Role of Monocyte Chemoattractant Protein-1 and its Receptor,CCR-2, in the Pathogenesis of Bleomycin-Induced Scleroderma
2003; Elsevier BV; Volume: 121; Issue: 3 Linguagem: Inglês
10.1046/j.1523-1747.2003.12408.x
ISSN1523-1747
AutoresToshiyuki Yamamoto, Kiyoshi Nishioka,
Tópico(s)Interstitial Lung Diseases and Idiopathic Pulmonary Fibrosis
ResumoSystemic sclerosis is a connective tissue disease characterized by excessive deposition of extracellular matrix in the skin as well as various internal organs. Cellular infiltrates are found in the dermis in early systemic sclerosis, which are suggested to play an important part. Recent studies suggest the involvement of monocyte chemoattractant protein-1, a C-C chemokine, in the fibrotic process. This study examines the role of monocyte chemoattractant protein-1 in the induction of dermal sclerosis in a murine model of bleomycin-induced scleroderma. Immunohistochemical analysis showed that expression of monocyte chemoattractant protein-1 in the infiltrating mononuclear cells was enhanced at 2 to 3 wk following bleomycin treatment, whereas expression of monocyte chemoattractant protein-1 in fibroblasts was detected at later stages in the sclerotic skin. Reverse transcriptase–polymerase chain reaction analysis showed that monocyte chemoattractant protein-1 mRNA expression in the lesional skin peaked at 2 to 3 wk following bleomycin treatment. Expression of CCR-2, a major receptor for monocyte chemo-attractant protein-1, was also upregulated in the lesional skin at both protein and mRNA levels following bleomycin treatment. Administration of anti-monocyte chemoattractant protein-1 neutralizing antibody together with local bleomycin treatment reduced dermal sclerosis, along with a decrease of collagen content in the skin as well as mRNA expression of type I collagen. In vitro analysis showed that stimulation with monocyte chemoattractant protein-1 (10 ng per mL) upregulated α1(I) collagen and decorin mRNA expression in normal dermal fibroblasts, whereas mRNA levels of fibronectin and biglycan were not altered. These data suggest that monocyte chemoattractant protein-1 and CCR-2 signaling plays an important part in the pathogenesis of bleomycin-induced scleroderma. Monocyte chemoattractant protein-1 may contribute to the induction of dermal sclerosis via its direct effect of upregulation of mRNA expression of extracellular matrix on fibroblasts, as well as indirect effect mediated by a number of cytokines released from immunocytes recruited into the lesional skin. Systemic sclerosis is a connective tissue disease characterized by excessive deposition of extracellular matrix in the skin as well as various internal organs. Cellular infiltrates are found in the dermis in early systemic sclerosis, which are suggested to play an important part. Recent studies suggest the involvement of monocyte chemoattractant protein-1, a C-C chemokine, in the fibrotic process. This study examines the role of monocyte chemoattractant protein-1 in the induction of dermal sclerosis in a murine model of bleomycin-induced scleroderma. Immunohistochemical analysis showed that expression of monocyte chemoattractant protein-1 in the infiltrating mononuclear cells was enhanced at 2 to 3 wk following bleomycin treatment, whereas expression of monocyte chemoattractant protein-1 in fibroblasts was detected at later stages in the sclerotic skin. Reverse transcriptase–polymerase chain reaction analysis showed that monocyte chemoattractant protein-1 mRNA expression in the lesional skin peaked at 2 to 3 wk following bleomycin treatment. Expression of CCR-2, a major receptor for monocyte chemo-attractant protein-1, was also upregulated in the lesional skin at both protein and mRNA levels following bleomycin