Portal de Periódicos da CAPES

Separate cis-trans Pathways Post-transcriptionally Regulate Murine CD154 (CD40 Ligand) Expression

2008; Elsevier BV; Volume: 283; Issue: 37 Linguagem: Inglês

10.1074/jbc.m802492200

1083-351X

B. JoNell Hamilton, Xiaowei Wang, Jane Collins, Donald B. Bloch, Alan Bergeron, Brian Henry, Benjamin M. Terry, Moe Zan, Andrew J. Mouland, William F. C. Rigby,

Cell Adhesion Molecules Research

We report a role for CA repeats in the 3′-untranslated region (3′-UTR) in regulating CD154 expression. Human CD154 is encoded by an unstable mRNA; this instability is conferred in cis by a portion of its 3′-UTR that includes a polypyrimidine-rich region and CA dinucleotide repeat. We demonstrate similar instability activity with the murine CD154 3′-UTR. This instability element mapped solely to a conserved 100-base CU-rich region alone, which we call a CU-rich response element. Surprisingly, the CA dinucleotide-rich region also regulated reporter expression but at the level of translation. This activity was associated with poly(A) tail shortening and regulated by heterogeneous nuclear ribonucleoprotein L levels. We conclude that the CD154 3′-UTR contains dual cis-acting elements, one of which defines a novel function for exonic CA dinucleotide repeats. These findings suggest a mechanism for the association of 3′-UTR CA-rich response element polymorphisms with CD154 overexpression and the subsequent risk of autoimmune disease. We report a role for CA repeats in the 3′-untranslated region (3′-UTR) in regulating CD154 expression. Human CD154 is encoded by an unstable mRNA; this instability is conferred in cis by a portion of its 3′-UTR that includes a polypyrimidine-rich region and CA dinucleotide repeat. We demonstrate similar instability activity with the murine CD154 3′-UTR. This instability element mapped solely to a conserved 100-base CU-rich region alone, which we call a CU-rich response element. Surprisingly, the CA dinucleotide-rich region also regulated reporter expression but at the level of translation. This activity was associated with poly(A) tail shortening and regulated by heterogeneous nuclear ribonucleoprotein L levels. We conclude that the CD154 3′-UTR contains dual cis-acting elements, one of which defines a novel function for exonic CA dinucleotide repeats. These findings suggest a mechanism for the association of 3′-UTR CA-rich response element polymorphisms with CD154 overexpression and the subsequent risk of autoimmune disease. Post-transcriptional regulation plays a critical role in immune homeostasis at the level of the intact animal. Mutations that perturb post-transcriptional control of tumor necrosis factor (TNF) 4The abbreviations used are: TNFtumor necrosis factorUTRuntranslated regionAREAU-rich elementntnucleotide(s)PTBpolypyrimidine tract-binding proteinhnRNPheterogeneous nuclear ribonucleoproteinCURECU-rich instability elementRArheumatoid arthritisSLEsystemic lupus erythematosusCARECA-rich instability elementRTreverse transcriptionRHrandom hexamerLM-PATligase-mediated polyadenylation tailPBSphosphate-buffered salineGAPDHglyceraldehyde-3-phosphate dehydrogenase. gene expression through the 3′-UTR AU-rich element (ARE) exhibited severe joint and bowel inflammation due to TNF overexpression (1Kontoyiannis D. Pasparakis M. Pizarro T.T. Cominelli F. Kollias G. Immunity. 1999; 10: 387-398Abstract Full Text Full Text PDF PubMed Scopus (1136) Google Scholar, 2Taylor G.A. Carballo E. Lee D.M. Lai W.S. Thompson M.J. Patel D.D. Schenkman D.I. Gilkeson G.S. Broxmeyer H.E. Haynes B.F. Blackshear P.J. Immunity. 