-phosphate dehydrogenase In the retina, Müller glial cells can express NOS-2 after endotoxin and cytokine stimulation (8Goureau O. Hicks D. Courtois Y. de Kozak Y. J. Neurochem. 1994; 63: 310-317Crossref PubMed Scopus (124) Google Scholar). Retinal pigmented epithelial (RPE) cells from bovine (9Goureau O. Lepoivre M. Becquet F. Courtois Y. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4276-4280Crossref PubMed Scopus (151) Google Scholar), human (10Goureau O. Hicks D. Courtois Y. Biochem. Biophys. Res. Commun. 1994; 198: 120-126Crossref PubMed Scopus (77) Google Scholar), and murine (11Sparrow J.R. Nathan C. Vodovotz Y. Exp. Eye Res. 1994; 59: 129-139Crossref PubMed Scopus (38) Google Scholar, 12Liversidge J. Grabowsky P. Ralston S. Benjamin N. Forrester J.V. Immunology. 1994; 83: 404-409PubMed Google Scholar) species also contain the NOS-2 isoform. Indeed, we demonstrated previously that in bovine RPE cells, NOS-2 was induced by combined treatment with lipopolysaccharide (LPS) and interferon-γ (Ifn-γ) but not individually (9Goureau O. Lepoivre M. Becquet F. Courtois Y. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4276-4280Crossref PubMed Scopus (151) Google Scholar). The regulation of NOS-2 induction is dependent on signal transduction activated by endotoxin, cytokines, and growth factors (6Nathan C. J. Clin. Invest. 1997; 100: 2417-2423Crossref PubMed Scopus (838) Google Scholar, 13Goureau O. Becquet F. Courtois Y. Anderson R.E. La Vail M.M. Hollyfield J.G. Degenerative Diseases of the Retina. Plenum Publishing Corp., New York1995: 61-68Crossref Google Scholar). These signals are the result of the activation of serine/threonine or tyrosine kinases (14Darnell J.E. Kerr I.M. Stark G.R. Science. 1994; 264: 1415-1421Crossref PubMed Scopus (5026) Google Scholar, 15Ulevitch R.J. Tobias P.S. Curr. Opin. Immunol. 1994; 6: 125-130Crossref PubMed Scopus (229) Google Scholar). In bovine RPE cells, the accumulation of NOS-2 mRNA and the accompanying NO release induced by LPS and Ifn-γ require tyrosine kinase signaling and oxidative mechanisms (16Faure V. Courtois Y. Goureau O. Am. J. Physiol. 1998; 275: C208-C215Crossref PubMed Google Scholar). We have also demonstrated that the transcription factor nuclear factor-κB (NF-κB) is required in LPS/Ifn-γ-induced NOS-2 mRNA accumulation in bovine RPE cells (16Faure V. Courtois Y. Goureau O. Am. J. Physiol. 1998; 275: C208-C215Crossref PubMed Google Scholar) as in many different cell types such as murine macrophages (17Xie Q. Kashiwabara Y. Nathan C. J. Biol. Chem. 1994; 269: 4705-4708Abstract Full Text PDF PubMed Google Scholar, 18Murphy W.J. Muroi M. Zhang C.X. Suzuki T. Russell S.W. J. Endotoxin Res. 1996; 3: 381-393Crossref Scopus (5) Google Scholar), vascular smooth muscle cells (19Spink J. Cohen J. Evans T.J. J. Biol. Chem. 1995; 270: 29541-29547Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar), or 3T3 fibroblasts (20Kleinert H. Euchenhofer C. Ihrig-Biedert I. Förstermann U. Mol. Pharmacol. 1996; 49: 15-21PubMed Google Scholar). In RPE cells, the antioxidant pyrrolidinedithiocarbamate (PDTC) but not the tyrosine kinase inhibitor genistein reduces the nuclear translocation of NF-κB and the formation of NF-κB·DNA complexes induced by LPS/Ifn-γ (16Faure V. Courtois Y. Goureau O. Am. J. Physiol. 1998; 275: C208-C215Crossref PubMed Google Scholar). Furthermore, the fact that LPS/Ifn-γ-induced NOS-2 mRNA accumulation is sensitive to cycloheximide (16Faure V. Courtois Y. Goureau O. Am. J. Physiol. 1998; 275: C208-C215Crossref PubMed Google Scholar) suggests that transcriptional factors that depend on protein synthesis are required for NOS-2 induction in RPE cells. In this context, different studies have reported the necessity of interferon regulatory factor-1 (IRF-1), transcriptionally induced by Ifn-γ, in NOS-2 gene induction (21Kamijo R. Harada H. Matsuyama T. Bosland M. Gerecitano J. Shapiro D. Le J. Koh S.I. Kimura T. Green S.J. Mak T.W. Taniguchi T. Vilcek J. Science. 