RNA Passes through the Hole of the Protein Hexamer in the Complex with the Escherichia coli Rho Factor
2001; Elsevier BV; Volume: 276; Issue: 6 Linguagem: Inglês
10.1074/jbc.m007066200
ISSN1083-351X
AutoresBrandt R. Burgess, John P. Richardson,
Tópico(s)ATP Synthase and ATPases Research
ResumoEscherichia coli transcription termination factor Rho is a ring-shaped hexameric protein that uses the energy derived from ATP hydrolysis to dissociate RNA transcripts from the ternary elongation complex. To test a current model for the interaction of Rho with RNA, three derivatives of Rho were made containing single cysteine residues and modified with a photo-activable cross-linker. The positions for the cysteines were: 1) in part of the primary RNA-binding site in the N terminus (Cys-82 Rho); 2) in a connecting polypeptide proposed to be on the outside of the hexamer (Cys-153 Rho); and 3) near the proposed secondary RNA-binding site in the ATP-binding domain (Cys-325 Rho). Results from the cross-linking of the modified Rho proteins to a series of λ cro RNA derivatives showed that Cys-82 Rho formed cross-links with all transcripts containing the Rho utilization (rut) site, that Cys-325 Rho formed cross-links to transcripts that had therut site and 10 or more residues 3′ of the rut site, and that Cys-153 did not form cross-links with any of the transcripts. From a model of the quaternary structure of Rho, which is largely based on homology to the F1-ATPase, amino acid 82 is located near the top of the hexamer, and amino acid 325 is located on a solvent-accessible loop in the center of the hexamer. These data are consistent with binding of the rut region of RNA around the crown, with its 3′-segment passing through the center of the Rho hexamer. Escherichia coli transcription termination factor Rho is a ring-shaped hexameric protein that uses the energy derived from ATP hydrolysis to dissociate RNA transcripts from the ternary elongation complex. To test a current model for the interaction of Rho with RNA, three derivatives of Rho were made containing single cysteine residues and modified with a photo-activable cross-linker. The positions for the cysteines were: 1) in part of the primary RNA-binding site in the N terminus (Cys-82 Rho); 2) in a connecting polypeptide proposed to be on the outside of the hexamer (Cys-153 Rho); and 3) near the proposed secondary RNA-binding site in the ATP-binding domain (Cys-325 Rho). Results from the cross-linking of the modified Rho proteins to a series of λ cro RNA derivatives showed that Cys-82 Rho formed cross-links with all transcripts containing the Rho utilization (rut) site, that Cys-325 Rho formed cross-links to transcripts that had therut site and 10 or more residues 3′ of the rut site, and that Cys-153 did not form cross-links with any of the transcripts. From a model of the quaternary structure of Rho, which is largely based on homology to the F1-ATPase, amino acid 82 is located near the top of the hexamer, and amino acid 325 is located on a solvent-accessible loop in the center of the hexamer. These data are consistent with binding of the rut region of RNA around the crown, with its 3′-segment passing through the center of the Rho hexamer. N-[4-(p-azidosalicylamidobutyl]-3′-(2′-pyridyldithio)propionamide 5,5′-dithiobis(2-nitrobenzoate) adenosine 5′-(β,γ-imino)triphosphate Transcription termination factor Rho in Escherichia coli consists of six identical protein subunits arranged in a ring structure (1Oda T. Takanami M. J. Mol. Biol. 1972; 71: 799-802Crossref PubMed Scopus (53) Google Scholar, 2Gogol E.P. Seifried S.E. von Hippel P.H. J. Mol. Biol. 1991; 221: 1127-1138Crossref PubMed Scopus (114) Google Scholar). For its function in termination, Rho binds to the nascent transcript and acts to dissociate the transcript from RNA polymerase and the DNA template (3Roberts J.W. Nature. 1969; 224: 1168-1174Crossref PubMed Scopus (523) Google Scholar, 4Richardson J.P. Greenblatt J.L. Neidhardt F.C. Curtiss III, R. Ingraham J.L. Lin E.C.C. Low K.B. Magasanik B. Reznikoff W.S. Riley M. Schaechter M. Umbarger H.E. Escherichia coli and salmonella: Cellular and Molecular Biology. American Society for Microbiology Press, Washington, DC1996: 822-848Google Scholar). Rho can also act as a helicase to dissociate a DNA molecule that is base paired to a 3′-segment of an RNA with a Rho attachment site (5Brennan C.A. Dombroski A.J. Platt T. Cell. 1987; 48: 945-952Abstract Full Text PDF PubMed Scopus (186) Google Scholar, 6Walstrom K.M. Dozono J.M. von Hippel P.H. Biochemistry. 