treatment. Administration of anti-monocyte chemoattractant protein-1 neutralizing antibody together with local bleomycin treatment reduced dermal sclerosis, along with a decrease of collagen content in the skin as well as mRNA expression of type I collagen. In vitro analysis showed that stimulation with monocyte chemoattractant protein-1 (10 ng per mL) upregulated α1(I) collagen and decorin mRNA expression in normal dermal fibroblasts, whereas mRNA levels of fibronectin and biglycan were not altered. These data suggest that monocyte chemoattractant protein-1 and CCR-2 signaling plays an important part in the pathogenesis of bleomycin-induced scleroderma. Monocyte chemoattractant protein-1 may contribute to the induction of dermal sclerosis via its direct effect of upregulation of mRNA expression of extracellular matrix on fibroblasts, as well as indirect effect mediated by a number of cytokines released from immunocytes recruited into the lesional skin. monocyte chemoattractant protein-1 systemic sclerosis Systemic sclerosis (SSc) is an autoimmune disorder with unknown etiology, characterized by excessive accumulation of extracellular matrix in the involved skin or various internal organs and vascular involvement (Krieg and Meurer, 1988Krieg T. Meurer M. Systemic scleroderma. Clinical and pathophysiological aspects.J Am Acad Dermatol. 1988; 18: 457-481Abstract Full Text PDF PubMed Scopus (174) Google Scholar;LeRoy et al., 1991LeRoy E.C. Trojanowska M. Smith E.A. The pathogenesis of scleroderma (systemic sclerosis, SSc).Clin Exp Rheumatol. 1991; 9: 173-177PubMed Google Scholar). Activated fibroblasts in the affected areas produce high amounts of collagen (Bostein et al., 1982Bostein G.R. Sherer G.K. LeRoy E.C. Fibroblast selection in scleroderma. An alternative model of fibrosis.Arthritis Rheum. 1982; 25: 189-195Crossref PubMed Scopus (149) Google Scholar;Krieg et al., 1986Krieg T. Perlish J.S. Fleischmajer R. Timpl R. Collagen synthesis by scleroderma fibroblasts.Ann NY Acad Sci. 1986; 460: 375-378Crossref Scopus (46) Google Scholar;Mauch et al., 1993Mauch C. Eckes B. Hunzelmann N. Oono T. Kozlowska E. Krieg T. Control of fibrosis in systemic scleroderma.. 1993; 100: 92-96Google Scholar). One of the characteristic histologic features is the inflammatory infiltrates of mononuclear cells (Fagundus and LeRoy, 1994Fagundus D.M. LeRoy E.C. Cytokines and systemic sclerosis.Clin Dermatol. 1994; 12: 407-417Abstract Full Text PDF PubMed Scopus (37) Google Scholar;Postlethwaite, 1995Postlethwaite A.E. Connective tissue metabolism including cytokine in scleroderma.Curr Opin Rheumatol. 1995; 7: 535-540Crossref PubMed Scopus (18) Google Scholar), which is associated with increased collagen synthesis in the surrounding fibroblasts (Fleischmajer et al., 1977Fleischmajer R. Perlish J.S. Reeves J.R.T. Cellular infiltrates in scleroderma skin.Arthritis Rheum. 1977; 20: 975-984Crossref PubMed Scopus (300) Google Scholar; Scharffetter et al., 1988Scharffetter K. Lankat-Buttgereit B. Krieg T. Localization of collagen mRNA in normal and scleroderma skin by in-situ hybridization.Eur J Clin Invest. 1988; 18: 9-17Crossref PubMed Scopus (178) Google Scholar). Inflammatory cells are potent candidates for releasing cytokines, which play a crucial part in initiating and/or leading to the sequential events of fibrosis (LeRoy et al., 1989LeRoy E.C. Smith E.A. Kahaleh M.B. Trojanowska M. Silver R.M. A strategy for determining the pathogenesis of systemic sclerosis. Is transforming growth factor beta the answer? Arthritis Rheum.. 