1994; 263: 1612-1615Crossref PubMed Scopus (787) Google Scholar, 22Martin E. Nathan C. Xie Q.W. J. Exp. Med. 1994; 180: 977-984Crossref PubMed Scopus (456) Google Scholar). In bovine RPE cells, we have demonstrated that IRF-1 mRNA accumulation can be modulated after Ifn-α and Ifn-γ treatment (23Faure V. Courtois Y. Goureau O. J. Biol. Chem. 1997; 272: 32169-32175Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar), also suggesting a role for this transcription factor in NOS-2 induction in RPE cells. In this study we have attempted to elucidate further the role of IRF-1 in NOS-2 induction in bovine RPE cells. Our results demonstrate that NOS-2 inducers (LPS/Ifn-γ) increase IRF-1 mRNA and protein accumulation and induce the formation of IRF-1·DNA complexes. Analysis of the effects of NOS-2 inhibitors, genistein, PDTC, and inhibitors of extracellular signal-regulated kinase (ERK) and p38 mitogen-activated protein (MAP) kinase pathways reveal that these compounds block LPS/Ifn-γ-induced IRF-1 mRNA accumulation and suppress the LPS/Ifn-γ-stimulated activity of IRF-1. Bovine RPE cells were prepared as reported previously (9Goureau O. Lepoivre M. Becquet F. Courtois Y. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4276-4280Crossref PubMed Scopus (151) Google Scholar) and cultured in DMEM supplemented with 10% fetal calf serum (Life Technologies, Cergy-Pontoise, France), 2.5 μg/ml Fungizone, 50 μg/ml gentamycin, and 2 mm l-glutamine. Cultures were homogeneous and contained only RPE cells, as characterized by immunohistochemistry with anti-cytokeratin monoclonal antibody KL-1 (24Becquet F. Goureau O. Soubrane G. Coscas G. Courtois Y. Hicks D. Exp. Cell Res. 1994; 212: 374-382Crossref PubMed Scopus (32) Google Scholar). Cells at passages 1–5 were used for experiments. Retinal Müller glial (RMG) cells were cultured from eyeballs from mice at postnatal day 10 according to Hicks and Courtois (25Hicks D. Courtois Y. Exp. Eye Res. 1992; 51: 119-129Crossref Scopus (209) Google Scholar). Early subcultures (up to three passages) were used for transfection experiments. LPS fromSalmonella typhimurium, PDTC, and genistein were obtained from Sigma (St. Quentin-Fallavier, France). The specific inhibitor of MAP kinase kinase (PD98059), the upstream kinase that phosphorylates and activates ERK kinases, and the two rabbit polyclonal antibodies against either total p38 MAP kinase or against only the phosphorylated form of p38 MAP kinase were obtained from BioLabs (Ozyme, Montigny-le-Bretonneux, France). The specific inhibitor of p38 MAP kinase (SB 203580) was obtained from Calbiochem (Meudon, France). The rabbit polyclonal antibody against IRF-1 and the two polyclonal antibodies against either total ERK2 or against only the phosphorylated forms of ERKs were obtained from Santa Cruz (TEBU, Le Perray en Yvelines, France). Bovine recombinant Ifn-γ was generously provided by Dr. T. Ramp (Ciba-Geigy, Basel, Switzerland). Mouse recombinant Ifn-γ was obtained from Peprotech (TEBU). Confluent RPE cells in 12-well culture plates (averaging 105 cells/well) were treated with LPS and Ifn-γ in the absence or presence of protein kinase inhibitors or PDTC in fresh DMEM and 10% fetal calf serum. After 72 h of incubation, the nitrite concentration was determined in cell-free culture supernatants using the spectrophotometric method based on the Griess reaction, as described previously (9Goureau O. Lepoivre M. Becquet F. Courtois Y. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4276-4280Crossref PubMed Scopus (151) Google Scholar). Promoters of the murine NOS-2 gene ligated upstream of the luciferase gene (gift of Dr. C. J. Lowenstein, Johns Hopkins University, Baltimore) (26Lowenstein C.J. Alley E.W. Raval P. Snowman A.M. Snyder S.H. Russell S.W. Murphy W.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 9730-9734Crossref PubMed Scopus (1008) Google Scholar) or of the murine IRF-1 gene ligated upstream of the luciferase gene (gift of Dr. R. Pine, Public Health Research Institute, New York) (27Pine R. Nucleic Acids Res. 1997; 25: 4346-4354Crossref PubMed Scopus (142) Google Scholar) were transfected into RPE cells using Lipofectin (Life Technologies) as described (28Renaud F. Desset S. Oliver L. Gimenez-Gallego G. Van Obberghen E. Courtois Y. Laurent M. J. Biol. Chem. 1996; 271: 2801-2811Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). The vector pGL2-basic (lacking a promoter) and the vector Promega pGL2-control (containing the SV40 early promoter and enhancer) served as negative and positive controls, respectively. Briefly, the transfection medium containing 10 μg of plasmid DNA and 60 μl of Lipofectin reagent in 2 ml of serum-free DMEM was incubated for 20 min at room temperature and then diluted with serum-free DMEM to a final volume of 5 ml and added to RPE cells, plated the day before. The transfection process occurred at 37 °C