1996; 4: 445-454Abstract Full Text Full Text PDF PubMed Scopus (661) Google Scholar). These studies and others established that the 3′-UTR ARE regulates TNF expression at the level of nuclear export, mRNA stability and translation (1Kontoyiannis D. Pasparakis M. Pizarro T.T. Cominelli F. Kollias G. Immunity. 1999; 10: 387-398Abstract Full Text Full Text PDF PubMed Scopus (1136) Google Scholar, 3Carballo E. Lai W.S. Blackshear P.J. Science. 1998; 281: 100-104Crossref Google Scholar, 4Piecyk M. Wax S. Beck A.R. Kedersha N. Gupta M. Maritim B. Chen S. Gueydan C. Kruys V. Streuli M. Anderson P. EMBO J. 2000; 19: 4154-4163Crossref PubMed Scopus (431) Google Scholar, 5Dumitru C.D. Ceci J. Tsatsanis C. Kontoyiannis D. Stamatakakis K. Lin J.H. Patriotis C.C. Jenkins N.A. Copleland N.G. Kollias G. Tsichlis P.N. Cell. 2000; 103: 1071-1083Abstract Full Text Full Text PDF PubMed Scopus (710) Google Scholar). tumor necrosis factor untranslated region AU-rich element nucleotide(s) polypyrimidine tract-binding protein heterogeneous nuclear ribonucleoprotein CU-rich instability element rheumatoid arthritis systemic lupus erythematosus CA-rich instability element reverse transcription random hexamer ligase-mediated polyadenylation tail phosphate-buffered saline glyceraldehyde-3-phosphate dehydrogenase. CD154 (CD40 ligand) is a member of the TNF gene family; it is transiently expressed by activated T lymphocytes to play a central, nonredundant role in humoral and cellular immunity (6Hollenbaugh D. Ochs H.D. Noelle R.J. Ledbetter J.A. Aruffo A. Immunol. Rev. 1994; 138: 23-37Crossref PubMed Scopus (85) Google Scholar, 7Foy T.M. Aruffo A. Bajorath J. Buhlmann J.E. Noelle R.J. Annu. Rev. Immunol. 1996; 14: 591-617Crossref PubMed Scopus (576) Google Scholar, 8Noelle R.J. Immunity. 1996; 4: 415-419Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar, 9Grewal I.S. Flavell R.A. Annu. Rev. Immunol. 1998; 16: 111-135Crossref PubMed Scopus (1345) Google Scholar). Humans with mutations of the CD154 gene experience a severe immunodeficiency characterized by high levels of IgM and the absence of IgG (6Hollenbaugh D. Ochs H.D. Noelle R.J. Ledbetter J.A. Aruffo A. Immunol. Rev. 1994; 138: 23-37Crossref PubMed Scopus (85) Google Scholar, 8Noelle R.J. Immunity. 1996; 4: 415-419Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar). These studies and others underscore the central role of CD154 interacting with CD40 on B cells in mediating Ig class switching. Like TNF and interleukin-2, CD154 mRNA initially exhibits rapid (t½ 20-30 min) decay in activated human T cells (10Rigby W.F.C. Waugh M.G. Hamilton B.J. J. Immunol. 1999; 163: 4199-4206PubMed Google Scholar, 11Ford G.S. Barnhart B. Shone S. Covey L.R. J. Immunol. 1999; 162: 4037-4044PubMed Google Scholar, 12Suarez A. Mozo L. Gayo A. Zamorano J. Gutierrez C. Eur. J. Immunol. 1997; 27: 2822-2829Crossref PubMed Scopus (36) Google Scholar). After prolonged (>24 h) activation, CD154, but not cytokine, mRNA exhibits increased stability (11Ford G.S. Barnhart B. Shone S. Covey L.R. J. Immunol. 1999; 162: 4037-4044PubMed Google Scholar). A distinct pattern of post-transcriptional regulation is also supported by the ability of LFA-3-CD2 interactions to selectively increase CD154 mRNA stability (13Murakami K. Ma W. Fuleihan R. Pober J.S. J. Immunol. 1999; 163: 2667-2673PubMed Google Scholar). These studies suggested that the post-transcriptional regulation of CD154 involves cis-trans pathways other than ARE-dependent gene expression. This hypothesis was supported by chimeric reporter gene studies that mapped a cis-acting instability element to a ∼330-nucleotide (nt) region in the human CD154 3′-UTR that lacked an ARE (14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar). This region contained a polypyrimidine (CU)-rich region juxtaposed to an extended CA dinucleotide repeat. Changes in CD154 mRNA turnover correlated with the cytoplasmic levels of p55 and p25 proteins that directly contacted cytidines or uridines in this region (10Rigby W.F.C. Waugh M.G. Hamilton B.J. J. Immunol. 