1989; 32: 817-825Google Scholar;Kovacs and DiPietro, 1994Kovacs E.J. DiPietro L.A. Fibrogenic cytokines and connective tissue production.FASEB J. 1994; 8: 854-861Crossref PubMed Scopus (343) Google Scholar). Monocyte chemoattractant protein (MCP)-1 is a chemoattractant for monocytes and T cells, belonging to a C-C chemokine superfamily of small proteins that are important in recruiting and activating leukocytes during inflammation (Rollins et al., 1988Rollins B.J. Morrison E.D. Stiles C.D. Cloning and expression of JE, a gene inducible by platelet-derived growth factor and whose product has cytokine-like properties.Proc Natl Acad Sci USA. 1988; 85: 3742-3748Crossref Scopus (367) Google Scholar;Leonard and Yoshimura, 1990Leonard E.J. Yoshimura T. Human monocyte chemoattractant protein-1 (MCP-1).Immunol Today. 1990; 11: 97-101Abstract Full Text PDF PubMed Scopus (524) Google Scholar). MCP-1 has also been characterized as the murine JE gene product. Previous studies have shown that numerous types of cells, including fibroblasts, endothelial cells, epithelial cells, mononuclear cells, smooth muscle cells, and mast cells are capable of expressing MCP-1 in the presence of serum or specific stimuli (Leonard and Yoshimura, 1990Leonard E.J. Yoshimura T. Human monocyte chemoattractant protein-1 (MCP-1).Immunol Today. 1990; 11: 97-101Abstract Full Text PDF PubMed Scopus (524) Google Scholar;Selvan et al., 1994Selvan R.S. Butterfield J.H. Krangel M.S. Expression of multiple chemokine genes by human mast cells.J Biol Chem. 1994; 269: 13893-13898PubMed Google Scholar). Recent studies have demonstrated that MCP-1 gene expression is upregulated in human idiopathic pulmonary fibrosis (Antoniades et al., 1992Antoniades H.N. Neville-Golden J. Galanopoulos T. Kradin R.L. Valente A.J. Graves D.T. Expression of monocyte chemoattractant protein 1 mRNA in human idiopathic pulmonary fibrosis.Proc Natl Acad Sci USA. 1992; 0: 5371-5375Crossref Scopus (224) Google Scholar), as well as rodent models of bleomycin-induced pulmonary fibrosis (Zhang et al., 1994Zhang K. Gharaee-Kermani M. Jones M.L. Warren J.S. Phan S.H. Lung monocyte chemoattractant protein-1 gene expression in bleomycin-induced pulmonary fibrosis.J Immunol. 1994; 153: 4733-4741PubMed Google Scholar) or crescent nephritis and interstitial kidney fibrosis (Lyoid et al., 1997Lyoid C.M. Minto A.W. Dorf M.E. Proudfoot A. Wells T.N.C. Salant D.J. Gutierrez-Ramos J.-C. RANTES and monocyte chemoattractant protein-1 (MCP-1) play an important role in the inflammatory phase of crescent nephritis, but only MCP-1 is involved in crescent formation and interstitial fibrosis.J Exp Med. 1997; 185: 1371-1380Crossref PubMed Scopus (425) Google Scholar). A recent in vitro study shows that MCP-1 upregulates type I collagen mRNA expression in rat lung fibroblasts, which is indirectly mediated by endogenous upregulation of transforming growth factor (TGF)-β gene expression (Gharaee-Kermani et al., 1996Gharaee-Kermani M. Denholm E.M. Phan S.H. Costimulation of fibroblast collagen and transforming growth factor β1 gene expression by monocyte chemoattractant protein-1 via specific receptors.J Biol Chem. 1996; 271: 17779-17784Crossref PubMed Scopus (385) Google Scholar). We previously reported that MCP-1 enhances expression of matrix metalloproteinase-1 and -2, as well as tissue inhibitor of metalloproteinase-1 in cultured skin fibroblasts (Yamamoto et al., 2000aYamamoto T. Kuroda M. Takagawa S. Nishioka K. Animal model of sclerotic skin. III. Histopathological comparison of bleomycin-induced scleroderma in various mice strains.Arch Dermatol Res. 2000; 292: 535-541Crossref PubMed Scopus (76) Google Scholar). In addition, MCP-1 expression was increased in scleroderma fibroblasts both in vitro (Yamamoto et al., 2001aYamamoto T. Eckes B. Krieg T. High expression and autoinduction of monocyte chemoattractant protein-1 in scleroderma fibroblasts.Eur J Immunol. 