for 5 h, then 5 ml of DMEM containing 20% fetal calf serum was added to the cells. The cells were incubated for 60 h and stimulated during the last 12 h with different combinations of LPS and Ifn-γ. When used, PDTC and protein kinase inhibitors were added 2 h before the stimulation. After rinsing with phosphate-buffered saline, cells were lysed with reporter lysis buffer (Promega, Charbonnières, France), and cell extracts were used for luciferase assays with the Promega kit in a luminometer (EG&G Berthold, Evry, France). To control transfection efficiency, pSVβ-galactosidase plasmid (Promega) was cotransfected with the luciferase reporter constructs in a 1:4 ratio. After stimulation, β-galactosidase activities were measured by colorimetric assay usingo-nitrophenyl-β-d-galactopyranoside substrate in 96-well plate-reading spectrophotometer (Bio-Rad, Ivry/Seine, France). The results showed that the difference in the relative efficiency of transfection between constructs was negligible (data not shown). Whole cell extracts were prepared from cultured bovine RPE cells treated with LPS and Ifn-γ for 12 h for IRF-1 analysis. In some experiments, cells were pretreated for 2 h with PDTC or protein kinase inhibitor before stimulation. Cells were washed three times in cold phosphate-buffered saline and lysed as described previously (23Faure V. Courtois Y. Goureau O. J. Biol. Chem. 1997; 272: 32169-32175Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). EMSAs with double-stranded consensus oligonucleotide IRF-1 (GGAAGCGAAAATGAAATTGACT) were performed as described previously (23Faure V. Courtois Y. Goureau O. J. Biol. Chem. 1997; 272: 32169-32175Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). For MAP kinase analysis, RPE cells were serum starved for 48 h before stimulation. After a 2-h pretreatment with PDTC or protein kinase inhibitors, cells were treated with LPS and Ifn-γ for distinct periods, washed with phosphate-buffered saline, and then scraped into lysis buffer as described (23Faure V. Courtois Y. Goureau O. J. Biol. Chem. 1997; 272: 32169-32175Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). Samples were centrifuged, and after one freeze/thaw cycle, 100 μg of supernatant proteins was subjected to SDS-polyacrylamide gel electrophoresis. Proteins were then transferred to an Immobilon membrane (Millipore, St. Quentin en Yvelines, France) by electroblotting. Western blot analysis using different polyclonal antibodies specific for IRF-1, total p38 MAP kinase, active p38 MAP kinase, ERK2, and active ERK kinases was performed as described previously (23Faure V. Courtois Y. Goureau O. J. Biol. Chem. 1997; 272: 32169-32175Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). RPE cells were pretreated or not with PDTC and protein kinase inhibitors 2 h before stimulation with LPS and Ifn-γ. After different times of incubation, total RNA was extracted from treated cells by cell lysis in guanidinium isothiocyanate followed by phenol acid extraction. 1 μg of RNA was reverse transcribed for 90 min at 42 °C with 200 units of superscript Moloney murine leukemia virus reverse transcriptase (Life Technologies), using random hexamers. 2 μl of cDNA was added to each PCR, and amplification was performed with the oligonucleotide primers specific for mouse IRF-1, and GAPDH as described previously (23Faure V. Courtois Y. Goureau O. J. Biol. Chem. 1997; 272: 32169-32175Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar, 29Goureau O. Bellot J. Thillaye B. Courtois Y. de Kozak Y. J. Immunol. 1995; 154: 6518-6523PubMed Google Scholar). Results were expressed as mean ± S.E. They were analyzed statistically by Mann-Whitney Utest. p values less than 0.05 were considered as significant. Because we have demonstrated previously that the accumulation of NOS-2 mRNA by the combination of LPS and Ifn-γ could be impaired by antioxidants and tyrosine kinase inhibitors (16Faure V. Courtois Y. Goureau O. Am. J. Physiol. 