1999; 163: 4199-4206PubMed Google Scholar). The p55 protein was purified and sequenced and found to be polypyrimidine tract-binding protein (PTB), also known as hnRNP I (14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar). Overexpression of PTB increased the cytoplasmic stability of reporter mRNA containing the CD154 3′-UTR instability element (14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar). The p25 protein derived from a splice isoform of PTB missing exons 3-10 that resulted in an in frame deletion was referred to as PTB-T (14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar). Overexpression of PTB-T decreased luciferase mRNA stability when this 330-nt instability sequence in the human CD154 3′-UTR was present (14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar). These data indicated that the competition of specific PTB proteins for binding to CU-rich sequences in this region modulated CD154 mRNA decay (14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar). With prolonged T cell activation, cytoplasmic PTB levels increased relative to PTB-T (10Rigby W.F.C. Waugh M.G. Hamilton B.J. J. Immunol. 1999; 163: 4199-4206PubMed Google Scholar, 14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar), consistent with the increased stability of CD154 mRNA seen at later time points (11Ford G.S. Barnhart B. Shone S. Covey L.R. J. Immunol. 1999; 162: 4037-4044PubMed Google Scholar). Studies of the increased CD154 mRNA stability seen in activated (24 h) human T cells as well as the D1.1 mutant of the Jurkat cell line demonstrated that PTB proteins from D1.1 cell cytoplasm interacted at three separate sites within this region (11Ford G.S. Barnhart B. Shone S. Covey L.R. J. Immunol. 1999; 162: 4037-4044PubMed Google Scholar, 15Kosinski P.A. Laughlin J. Singh K. Covey L.R. J. Immunol. 2003; 170: 979-988Crossref PubMed Scopus (46) Google Scholar). Deletions that eliminated PTB binding to the CD154 3′-UTR decreased the stability of CD154 mRNA seen in D1.1 cells. Subsequent work suggested that the interaction of PTB and nucleolin with this region of the CD154 3′-UTR correlated with the increased mRNA stability (16Singh K. Laughlin J. Kosinski P.A. Covey L.R. J. Immunol. 2004; 173: 976-985Crossref PubMed Scopus (50) Google Scholar). Thus, the stabilization of CD154 mRNA that occurs with prolonged T cell activation involves the differential effects of PTB splice isoforms as well as the interaction of PTB with other trans-acting factors. Despite these insights, it was still unclear if the dispersed 3′-UTR CU-rich elements in the human CD154 3′-UTR alone conferred the increased CD154 mRNA turnover seen early in T cell activation as well as with chimeric reporter genes (10Rigby W.F.C. Waugh M.G. Hamilton B.J. J. Immunol. 1999; 163: 4199-4206PubMed Google Scholar, 11Ford G.S. Barnhart B. Shone S. Covey L.R. J. Immunol. 1999; 162: 4037-4044PubMed Google Scholar, 12Suarez A. Mozo L. Gayo A. Zamorano J. Gutierrez C. Eur. J. Immunol. 