2001; 31: 2936-2941Crossref PubMed Scopus (66) Google Scholar) and in vivo (Hasegawa et al., 1999Hasegawa M. Sato S. Takehara K. Augmentation of production of chemokines (monocyte chemotactic protein-1 (MCP-1), macrophage inflammatory protein-1α (MIP-1β) and MIP-1α) in patients with systemic sclerosis: MCP-1 and MIP-1α may be involved in the development of pulmonary fibrosis.Clin Exp Immunol. 1999; 117: 159-165Crossref PubMed Scopus (188) Google Scholar;Yamamoto et al., 2001bYamamoto T. Eckes B. Hartmann K. Krieg T. Expression of monocyte chemoattractant protein-1 in the lesional skin of systemic sclerosis.J Dermatol Sci. 2001; 26: 133-139Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). These results suggest an important involvement of MCP-1 in the pathogenesis of scleroderma. We have recently established a mouse model for scleroderma by repeated application of bleomycin (Yamamoto et al., 1999aYamamoto T. Takagawa S. Katayama I. Yamazaki K. Hamazaki Y. Shinkai H. Nishioka K. Animal model of sclerotic skin. I. Local injections of bleomycin induce sclerotic skin mimicking scleroderma.J Invest Dermatol. 1999; 112: 456-462Abstract Full Text Full Text PDF PubMed Scopus (312) Google Scholar,Yamamoto et al., 1999bYamamoto T. Takahashi Y. Takagawa S. Katayama I. Nishioka K. Animal model of sclerotic skin. II. Bleomycin induced scleroderma in genetically mast cell deficient WBB6F1-W/WV mice.J Rheumatol. 1999; 26: 2628-2634PubMed Google Scholar,Yamamoto et al., 2000bYamamoto T. Eckes B. Mauch C. Hartmann K. Krieg T. Monocyte chemoattractant protein-1 enhances gene expression and synthesis of matrix metalloproteinase-1 in human fibroblasts by an autocrine IL-1α loop.J Immunol. 2000; 164: 6174-6179Crossref PubMed Scopus (215) Google Scholar,c;Yamamoto and Nishioka, 2002Yamamoto T. Nishioka K. Animal model of sclerotic skin V. Increased expression of a-smooth muscle actin in fibroblastic cells in bleomycin-induced scleroderma.Clin Immunol. 2002; 102: 77-83Crossref PubMed Scopus (61) Google Scholar). Local injections of bleomycin-induced dermal sclerosis which mimics human scleroderma both histologically and biochemically in several mice strains. In this study, we examined the role of MCP-1 and its receptor, CCR-2, in the pathogenesis of bleomycin-induced dermal sclerosis. Specific pathogen-free, female C3H/HeJ mice (6 wk old; weighing about 20 g) were purchased from Japan Clea (Tokyo, Japan) and maintained with food and water ad libitum. All mice were treated humanly, and all the experiments were performed in accordance with proper institutional approval. Bleomycin (Nippon Kayaku Co. Ltd, Tokyo, Japan) was dissolved in phosphate-buffered saline (PBS) at a concentration of 1 mg per mL. One hundred microliters of bleomycin or control PBS were injected into the shaved back of mice every other day for 4 wk with a 26-gauge needle. In each group, six mice were examined. Biopsy was performed from the shaved back skin on the next day of the final treatment. The skin pieces were cut into two. One was fixed in 10% formalin solution and embedded in paraffin, and the other was snap-frozen in OCT compound (Miles, Elkhart, Indiana) in liquid nitrogen and stored immediately at –80°C. Five micrometer thick cryostat sections were prepared on poly L-lysin coated slides. Immunohistochemistry was performed by the avidin–biotin peroxidase technique using anti-murine MCP-1 antibody (Genzyme Techne, Minneapolis, Minnesota) (diluted in PBS, 1:250) or anti-CKR-2B antibody (Santa Cruz Biotechnology Inc., Santa Cruz, California) 1:250. The sections were developed with 3,3′-diaminobenzidine solution as chromogen. They were counterstained with hematoxylin, dehydrated, cleared, and mounted. Negative controls were prepared by omission of the primary antibody and by its substitution for corresponding IgG. Total RNA was isolated from biopsied