1998; 275: C208-C215Crossref PubMed Google Scholar), we attempted to establish whether these effects were the result of the prevention of NOS-2 gene transcription. For this, we decided to analyze the induction of the promoter of NOS-2 by transitory transfection of the NOS-2 promoter linked to the luciferase gene reporter. Transfected cells were stimulated for 12 h to measure the maximal luciferase activity (Fig. 1 A). When bovine RPE cells were stimulated with LPS (bar 2), it appeared that there was an increase of the luciferase activity; none was observed in unstimulated cells (bar 1) or in cells stimulated with Ifn-γ alone (bar 3). When cells were stimulated with the combination of LPS and Ifn-γ (bar 4), the luciferase activity was similar to that observed with LPS alone. Control experiments revealed that no luciferase activity was detected in LPS/Ifn-γ-stimulated RPE cells transfected with the promoterless pGL2-basic construct, and a large increase of luciferase activity in unstimulated cells transfected with the SV40 early promoter/enhancer pGL2-control (data not shown). Pretreatment with PDTC (bars 5 and 7) or genistein (bars 6 and8) markedly inhibited the increase of luciferase activity caused by LPS alone or LPS/Ifn-γ, demonstrating the role of tyrosine kinases and oxidative mechanisms in the induction of the NOS-2 gene in bovine RPE cells. To understand the apparent failure of the NOS-2 promoter to respond to Ifn-γ, murine RMG cells, expressing NOS-2 after LPS/Ifn-γ stimulation (8Goureau O. Hicks D. Courtois Y. de Kozak Y. J. Neurochem. 1994; 63: 310-317Crossref PubMed Scopus (124) Google Scholar), were transfected with the same construct. Results reported in Fig. 1 B show that Ifn-γ alone had no effect on luciferase activity (bar 3). A greater increase of the luciferase activity by LPS/Ifn-γ stimulation rather than by LPS alone was also seen (bar 4 compared withbar 2), suggesting a difference in the induction of the murine promoter in bovine RPE cells and murine RMG cells. To investigate the type of protein kinase pathway which could be involved in NOS-2 induction in RPE cells, a specific inhibitor of MAP kinase kinase (PD98059), the upstream kinase that phosphorylates and activates ERK kinases, and a specific inhibitor of the p38 MAP kinase (SB 203580), were first tested on NO production caused by LPS and Ifn-γ. As shown in Table I, the stimulated NO release determined from the nitrite level in the culture supernatants was decreased by 56 and 65% in the presence of PD98059 or SB 203580, respectively. Transfection experiments demonstrated that stimulation of the transfected cells with LPS/Ifn-γ after pretreatment with PD98059 reduced luciferase activity by 65% (TableI). Similar treatment with SB 203580 also prevented LPS/Ifn-γ-induced luciferase activity by 87% (Table I). These results suggest that the signaling pathway involved in NOS-2 induction is affected by inhibitors of ERK and p38 MAP kinase pathways.Table IEffect of genistein, PD98059, and SB 203580 on nitrite accumulation and NOS-2 promoter induction by LPS/Ifn-γNitrite accumulationLuciferase activity% of stimulation% of maximalControl2 ± 11LPS + Ifn-γ100100LPS + Ifn-γ + genistein11 ± 3**12 ± 4**LPS + Ifn-γ + PD9805944 ± 5**35 ± 7**LPS + Ifn-γ + SB 20358035 ± 4**13 ± 3**For nitrite determination, measured by Griess reaction as described under "Materials and Methods," cells were incubated with or without 1 μg/ml LPS and 100 units/ml Ifn-γ in combination with 90 μm genistein, 10 μm PD98059, or 25 μm SB 203580 for 72 h. For the luciferase activity, after transitory transfections RPE cells were pretreated for 2 h without or with 90 μm genistein, 10 μmPD98059, or 25 μm SB 203580 and then stimulated with 1 μg/ml LPS and 100 units/ml Ifn-γ in combination with genistein, PD98059, or SB 203580 for 12 h. Values (means ± S.E.) are expressed as a percentage of maximal nitrite accumulation or maximal luciferase activity after LPS and Ifn-γ treatment. ** indicatesp < 0.01, very significantly different from LPS/Ifn-γ. Open table in a new tab For nitrite determination, measured by Griess reaction as described under "Materials and Methods," cells were incubated with or without 1 μg/ml LPS and 100 units/ml Ifn-γ in combination with 90 μm genistein, 10 μm PD98059, or 25 μm SB 203580 for 72 h. For the luciferase activity, after transitory transfections RPE cells were pretreated for 2 h without or with 90 μm genistein, 10 μmPD98059, or 25 μm SB 203580 and then stimulated with 1 μg/ml LPS and 100 units/ml Ifn-γ in combination with genistein, PD98059, or SB 203580 for 12 h. Values (means ± S.E.) are expressed as a percentage of maximal nitrite accumulation or maximal luciferase activity after LPS and Ifn-γ treatment. ** indicatesp < 0.01, very significantly different from LPS/Ifn-γ. Because we have recently described the activation of IRF-1 by inducers of NOS-2 (23Faure V. Courtois Y. Goureau