1997; 27: 2822-2829Crossref PubMed Scopus (36) Google Scholar, 14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar). This is particularly important due to the presence of other 3′-UTR elements (polycytidines, CA repeats) in this region that are associated with post-transcriptional gene regulation (17Waggoner S.A. Liebhaber S.A. Exp. Biol. Med. 2003; 228: 387-395Crossref PubMed Scopus (99) Google Scholar, 18Hui J. Reither G. Bindereif A. RNA. 2003; 9: 931-936Crossref PubMed Scopus (69) Google Scholar, 19Hui J. Stangl K. Lane W.S. Bindereif A. Nat. Struct. Biol. 2003; 10: 33-37Crossref PubMed Scopus (135) Google Scholar, 20Hui J. Hung L.H. Heiner M. Schreiner S. Neumuller N. Reither G. Haas S.A. Bindereif A. EMBO J. 2005; 24: 1988-1998Crossref PubMed Scopus (189) Google Scholar, 21Cheli Y. Kunicki T.J. Blood. 2006; 107: 4391-4398Crossref PubMed Scopus (21) Google Scholar). The conserved murine CD154 3′-UTR has advantages for this analysis, given the condensed (180 nt) nature of the CU- and CA-rich regions (Fig. 1). Using transient transfection of chimeric reporter constructs, we demonstrated that the conserved 100-base CU-rich region in the murine CD154 3′-UTR functions as a cis-acting cytoplasmic instability element. This analysis of the CU-rich instability element (CURE) was confounded by the discovery of a second cis-acting element in the CA-rich region that regulates translation. Immediately 3′ to the CURE is a series of 7, 10, and 17 CA dinucleotide repeats. CA dinucleotide repeats are the most common simple repeat in the mammalian genome (22Mouse Genome Sequencing Consortium Nature. 2002; 420: 520-562Crossref PubMed Scopus (5516) Google Scholar), but their functional role in gene expression has only recently been explored. The polymorphic nature of intronic CA repeats have been shown to regulate splicing efficiency and gene expression (18Hui J. Reither G. Bindereif A. RNA. 2003; 9: 931-936Crossref PubMed Scopus (69) Google Scholar, 19Hui J. Stangl K. Lane W.S. Bindereif A. Nat. Struct. Biol. 2003; 10: 33-37Crossref PubMed Scopus (135) Google Scholar, 20Hui J. Hung L.H. Heiner M. Schreiner S. Neumuller N. Reither G. Haas S.A. Bindereif A. EMBO J. 2005; 24: 1988-1998Crossref PubMed Scopus (189) Google Scholar, 21Cheli Y. Kunicki T.J. Blood. 2006; 107: 4391-4398Crossref PubMed Scopus (21) Google Scholar). In contrast, there is little understanding of the role of the exonic CA repeats, which are less frequent. Our studies demonstrate that 3′-UTR CA-rich repeats regulate gene expression at the level of translation. Recent work indicates that the CA repeats in the CD154 3′-UTR are polymorphic and influence both gene expression and autoimmune disease risk (23Citores M.J. Rua-Figueroa I. Rodriguez-Gallego C. Durantez A. Garcia-Laorden M.I. Rodriguez-Lozano C. Rodriguez-Perez J.C. Vargas J.A. Perez-Aciego P. Ann. Rheum. Dis. 2004; 63: 310-317Crossref PubMed Scopus (31) Google Scholar, 24Martin-Donaire T. Losada-Fernandez I. Perez-Chacon G. Rua-Figueroa I. Erausguin C. Naranjo-Hernandez A. Rosodo S. Garcia-Saavedra A. Citores M.J. Vargas J.A. Perez-Aciego P. Arth. Res. Ther. 2007; 9: R89Crossref PubMed Scopus (15) Google Scholar). Our study not only defines the role of hnRNP L in regulating the function of exonic CA repeats but also provides a molecular mechanism of how CA repeat polymorphisms influence CD154 expression to increase the risk of rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE). Plasmids and Antisera—The pcDNA 3.1/LUC and tetracycline-responsive vector pTRE-LUC utilize the bovine growth hormone and β-globin polyadenylation signal sequences, respectively, and have been previously described (14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar). The murine CD154 3′-UTR corresponding to nt 23-650 relative to the translational stop site was amplified from total cellular RNA from B6 splenocytes activated with PMA (10 ng/ml; Sigma) plus ionomycin (0.5 μm) and cloned into TOPO 2.1 (Invitrogen). Sequencing confirmed identity with murine CD154 (Gen-Bank™ accession number 560692). Deletion of the CURE (nt 127-228) or the CARE (nt 229-306) from the CD154 3′-UTR corresponds to the CURE- and CARE-, respectively, whereas the CURE and CARE (nt 127-306) deletion is referred to as CUCARE-. All were generated by QuikChange (Stratagene) deletion from TOPO 2.1, as were the polycytidine and ARE mutations in the context of the CU/CARE-, and confirmed by sequencing. These sequences were released by EcoRI and cloned into the XbaI site in pcDNA 3.1 firefly luciferase (pcDNA3.1/LUC) vector (14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar). The CUCARE+ reporter was amplified and cloned into TOPO 2.1 and then released and ligated into pcDNA 3.1 luciferase, as described above. The CURE (CURE+) and CARE (CARE+) reporters were generated by QuikChange from plasmids containing the CUCARE+ in TOPO 2.1 and cloned into pcDNA 3.1 luciferase as described above. The pTRE-Luc vectors were generated by cloning inserts from the TOPO 2.1 vectors into the EcoRV site downstream of the luciferase coding region. The CARE was cloned downstream of the polyadenylation signal sequence in the BamHI site of pGL3-promoter vector (Promega). Short hairpin RNA cDNA (HuSH plasmids) targeting hnRNP L were purchased from Origene; their activity was confirmed in HeLa cells by immunoblotting. Generation of pcDNA3.1-hnRNP L resulted from release of hnRNP L from pFASTBac hnRNP L (generously provided by Dr. Albert Bindereif) through EcoRI and XhoI digestion and cloning into EcoRI and XhoI sites in pcDNA 3.1. Mouse anti-green fluorescent protein antibody and goat anti-TIA (T-cell intracellular antigen) antiserum were obtained from Invitrogen and Santa Cruz Biotechnology, respectively. Human serum containing antibodies that react with Ge-1, a component of the cytoplasmic RNA processing body, was previously described (25Yu J.H. Yang W.H. Gulick T. Bloch K.D. Bloch D.B. RNA. 2005; 11: 1795-1802Crossref PubMed Scopus (152) Google Scholar). Fluorescein isothiocyanate- or rhodamine-conjugated, species-specific donkey anti-human, anti-mouse, and anti-goat IgG antisera were obtained from Jackson ImmunoResearch Laboratories. Transient Transfection Assay of Reporter Gene Activity—Except for small interfering RNA and hnRNP L overexpression studies, 5 × 104 HeLa cells were transfected with 50 ng of luciferase vectors, 1.5 μl of Lipofectamine (Invitrogen), and 4 μl of PLUS (Invitrogen) in 0.5 ml of RPMI for 3.5 h at 37 °C 5% CO2, after which 0.5 ml of RPMI plus 20% fetal calf serum was added. After 20 h, cells were lysed, and luciferase activity was determined by luminometry. Individual experiments were analyzed for 3′-UTR-specific effects by dividing the mean luciferase activity from triplicate transfections of pcDNA3.1/LUC- or pTRE-LUC-based expression plasmids by that obtained from cells transfected with the corresponding control vector, which was assigned a value of 100%. Identical results were obtained when we utilized cotransfection of Renilla luciferase vectors to control for changes in transfection efficiency (data not shown). In short hairpin RNA and hnRNP L overexpression experiments, cells were transiently transfected at day -2 with either 500 ng of HuSH 303 or HuSH L79 or 250 ng of empty pcDNA 3.1 control vector or pcDNA 3.1 hnRNP L, followed by a repeat cotransfection of these plasmids along with the corresponding luciferase reporters at day 0 with 40-60% transfection efficiency of the effector vectors. Separate cultures received equivalent amounts of the corresponding control vector (empty or containing an irrelevant RNA sequence) on days -2 and 0. Transient transfection of human peripheral blood mononuclear cells was performed using AMAXA nucleofection. After being transiently transfected overnight, luciferase activity was measured. Additional cultures were activated with PMA/ionomycin for 4 h prior to analysis of luciferase activity. RNA Analysis by Quantitative RT-PCR—Cytoplasmic RNA was extracted as previously described (26Gough N.M. Anal. Biochem. 