skin tissues using RNeasy Mini Kit (Qiagen, Tokyo, Japan). Complementary single-stranded DNA was synthesized from total RNA by reverse transcription. Initially, 100 ng of total RNA in DEPC-treated water was heated at 65°C for 5 min and cooled rapidly. After adding 1 μL of 10×PCR buffer (500 mM KCl, 100 mM Tris–HCl buffer, pH 8.4, 15 mM MgCl2 and 0.01% gelatin), 1 mL of 25 mM aNTP (Takara, Tokyo, Japan), 1 μL of 10á×hexanucleotide mixture (Roche Diagnostics GmbH, Mannheim, Germany), 20 U of ribonuclease inhibitor (Takara) and 3 U of RAV-2 reverse transcriptase (Takara), the mixture was incubated at 42°C for 60 min, heated at 94°C for 5 min and quick-chilled on ice. The cDNA was amplified by PCR using Ready-to-Go PCR beads (Amersham Pharmacia Biotech, Piscataway, New Jersey) with the specific primers for MCP-1 (sense; 5′CTCACCTGCTGCTACTCATTC 3′, anti-sense; 5′ GCATGAGGTGGTTGTGAAAAA 3′), CCR-1 (sense; 5′ GTGTTCATCATTGGAGTGGTGG 3′, anti-sense 5′ GGTTGAACAGGT-AGATGCTGGTC 3′), CCR-2 (sense; 5′ TGTTACCTCAGTTCATCCA-CGG 3′, anti-sense; 5′ CAGAATGGTAATGTGAGCAGGAAG 3′), type I collagen (sense; 5′ TGGTGCCAAGGGTCTCACTGGC 3′, anti-sense; 5′ GGACCTTGTACACCACGTTCACC 3′), and GAPDH (sense; 5′ TGAAGGTCGGTGTGAACGGATTTGGC 3′, anti-sense; 5′ CATGTAGGCCATGAGGTCCACCAC 3′). Other primers for MIP-1α, MIP-1β, and RANTES were purchased from Biosource International (Camarillo, California). The PCR conditions for amplification were as follows; the mixture was first incubated for 1 min and 30 s at 94°C and then cycled 30 times at 94°C for 25 s, 55°C for 30 s, 72°C for 45 s, followed by extension at 72°C for 10 min. For GAPDH, amplification was performed 25 cycles. Cycle curve studies confirmed that amplification occurred in a linear range. After amplification, PCR products were subjected to electrophoresis on 1.7% agarose gels and detected by ethidium bromide under ultraviolet illuminator. For negative control, total cellular RNA without reverse transcription was used. Primary human normal dermal fibroblasts were established by outgrowth from skin biopsies of healthy donors (n=4, aged 40–65 y old) after informed consent. Cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% heat inactivated fetal bovine serum, 2 mM glutamine, 50 μg sodium ascorbate per mL, 100 U per mL penicillin, 100 μg streptomycin per mL, and grown in the moist atmosphere of a CO2 incubator at 37°C. Cells were used at passage numbers 3 to 6. After the seeded fibroblasts were grown semiconfluent in the monolayer, the medium was changed to Dulbecco's modified Eagle's medium without fetal bovine serum. Twenty-four hours later, cells were incubated with 10 ng MCP-1 per mL (R&D Systems, Minneapolis, Minnesota) for 6 to 24 h. Total RNA was extracted from cultured fibroblasts as described above. Aliquots of 5 μg per lane were electrophoresed in denaturing agarose gels containing 0.66 M formaldehyde, transferred to GeneScreen membranes (NEN Life Science Products, Bostan, Massachusetts), fixed by ultraviolet cross-linking and hybridized to cDNA probes specific for α1(I) collagen (Hf 677) (Chu et al., 1982Chu M.L. Myers J.C. Bernard M. Ding J.F. Ramirez F. Cloning and characterization of five overlapping cDNAs specific for human proalpha 1(I) collagen chain.Nucleic Acid Res. 1982; 10: 5925-5935Crossref PubMed Scopus (375) Google Scholar), fibronectin (FN 711) (Bernard et al., 1985Bernard M. Kolbe M. Weil D. Chu M.L. Human cellular fibronectin. Comparison of the carboxyl-terminal portion with rat identifies primary structural domains separated by hypervariable regions.Biochemistry. 