O. J. Biol. Chem. 1997; 272: 32169-32175Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar), we tested the effect of genistein and PDTC on LPS/Ifn-γ-induced IRF-1 activation. EMSA studies (Fig. 2) revealed the presence of one major and two minor DNA-protein complexes in extracts of RPE cells stimulated with Ifn-γ alone (lane 3) or by the coaddition of LPS and Ifn-γ (lane 5). These complexes were absent in control (lane 1) and in LPS-treated cells (lane 2). The formation of these complexes was prevented by the addition of excess unlabeled IRF-1 oligonucleotide (lane 7), demonstrating the specificity of the DNA-protein interaction. The middle darker complex appears to correspond to the probe complexed with IRF-1, whereas the fainter bands might correspond to complexes formed with other members of the IRF family such as IRF-2 (30Harada H. Fujita T. Miyamoto M. Kimura Y. Maruyama M. Furia A. Miyata T. Taniguchi T. Cell. 1989; 58: 729-739Abstract Full Text PDF PubMed Scopus (804) Google Scholar). The amount of the complexes observed after the LPS/Ifn-γ stimulation decreased in the presence of genistein (lane 4) or PDTC (lane 6), indicating that tyrosine kinase inhibitor and antioxidant induced a decrease of IRF-1 binding to its specific DNA target sequence. When cells were stimulated with LPS/Ifn-γ, but not in untreated cells, Western blot analysis revealed a transitory expression of the IRF-1 protein with a maximal signal observed at 24 h (Fig.3 A). Results depicted in Fig.3 B demonstrate that Ifn-γ alone was able to induce IRF-1 expression (lane 2). Furthermore, the addition of genistein (lane 4) or PDTC (lane 5) inhibited the IRF-1 protein accumulation by 53 and 66%, respectively, after 24 h of treatment with LPS/Ifn-γ (lane 3). By reverse transcriptase-PCR analysis (Fig.4 A), we also observed a rapid and transient IRF-1 mRNA accumulation in cells stimulated with Ifn-γ alone or with LPS/Ifn-γ, but not in unstimulated cells (lane 1). The IRF-1 mRNA accumulation was similar with Ifn-γ alone or when combined with LPS; the maximal signal was observed after 3 or 6 h of stimulation (Fig. 4 B). Analysis of the effects of the different inhibitors of NOS-2 induction revealed that IRF-1 mRNA accumulation induced by LPS/Ifn-γ after 3 h of stimulation was decreased by pretreatment with PDTC or genistein (Fig. 5 A). More specific analysis with the two distinct MAP kinase inhibitors (Fig.5 B) demonstrated that pretreatment with PD98059 (lane 3) or SB 203580 (lane 5) at a concentration that inhibited NOS-2 expression prevented the LPS/Ifn-γ-induced IRF-1 mRNA accumulation.Figure 4Kinetics of IRF-1 mRNA accumulation. Panel A, RPE cells were stimulated without (lane 1) or with 100 units/Ifn-γ alone (lanes 2,4, 6, and 8) or combined with 1 μg/ml LPS (lanes 3, 5, 7, and9). RNA was then harvested after 3 h (lanes 2 and 3), 6 h (lanes 4 and5), 12 h (lanes 6 and 7), or 24 h (lanes 8 and 9) of stimulation, and the levels of IRF-1 and GAPDH mRNAs were assessed successively by reverse transcriptase-PCR as described under "Materials and Methods." The experiment shown in panel A represents one of three independent trials that gave similar results. Data inpanel B are presented as the relative amount of IRF-1 normalized to the relative amount of GADPH, and values are the means ± S.E. of three independent experiments. •, Ifn-γ; ○, LPS + Ifn-γ.View Large Image Figure ViewerDownload (PPT)Figure 5Regulation of IRF-1 mRNA accumulation by PDTC, genistein, and specific MAP kinase inhibitors. Panel A, confluent RPE cells were stimulated without (lane 1) or with 100 units/ml Ifn-γ (lane 2), 1 μg/ml LPS and Ifn-γ (lane 3), LPS/Ifn-γ and 10 μm PDTC (lane 4), and LPS/Ifn-γ and 90 μm genistein (lane 5). Panel B, cells were stimulated without (lane 1) or with 1 μg/ml LPS and 100 units/ml Ifn-γ (lanes 2 and 4), LPS/Ifn-γ with 10 μm PD98059 (lane 3), and LPS/Ifn-γ with 25 μm SB 203580 (lane 5). When used, protein kinase inhibitors were added to the cells 2 h before stimulation. After 3 h, total RNA was isolated, and the levels of IRF-1 and GAPDH mRNAs were assessed by reverse transcriptase-PCR analysis as described under "Materials and Methods." Densitometric analysis of the IRF-1 band corrected for GAPDH expression is shown below. The experiment shown represents one of three independent trials that gave similar results.View Large Image Figure ViewerDownload (PPT) To address whether the inhibitory effects of the