1988; 173: 93-95Crossref PubMed Scopus (385) Google Scholar). Nuclei were pelleted and resuspended in Solution 1 (10 mm Tris, 150 mm NaCl, 1.5 mm MgCl2, and 0.65% Nonidet P-40) and spun through a 30% sucrose cushion, resuspended in Solution 1, and spun through a 30% sucrose cushion again. Nuclear RNA was then extracted as previously described (27Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (64426) Google Scholar). Poly(A) RNA was purified using Oligotex beads (Qiagen). Isolation of a polysome-enriched fraction was performed as previously described (28Brooks S.A. Connolly J.E. Diegel R.J. Fava R.A. Rigby W.F.C. Arth. Rheum. 2002; 46: 1362-1370Crossref PubMed Scopus (57) Google Scholar). Cells were washed three times with 1× phosphate-buffered saline and resuspended in 3.5 ml of Buffer A (10 mm Tris-HCl, pH 7.6, 1 mm KAc, 1.5 mm MgAc, 2 mm dithiothreitol, 1 mg/ml pepstatin A, 1 mg/ml leupeptin, 1 mm pefabloc). The inclusion of EDTA (10 mm) in the homogenization buffer was used to disrupt polysomes prior to purification (29Nolan R.D. Arnstein H.R. Eur. J. Biochem. 1969; 9: 445-450Crossref PubMed Scopus (16) Google Scholar). Cells were lysed by 20 strokes with a Teflon pestle homogenizer at 1,500 rpm and centrifuged at 12,000 × g for 10 min to pellet the nuclei, followed by layering of the supernatant onto a 30% sucrose gradient in buffer A that was centrifuged at 4 °C for 5 h at 36,000 rpm. RNA was extracted from polysomes and S130, and RT-PCR analysis was performed as described (14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar, 27Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (64426) Google Scholar). For studies of mRNA stability, Tet-Off HeLa cells (Clontech) were purchased and carried according to the manufacturer's instructions and transiently transfected as described above, allowed to recover overnight, and then treated with doxycycline (1 μg/ml) to shut off transcription for specified times. Analysis of the effects of priming on gene expression utilized cytoplasmic RNA that was digested with TurboDNase I (Ambion) and then reverse transcribed with either oligo(dT), random hexamers, or a luciferase-specific primer (5′-TTTGGCGGTTGTTACTTGAC-3′) and Superscript II RT (Invitrogen). Reverse transcriptions were analyzed for luciferase transcripts using primers for luciferase, GAPDH, and H4 histone RNA: luciferase, 5′-GGTGGCTCCCGCTGAATTGG-3′ (upper) and 5′-CCGTCATCGTCTTTCCGTGC-3′ (lower); GAPDH, 5′-ACCACCTTCTTGATGTCATC-3′ (upper) and 5′-CAAGGCTGTGGGCAAGGTCA-3′ (lower); H4 histone, 5′-CAACATTCAGGGCATCACCAA-3′ (upper) and 5′-CCCGAATCACATTCTCCAAGAA-3′ (lower). Oligo(dT) and random hexamer (RH) priming of reverse transcriptions were analyzed for GAPDH and histone H4 transcripts to control for input RNA. Real time PCR was performed using a Bio-Rad iCycler and IQ SYBR Green Supermix (Bio-Rad product number 170-8882). The luciferase/GAPDH or H4 transcript ratio was calculated for each sample, where Ct = threshold cycle and ΔCt = luciferase Ct - GAPDH (oligo(dT)-primed RT) or H4 (RH-primed RT) Ct. ΔΔCt =ΔCt1 - ΔCt2, where ΔCt1 is CD154 and ΔCt2 is control with the -fold difference = 2-ΔΔCt. In these experiments, the percentage inhibition of CD154 3′UTR-dependent luciferase expression seen with each vector and priming method was calculated and then divided by the