1985; 24: 2698-2704Crossref PubMed Scopus (79) Google Scholar), decorin (Krusius and Ruoslahti, 1986Krusius T. Ruoslahti E. Primary structure of an extracellular matrix proteoglycan core proteins deduced cloned cDNA.Proc Natl Acad Sci USA. 1986; 83: 7683-7687Crossref PubMed Scopus (398) Google Scholar), biglycan (Fisher et al., 1989Fisher L.W. Termine J.D. Young M.F. Deduced protein sequence of bone small proteoglycan I (biglycan) shows homology with proteoglycan II (decorin) and several non connective tissue proteins in a variety of species.J Biol Chem. 1989; 264: 4571-4576Abstract Full Text PDF PubMed Google Scholar), and GAPDH (Fort et al., 1985Fort P. Marty L. Piechaczyk M. el Sabrouty S. Dani C. Jeanteur P. Blanchard J.M. Various rat adult tissues express only one major mRNA species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family.Nucleic Acid Res. 1985; 13: 1431-1442Crossref PubMed Scopus (1957) Google Scholar), which were labeled by random priming using [α-32P]deoxycytidine triphosphate. Filters were hybridized overnight at 42°C in 50% formamide, 5á×sodium citrate/chloride buffer, 100 μg denatured salmon sperm DNA per mL, 5á×Denhardt's, washed twice at room temperature in 2á×sodium citrate/chloride buffer, 0.1% sodium dodecyl sulfate, followed by washing step at high stringency (62–65°C in 0.1á×sodium citrate/chloride buffer, 0.1% sodium dodecyl sulfate). Autoradiography was performed from 6 h to 1 d at –80°C using intensifying screens (Kodak, Rochester, New York). Signal intensities were determined by densitometry, and normalized to GAPDH. To determine the effect of the antibody on the induction of dermal sclerosis, we intravenously administered anti-murine MCP-1 neutralizing antibody (Genzyme Techne) 250 μg per mL 30 min before subcutaneous injections of bleomycin (1 mg per mL). Fifty microliters of anti-MCP-1 antibody was injected from tail vein (n=6) every other day for 4 wk and the back skins were harvested. Normal goat serum (NGS) (n=6) and anti-RANTES neutralizing antibody (Genzyme Techne) 250 μg per mL (n=6) were used as a control under the same protocol. Collagen deposition was estimated by determining the total collagen content of the 8 mm punch biopsy specimens using the Sircol Collagen Assay kit (Biocolor, Northern Ireland) according to the manufacturer's instructions. The biopsies were homogenized in 0.5 M acetic acid, and 1 mL of Sircol dye reagent that binds to collagen was added to each sample and then mixed for 30 min. After centrifugation, the pellet was suspended in 1 mL of the alkali reagent included in the kit and assessed colorimetrically at 540 nm by a spectrophotometer. Collagen standard solutions were utilized to construct a standard curve. Results were expressed as a percentage compared with control group that received only PBS injections. Results were expressed as mean±SD. Significance testing was analyzed using Mann–Whitney U test. p<0.05 was considered to be significant. To begin with, immuno-histochemical detection of MCP-1 was examined in the lesional skin. Fibroblasts and mononuclear cells were morphologically identified by a few dermatologists in our department. MCP-1-positive cells were weakly detected on scattered mononuclear cells in PBS-treated skin (Figure 1a). Fibroblastic cells were negatively stained with MCP-1 in PBS-treated skin. By contrast, MCP-1 was detectable on the infiltrating mononuclear cells in the dermis at 1 wk, and the number of MCP-1-positive cells peaked at 2 to 3 wk in bleomycin-treated mice (Figure 1b). In addition, the positively labeled fibroblastic cells were also localized in the sclerotic dermis at later stages (Figure 1c). MCP-1 was also detected in keratinocytes, endothelial cells, and possibly mast cells. CCR-2 is the major receptor for MCP-1. MCP-1 and CCR-2 have been implicated in several inflammatory diseases. In this study, we examined the involvement of CCR-2 in the induction of dermal sclerosis induced by bleomycin. Immunohistochemical