antioxidants and protein kinase inhibitors on IRF-1 mRNA accumulation were caused by the prevention of IRF-1 gene transcription, we decided to analyze the induction of the promoter of IRF-1 (Fig. 6) by transitory transfection assays with two different constructs of murine reporter gene of the IRF-1 promoter coupled to luciferase (27Pine R. Nucleic Acids Res. 1997; 25: 4346-4354Crossref PubMed Scopus (142) Google Scholar). When bovine RPE cells were not stimulated (bar 1) or stimulated with LPS alone (bar 2), no increase of luciferase activity was detected. Stimulation with Ifn-γ (bar 3) increased luciferase activity and was increased greatly by the coaddition of LPS in the culture medium (bar 4). The addition of genistein (bar 5) or PDTC (bar 6) largely decreased the luciferase activity induced by LPS/Ifn-γ. Furthermore, the LPS/Ifn-γ-induced luciferase activity was reduced in cells previously coincubated with PD98059 (bar 7) or with SB 203580 (bar 8) at concentrations that prevented IRF-1 mRNA accumulation. Taken together, these results demonstrated that PDTC and protein kinase inhibitors prevented the induction of IRF-1 gene and the accompanying IRF-1 expression and activity. To investigate further the association of ERK and p38 MAP kinase activation with NOS-2 induction in RPE cells, serum-starved RPE cells were treated with LPS and Ifn-γ alone or combined. The activation of ERK and p38 MAP kinase was determined by Western blot analysis, using antibodies specific for the activated forms of the two kinases. Fig. 7 A shows that p38 MAP kinase phosphorylation was observed only after LPS treatment (lane 3) but not after Ifn-γ stimulation (lane 2) or in unstimulated cells (lane 1). The coaddition of LPS and Ifn-γ induced maximal accumulation of active phosphorylated p38 MAP kinase (lane 4), which was largely prevented by genistein (lane 5) and by SB 203580 (lane 6). In contrast, stimulation of cells with Ifn-γ (Fig. 7 B,lane 2) or with LPS (lane 3) induced ERK1/2 phosphorylation as noted by the appearance of the characteristic doublet of 42 and 44 kDa, which was absent in unstimulated cells (lane 1). Maximal phosphorylation occurred with the combined stimulation of LPS and Ifn-γ (lane 4). This LPS/Ifn-γ-induced phosphorylation of ERK1/2 was decreased in the presence of genistein (lane 5). Pretreatment with PD98059 (lane 6), the MEK1 inhibitor, resulted in an inhibition of ERK1/2 activation caused by LPS/Ifn-γ. We have demonstrated that induction of NOS-2 activity in RPE cells by LPS/Ifn-γ implicates a transcriptional mechanism dependent upon the Ifn-γ-activated factor, IRF-1, and that transcription of IRF-1 and NOS-2 can be regulated by different MAP kinase pathways and oxidative mechanisms. Transfection analysis with luciferase-reporter constructs containing the promoter of NOS-2 demonstrated that LPS/Ifn-γ mediated transcriptional regulation of NOS-2 gene expression, explaining in part the accumulation of NOS-2 mRNA after LPS and Ifn-γ stimulation (16Faure V. Courtois Y. Goureau O. Am. J. Physiol. 1998; 275: C208-C215Crossref PubMed Google Scholar, 23Faure V. Courtois Y. Goureau O. J. Biol. Chem. 1997; 272: 32169-32175Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). In bovine RPE cells, LPS, but not Ifn-γ alone, increased murine NOS-2 promoter activity, as reported previously in murine macrophages with the same promoter (18Murphy W.J. Muroi M. Zhang C.X. Suzuki T. Russell S.W. J. Endotoxin Res. 1996; 3: 381-393Crossref Scopus (5) Google Scholar, 26Lowenstein C.J. Alley E.W. Raval P. Snowman A.M. Snyder S.H. Russell S.W. Murphy W.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 9730-9734Crossref PubMed Scopus (1008) Google Scholar). However, in contrast to murine macrophages, Ifn-γ did not potentiate LPS-induced promoter induction in bovine RPE cells. It could be the result of a species effect because in transfection experiments of this murine promoter in RMG cells from mice, we observed a potentiation of the induction of the promoter by the addition of Ifn-γ with LPS. The lack of an Ifn-γ effect on the murine-derived constructs in bovine cells suggests the absence of one or more nuclear factors in bovine RPE cells which are required for maximal expression of the murine promoter or the existence of factors in bovine cells which could not recognize the murine promoter. This incapacity of the murine NOS-2 promoter to respond to Ifn-γ in bovine RPE cells is similar to the hyporesponsiveness of the human NOS-2 promoter transfected in murine macrophages to Ifn-γ, alone or combined with other cytokines (31Spitsin S.V. Koprowski H. Michaels F.H. Mol. Med. 1996; 2: 226-235Crossref PubMed Google Scholar, 32Zhang X. Laubach V.E. Alley E.W. Edwards K.A. Sherman P.A. Russell S.W. Murphy W.J. J. Leukocyte Biol. 1996; 59: 575-585Crossref PubMed Scopus (96) Google Scholar). The inhibition of LPS/Ifn-γ-induced NOS-2 promoter activity by genistein and by PDTC, reported previously as inhibitors of NOS-2 mRNA accumulation in RPE cells (16Faure V. Courtois Y. Goureau O. Am. J. Physiol. 