inhibition seen with the empty control vector, which was assigned a value of 100%. In some instances (Fig. 4), data are presented where the ΔCt obtained with oligo(dT) for a given transfection is subtracted from that obtained with random hexamer (ΔCtRH - ΔCtdT) or luciferase-specific priming. Student's t test was performed, and p values were determined using Excel. Immunoprecipitation Analysis—HeLa cells were transiently transfected as specified and cultured overnight, or human peripheral blood mononuclear cells were activated for 24 h with PMA (10 ng/ml) and ionomycin (1 μm). Cytoplasmic and nuclear extractions were performed as previously described (10Rigby W.F.C. Waugh M.G. Hamilton B.J. J. Immunol. 1999; 163: 4199-4206PubMed Google Scholar, 14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar) with the addition of Protector RNase inhibitor (Roche Applied Science). Immunoprecipitations from extracts were performed in immunoprecipitation buffer (10 mm Tris, pH 7.6, 1.5 mm MgCl2, 0.05% Triton X-100, 150 mm NaCl, 2 μm pefabloc, 2 ng/ml each leupeptin and pepstatin A, 4 units/ml RNase inhibitor from Roche Applied Science) in parallel with 4D11 (anti-RNP L) and BB7 (anti-PTB) antibodies as well as a mouse IgG isotype control bound to protein A-Sepharose beads (Amersham Biosciences). Beads were washed six times with 10 volumes of immunoprecipitation buffer, and 5% of packed beads were boiled in SDS-PAGE loading buffer and resolved by 12% SDS-PAGE and immunoblotted. To study the RNA tethering of PTB and hnRNP L, RNase A digestion was performed prior to immunoprecipitation, as previously described (30Lykke-Andersen J. Wagner E. Genes Dev. 2005; 19: 351-361Crossref PubMed Scopus (386) Google Scholar). Similar results were obtained with the incubation of beads with RNase A (1 unit/ml, 37 °C, 30 min; Roche Applied Science) at 37 °C treatment following immunoprecipitation. The remaining beads were digested with proteinase K (Roche Applied Science) and extracted with phenol/chloroform. Following DNase I digestion, the presence of human CD154 or luciferase mRNA in each precipitation was measured by oligo(dT)-based reverse transcription and quantitative PCR using primer specific for luciferase (described above) or human CD154, GAPDH (described above), interleukin-2, or γ-interferon primers as listed below: CD154, 5′-TTGCGGGCAACAATCCATTCACTT (upper) and 5′-GTGGGCTTAACCGCTGTGCTGTATT (lower); interleukin-2, 5′-AACCTCAACTCCTGCCACA (upper) and 5′-CCTGGTCACTTTGGGATTCT (lower); γ-interferon, 5′-GGCAAGGCTATGTGATTAC (upper) and 5′-TTTCCATTTGGGTACAGTCA (lower). Analysis of Poly(A) Tail Length—Poly(A) tail length was measured by a ligase-mediated polyadenylation tail assay (LM-PAT) assay (31Salles F.J. Richards W.G. Strickland S. Methods. 1999; 17: 38-45Crossref PubMed Scopus (134) Google Scholar), in which the 3′-end of the poly(A) tail was hybridized to a primer containing oligo(dT)16 and a GC “anchor” sequence, 5′-GCGAGCTCCGCGGCCGCT16-3′ (Operon). Target mRNA (100 ng) was incubated with phosphorylated oligo(dT)16 (Roche Applied Science) at 42 °C in the presence of 10 units of T4 DNA ligase (Invitrogen) saturating the poly(A) tail, thereby creating an oligo(dT) copy of the poly(A) tail. At 42 °C, the 3′-end of the poly(A) tail remained largely unpaired due to unfavorable hybridization conditions. The oligo(dT)-GC anchor sequence was added at a 10-fold molar excess, and the temperature was reduced to 12 °C, enabling selective hybridization to the unpaired 3′-ends. Reverse transcription was performed (Superscript II reverse transcriptase; Invitrogen), followed by PCR using a primer corresponding to the GC-rich sequence in the