examination revealed that CCR-2 expression was enhanced on the infiltrating mononuclear cells at 2 to 3 wk following bleomycin treatment, as compared with PBS treatment (Figure 1d,e). Thereafter, CCR-2 expression on the infiltrating mononuclear cells was decreased. On the contrary, CCR-2 was also detected on the fibroblastic cells in the sclerotic dermis after 4 wk (Figure 1f). This immunohistologic distribution demonstrated concurrent upregulation of MCP-1 and CCR-2 with enhanced expression on mononuclear cells at early inflammatory stages and on fibroblasts at later sclerotic stages. Results of reverse transcriptase–PCR analysis showed that mRNA expression of MCP-1 was increased and peaked at 2 to 3 wk following bleomycin treatment (Figure 2). The highest mRNA expression of MCP-1 coincides with the kinetics followed by the infiltrating leukocytes. In addition to MCP-1, mRNA expression of MIP-1α and MIP-1β was also upregulated at 3 wk after bleomycin treatment. On the other hand, RANTES mRNA expression was not significantly altered during the course. Results of reverse transcriptase–PCR analysis showed increased expression of CCR-2 mRNA, which reached a maximum at 2 to 3 wk following bleomycin treatment (Figure 3). CCR-1 mRNA level was mildly upregulated at 2 wk following bleomycin treatment. Next, effect of anti-MCP-1 neutralizing antibody was examined to determine whether blockade of MCP-1 activity suppresses the induction of dermal sclerosis. Mice treated with bleomycin (1 mg per mL) and intravenous NGS showed definite dermal sclerosis with thickened collagen bundles and deposition of homogeneous materials in the dermis (Figure 4a). On the contrary, systemic administration of anti-MCP-1 antibody together with local bleomycin treatment every other day for 4 wk suppressed the induction of dermal sclerosis (Figure 4a). The number of infiltrating mononuclear cells was reduced up to 50% after anti-MCP-1 treatment. Dermal thickness was also decreased after the treatment with anti-MCP-1 antibody. mRNA expression of type I collagen showed a partial reduction in mice treated with bleomycin and anti-MCP-1 antibody, as compared with that treated with bleomycin and NGS (Figure 4b). Collagen content in the skin treated with bleomycin and NGS (181±8.1% of control) showed a significant decrease after the treatment with bleomycin and anti-MCP-1 antibody (150°C 9.9% of control) (p<0.05) (Figure 4c). On the contrary, treatment with anti-RANTES antibody together with local bleomycin injections did not reduce dermal sclerosis (not shown), and there was no significant difference in the collagen contents in the skin between mice treated with bleomycin and NGS and those treated with bleomycin and anti-RANTES antibody (177±8.9% of control) (Figure 4c). Finally, we investigated the direct effect of MCP-1 on the induction of extracellular matrix in cultured fibroblasts. The time course of α1(I) collagen, fibronectin, decorin, and biglycan mRNA expression was examined by northern blot analysis in normal dermal fibroblasts exposed to 10 ng MCP-1 per mL for different time periods (6–24 h). As shown in Figure 5, α1(I) collagen mRNA was upregulated as early as 6 h and further increased at 24 h. Densitometric quantification revealed up to 4.3-fold increase of α1(I) collagen mRNA expression by MCP-1. Decorin mRNA expression showed its peak at 12 h, and waned to basal level at 24 h. MCP-1 upregulated α1(I) collagen and decorin mRNA expression in a concentration-dependent manner ranging from 1 to 50 ng per mL (data not shown). On the contrary, mRNA levels of fibronectin and biglycan were not significantly altered. Recent studies suggest that MCP-1 is involved in fibrotic process, including human idiopathic pulmonary fibrosis (Antoniades et al., 1992Antoniades H.N. Neville-Golden J. Galanopoulos T. Kradin R.L. Valente A.J. Graves D.T. Expression of monocyte chemoattractant protein 1 mRNA in human idiopathic pulmonary fibrosis.Proc Natl Acad Sci USA. 1992; 0: 5371-5375Crossref Scopus (224) Google Scholar), acute hepatic fibrogenesis (Marra et al., 1998Marra F. DeFranco R. Grappone C. et al.Increased expression of monocyte chemotactic protein-1 during active hepatic fibrogenesis: Correlation with monocyte infiltration.Am J Pathol. 