1998; 275: C208-C215Crossref PubMed Google Scholar), confirmed the direct involvement of tyrosine kinase and oxidative pathways in the induction of the NOS-2 gene in bovine RPE cells. We have identified some protein kinases involved in the LPS/Ifn-γ-induced NOS-2 pathway by using specific antibodies and specific inhibitors of MAP kinases. We demonstrated that ERK1/2, described previously as a target of growth factors in RPE cells (33Hinton D.R. He S. Graf K. Yang D. Hsueh W.A. Ryan S.J. Law R.E. Exp. Cell Res. 1998; 239: 11-15Crossref PubMed Scopus (68) Google Scholar, 34Guillonneau X. Bryckaert M. Launay-Longo C. Courtois Y. Mascarelli F. J. Biol. Chem. 1998; 273: 22367-22373Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar), was also activated by the inducers of NOS-2 (LPS and Ifn-γ) and that LPS was also able to activate p38 MAP kinase. The inhibition of LPS/Ifn-γ-induced luciferase activity related to the NOS-2 promoter construct and of LPS/Ifn-γ-induced NO production by specific inhibitors of either the ERK1/2 pathway (PD98059) or the p38 MAP kinase pathway (SB 203580) suggested the participation of these two MAP kinase pathways in the induction of NOS-2, as described recently in brain astrocytes and microglial cells (35Bhat N.R. Zhang P. Lee J.C. Hogan E.L. J. Neurosci. 1998; 18: 1633-1641Crossref PubMed Google Scholar). In cardiomyocytes, interleukin-1β/Ifn-γ-induced NOS-2 mRNA synthesis also involved activation of the ERK pathway (36Singh K. Balligand J. Fischer T.A. Smith T.W. Kelly R.A. J. Biol. Chem. 1996; 271: 1111-1117Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar), whereas in DLD-1 cells neither ERK1/2 nor p38 MAP kinase was required for the regulation of NOS-2 mRNA by Ifn-γ/interleukin-1β/tumor necrosis factor-α (37Kleinert H. Euchenhofer C. Fritz G. Ihrig-Biedert I. Förstermann U. Br. J. Pharmacol. 1998; 123: 1716-1722Crossref PubMed Scopus (37) Google Scholar). These differences reflect probably the cell type-, species-, and stimuli-specific regulation of the NOS-2 gene. The sensitivity of LPS/Ifn-γ-induced NOS-2 mRNA accumulation to cycloheximide (16Faure V. Courtois Y. Goureau O. Am. J. Physiol. 1998; 275: C208-C215Crossref PubMed Google Scholar) and the transcriptional activation of IRF-1 after Ifn-γ stimulation (23Faure V. Courtois Y. Goureau O. J. Biol. Chem. 1997; 272: 32169-32175Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar) indicate the importance of this factor in the induction of NOS-2 in RPE cells, as demonstrated previously in other cell types (21Kamijo R. Harada H. Matsuyama T. Bosland M. Gerecitano J. Shapiro D. Le J. Koh S.I. Kimura T. Green S.J. Mak T.W. Taniguchi T. Vilcek J. Science. 1994; 263: 1612-1615Crossref PubMed Scopus (787) Google Scholar, 22Martin E. Nathan C. Xie Q.W. J. Exp. Med. 1994; 180: 977-984Crossref PubMed Scopus (456) Google Scholar, 38Hecker M. Preiss C. Klemm P. Busse R. Br. J. Pharmacol. 1996; 118: 2178-2184Crossref PubMed Scopus (93) Google Scholar, 39Fujimura M. Tominaga T. Kato I. Takasawa S. Kawase M. Taniguchi T. Okamoto H. Yoshimoto T. Brain Res. 1997; 759: 247-250Crossref PubMed Scopus (26) Google Scholar, 40Flodström M. Eizirik D.L. Endocrinology. 