oligo(dT) anchor along with a primer specific for the mRNA to be analyzed. Primers used for LM-PAT assay were as follows: luciferase, GCCATCTGTTGTTTGCC; mCD154, CTGTCTACAGCACTGTCGGG; mTNF, CACCTGGCCTCTCTACCTTG. Primers are designed so that the PCR product encodes a restriction enzyme site: MnlI, AseI, and HphI, respectively. Products are resolved by agarose gel electrophoresis, and the identity of the visualized band was confirmed by restriction enzyme digestion. Immunohistochemistry—Hep-2 cells were transfected with a eukaryotic expression plasmid encoding green fluorescent protein-hnRNP L using the Effectene transfection system (Qiagen). To induce stress granule formation, Hep-2 cells were exposed to sodium arsenite (0.5 mm) for 1 h at 37 °C. For immunofluorescent staining, Hep-2 cells were fixed with 2% paraformaldehyde in PBS and permeabilized by treatment with 100% methanol. Cells were stained with primary and secondary antisera as previously described (25Yu J.H. Yang W.H. Gulick T. Bloch K.D. Bloch D.B. RNA. 2005; 11: 1795-1802Crossref PubMed Scopus (152) Google Scholar). The Murine CD154 3′-UTR Has Two cis-Acting Elements That Independently Regulate Reporter Gene Expression—The murine CD154 3′-UTR exhibits highly conserved CU- and CA-rich elements as well as polycytidine (pC) and ARE (Fig. 1). Relative to its human counter-part, the murine CURE and CARE are condensed (∼180 nt). Transient transfection of HeLa cells with chimeric reporter constructs demonstrated that the conserved murine CD154 3′-UTR functioned to reduce luciferase expression (Fig. 2a). The magnitude of this effect was equivalent to that seen with the human CD154 3′-UTR (14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar). Prior studies established that human CD154 mRNA levels and stability were regulated by the interaction of PTB proteins with canonical binding sites in a region in the CU-rich portion of the 3′-UTR (11Ford G.S. Barnhart B. Shone S. Covey L.R. J. Immunol. 1999; 162: 4037-4044PubMed Google Scholar, 14Hamilton B.J. Genin A. Cron R.Q. Rigby W.F.C. Mol. Cell. Biol. 2003; 23: 510-525Crossref PubMed Scopus (73) Google Scholar). Thus, deletion of these PTB binding sites contained in the CURE of the murine CD154 3′-UTR (CURE-) was predicted to eliminate its ability to inhibit reporter gene expression (Fig. 1). Unexpectedly, little or no decrease in inhibition was seen with the CURE-CD154 3′-UTR (Fig. 2a). Deletion of the CARE (CARE-) from the 3′-UTR also retained inhibitory activity. Excision of both CURE and CARE (CUCA-) increased luciferase activity that approached or exceeded that seen with controls. Similar effects were seen with transient transfection of human peripheral blood mononuclear cells under basal and short term activation conditions (Fig. 2b). These data suggest that CURE and CARE both regulated reporter gene expression. Mutations of other candidate cis-acting elements (the retained AURE, poly(C) sequence) in the context of CURE and CARE deletion (CUCA-) had no effect on reporter gene expression (Fig. 2c). Insertion of the CURE (CARE+) or CARE (CARE+) alone in the 3′-UTR of reporter genes demonstrated that each cis-acting element was equipotent in reducing luciferase activity (Fig. 2d). Thus, either the CURE or the CARE is sufficient to transfer their effect when present in the 3′-UTR of heterologous transcripts. However, combining the CURE and CARE (CUCA+) did not further enhance their effects on luciferase expression (Fig. 2d). The CURE and CARE in the Murine CD154 3′-UTR Regulate Reporter Gene Expression through Different Pathways—Using transient transfection of plasmid reporters into HeLa cells, we examined the eff