1998; 152: 423-430PubMed Google Scholar), as well as experimental animal models of wound healing (DiPietro et al., 1995DiPietro L.A. Polverini P.J. Rahbe S.M. Kovacs E.J. Modulation of JE/MCP-1 expression in dermal wound repair.Am J Pathol. 1995; 146: 868-875PubMed Google Scholar), lung fibrosis induced by bleomycin (Zhang et al., 1994Zhang K. Gharaee-Kermani M. Jones M.L. Warren J.S. Phan S.H. Lung monocyte chemoattractant protein-1 gene expression in bleomycin-induced pulmonary fibrosis.J Immunol. 1994; 153: 4733-4741PubMed Google Scholar), and renal fibrosis (Lyoid et al., 1997Lyoid C.M. Minto A.W. Dorf M.E. Proudfoot A. Wells T.N.C. Salant D.J. Gutierrez-Ramos J.-C. RANTES and monocyte chemoattractant protein-1 (MCP-1) play an important role in the inflammatory phase of crescent nephritis, but only MCP-1 is involved in crescent formation and interstitial fibrosis.J Exp Med. 1997; 185: 1371-1380Crossref PubMed Scopus (425) Google Scholar). We have recently shown that MCP-1 expression is upregulated in scleroderma skin (Yamamoto et al., 2001bYamamoto T. Eckes B. Hartmann K. Krieg T. Expression of monocyte chemoattractant protein-1 in the lesional skin of systemic sclerosis.J Dermatol Sci. 2001; 26: 133-139Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar), as well as cultured scleroderma fibroblasts (Yamamoto et al., 2001aYamamoto T. Eckes B. Krieg T. High expression and autoinduction of monocyte chemoattractant protein-1 in scleroderma fibroblasts.Eur J Immunol. 2001; 31: 2936-2941Crossref PubMed Scopus (66) Google Scholar). Increased expression of MCP-1 in scleroderma has also been reported by other groups (Distler et al., 2001Distler O. Pap T. Kowal-Bielecka O. et al.Overexpression of monocyte chemoattractant protein 1 in systemic sclerosis: Role of platelet-derived growth factor and effects of monocyte chemotaxis and collagen synthesis.Arthritis Rheum. 2001; 44: 2665-2678Crossref PubMed Scopus (142) Google Scholar;Galindo et al., 2001aGalindo M. Santiago B. Rivero M. Rullas J. Alcami J. Pablos J.L. Chemokine expression by systemic sclerosis fibroblasts. Abnormal regulation of monocyte chemoattractant protein 1 expression.Arthritis Rheum. 2001; 44: 1382-1386Crossref PubMed Scopus (98) Google Scholar). Here we demonstrate that MCP-1 expression is enhanced in the lesional skin of an in vivo model for scleroderma. Immunohistologic localization revealed that both mononuclear cells and fibroblasts were the predominant cellular sources of MCP-1. MCP-1 was detected on the infiltrating mononuclear cells at relatively early phases, and thereafter also detected on fibroblasts in the sclerotic stages. MCP-1 expression in fibroblasts can play an important part in the development of fibrosis in scleroderma. It has been shown to modulate connective tissue deposition by both inducing collagen synthesis and collagenase production. MCP-1 produced by activated fibroblasts could act as a chemoattractant for mononuclear cells, which contribute to the initial inflammatory infiltrate localized around small blood vessels in the dermis in the early stages of scleroderma and could be involved in the perpetuation of the process. These infiltrating cells have been shown to play a disease-triggering role releasing a number of growth fact
Referência(s)