1997; 138: 2747-2753Crossref PubMed Scopus (67) Google Scholar). Reverse transcriptase-PCR analysis confirmed that IRF-1 mRNA is synthesized de novo in contrast to IRF-2, its repressor constitutively expressed in RPE cells (23Faure V. Courtois Y. Goureau O. J. Biol. Chem. 1997; 272: 32169-32175Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). Because these two factors are similar but apparently compete for the same cis-acting recognition sequences, leading to opposite effects on gene transcription (30Harada H. Fujita T. Miyamoto M. Kimura Y. Maruyama M. Furia A. Miyata T. Taniguchi T. Cell. 1989; 58: 729-739Abstract Full Text PDF PubMed Scopus (804) Google Scholar), the accumulation of IRF-1 and the decrease of IRF-2 after LPS/Ifn-γ treatment could favor the interaction of IRF-1 with the NOS-2 promoter, resulting in an activation of NOS-2 gene transcription. Furthermore, we demonstrated by Western blot and EMSA that Ifn-γ induced IRF-1 protein accumulation and the formation of DNA·IRF-1 binding sequence complexes. These effects of Ifn-γ are attributable to activation of the IRF-1 gene by Ifn-γ in RPE cells because it was able to increase luciferase activity in transfection experiments with the IRF-1 promoter constructs. Furthermore, LPS, which is required for NOS-2 induction, slightly potentiated Ifn-γ-induced IRF-1 gene transcription and the consecutive IRF-1 activation but had no effect by itself on the induction of IRF-1. This suggests an effect of LPS on the induction of the IRF-1 promoter only when cells are already stimulated with Ifn-γ, as suggested in HepG2 cells transfected with the same plasmids, where tumor necrosis factor-α, ineffective by itself, largely potentiated the Ifn-γ response (27Pine R. Nucleic Acids Res. 1997; 25: 4346-4354Crossref PubMed Scopus (142) Google Scholar). By using the nonspecific tyrosine kinase inhibitor, genistein, we demonstrated that induction of the IRF-1 gene and IRF-1 activation required the action of tyrosine kinases. This phenomenon could be explained by an inhibition of the phosphorylation of one component of the JAK/STAT pathway, a transductory signal already described for the Ifn-γ (14Darnell J.E. Kerr I.M. Stark G.R. Science. 1994; 264: 1415-1421Crossref PubMed Scopus (5026) Google Scholar). As concerns the MAP kinases, our results with specific inhibitors demonstrated that ERK1/2 and p38 MAP kinase are partially involved in IRF-1 induction. However, because MAP kinases are required for IRF-1 induction, they are not sufficient since LPS that activated ERK1/2 and p38 MAP kinase had no effect on IRF-1 promoter activity. An additional tyrosine kinase-dependent step, such as involves JAK kinases, suggested above, could be necessary for IRF-1 induction. Furthermore, we have demonstrated that the antioxidant PDTC, which blocked NOS-2 promoter activation (Fig. 1) and NOS-2 mRNA accumulation (16Faure V. Courtois Y. Goureau O. Am. J. Physiol. 1998; 275: C208-C215Crossref PubMed Google Scholar), is also able to prevent IRF-1 promoter activation, IRF-1 mRNA and protein accumulation, and IRF-1-DNA interactions. The presence of consensus sequences for NF-κB in the IRF-1 promoter (27Pine R. Nucleic Acids Res. 1997; 25: 4346-4354Crossref PubMed Scopus (142) Google Scholar) could be responsible for this redox-sensitive step in IRF-1 gene transcription. An important finding in the present study is that although Ifn-γ alone induced binding of IRF-1, it failed to induce NOS-2 mRNA and nitrite production. However, inhibition of LPS/Ifn-γ-induced IRF-1 activation partially prevented NOS-2 induction, demonstrating that induction of IRF-1 is required to induce NOS-2 in bovine RPE cells. In this context, RPE cells are very similar to other cells types, such as macrophages (21Kamijo R. Harada H. Matsuyama T. Bosland M. Gerecitano J. Shapiro D. Le J. Koh S.I. Kimura T. Green S.J. Mak T.W. Taniguchi T. Vilcek J. Science. 1994; 263: 1612-1615Crossref PubMed Scopus (787) Google Scholar, 22Martin E. Nathan C. Xie Q.W. J. Exp. Med. 1994; 180: 977-984Crossref PubMed Scopus (456) Google Scholar) or islet cells (40Flodström M. Eizirik D.L. Endocrinology. 1997; 138: 2747-2753Crossref PubMed Scopus (67) Google Scholar), where IRF-1 has been reported to be necessary, but not sufficient, for the induction of NOS-2. Our study suggests the existence of different intracellular signaling pathways in NOS-2 induction in RPE cells because tyrosine kinase inhibitors blocked NOS-2 mRNA accumulation, without affecting NF-κB binding (16Faure V. Courtois Y. Goureau O. Am. J. Physiol. 1998; 275: C208-C215Crossref PubMed Google Scholar) but inhibiting the induction of IRF-1. This suggests that for NOS-2 expression, two factors, NF-κB and IRF-1, are necessary but not sufficient alone, and their activation or induction implicates a redox-sensitive process, tyrosine kinases and MAP kinases. We thank Dr. C. J. Lowenstein for the generous gift of NOS-2 promoter construct, Dr. R. Pine for IRF-1 promoter constructs, Dr. D. S. McDevitt for critical reading, and H. Coet for photographic work.

Referência(s)