1997; 36: 7993-8004Crossref PubMed Scopus (47) Google Scholar). The motive power for these actions comes from the hydrolysis of ATP to ADP and Pi. The mechanism for coupling ATP hydrolysis to these dissociation reactions is not known. The Rho polypeptide contains two major domains: an N-terminal RNA-binding domain (residues 1–130) and a C-terminal ATP-binding domain (residues 131–419) (7Bear D.G. Andrews C.L. Singer J.D. Morgan W.D. Grant R.A. von Hippel P.H. Platt T. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 1911-1915Crossref PubMed Scopus (43) Google Scholar, 8Dolan J.W. Marshall N.F. Richardson J.P. J. Biol. Chem. 1990; 265: 5747-5754Abstract Full Text PDF PubMed Google Scholar). The RNA-binding domain contains an oligosaccharide/oligonucleotide-binding domain (OB-fold) (9Allison T.J. Wood T.C. Briercheck D.M. Rastinejad F. Richardson J.P. Rule G.S. Nat. Struct. Biol. 1998; 5: 352-356Crossref PubMed Scopus (67) Google Scholar). Rho forms strong binding interactions with single-stranded C-rich RNA molecules, and RNA segments with these characteristics form the attachment sites (known as the rut or Rho utilization sites) used by Rho to mediate termination of a transcript. The structure of a complex of the RNA-binding domain of Rho with oligo(rC)9, determined by x-ray crystallography, shows that a cytidylate residue forms H bonds with Arg-66 and Glu-78 and a π-bond stacking interaction with Phe-64 (10Bogden C.E. Fass D. Bergman N. Nichols M.D. Berger J.M. Mol. Cell. 1999; 3: 487-493Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). Evidence for a second RNA-binding site distinct from that in the RNA-binding domain has come from a detailed analysis of the polynucleotide requirements for activation of ATP hydrolysis by Rho (11Richardson J.P. J. Biol. Chem. 1982; 257: 5760-5766Abstract Full Text PDF PubMed Google Scholar) and from the finding that mutant forms of Rho with changes in certain residues in the ATP-binding domain are defective in their interactions with RNA that are coupled to ATP hydrolysis (12Richardson J.P. Carey III, J.L. J. Biol. Chem. 1982; 257: 5767-5771Abstract Full Text PDF PubMed Google Scholar, 13Miwa Y. Horiguchi T. Shigesada K. J. Mol. Biol. 1995; 254: 815-837Crossref PubMed Scopus (88) Google Scholar, 14Pereira S. Platt T. J. Mol. Biol. 1995; 251: 30-40Crossref PubMed Scopus (21) Google Scholar). Large parts of the Rho polypeptide are similar to the corresponding parts of the α and β subunits of the F1-ATPase (15Opperman T. Richardson J.P. J. Bacteriol. 1994; 176: 5033-5043Crossref PubMed Google Scholar). In addition, the hexameric Rho protein is morphologically similar to the α3β3 sub-component of that ATPase (1Oda T. Takanami M. J. Mol. Biol. 1972; 71: 799-802Crossref PubMed Scopus (53) Google Scholar, 2Gogol E.P. Seifried S.E. von Hippel P.H. J. Mol. Biol. 1991; 221: 1127-1138Crossref PubMed Scopus (114) Google Scholar,16Abrahams J.P. Leslie A.G. Lutter R. Walker J.E. Nature. 1994; 370: 621-628Crossref PubMed Scopus (2764) Google Scholar). These similarities have led to proposed models of a tertiary structure for the ATP-binding domain of the Rho polypeptide and a quaternary structure of the hexamer, both based on the structure of the bovine mitochondrial F1-ATPase (13Miwa Y. Horiguchi T. Shigesada K. J. Mol. Biol. 1995; 254: 815-837Crossref PubMed Scopus (88) Google Scholar, 16Abrahams J.P. Leslie A.G. Lutter R. Walker J.E. Nature. 1994; 370: 621-628Crossref PubMed Scopus (2764) Google Scholar, 17Wood T.C. Theory and Application of Protein HomologyPh.D. Dissertation. University of Virginia, 1999Google Scholar, 18Yu X. Horiguchi T. Shigesada K. Egelman E.H. J. Mol. Biol. 2000; 299: 1299-1307Crossref Scopus (44) Google Scholar). A striking feature of these models is that mutational changes in Rho that affect secondary RNA-binding site interactions are found primarily in residues that face into the center of the hexameric hole (13Miwa Y. Horiguchi T. Shigesada K. J. Mol. Biol. 1995; 254: 815-837Crossref PubMed Scopus (88) Google Scholar). These observations have led to the proposal of a model for the interactions of Rho with RNA that cause transcript termination (19Richardson J.P. J. Biol. Chem. 1996; 271: 1251-1254Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). In this model, the nascent transcript first binds to an extensive site composed of the RNA-binding domains on the six subunits arranged around one pole of the hexamer. This binding occurs in a way that allows the RNA that is on the 3′-side of the attachment segment to pass through the hole of the hexameric ring, perhaps by assembly of the hexamer on the RNA (20Gan E. Richardson J.P. Biochemistry. 1999; 38: 16882-16888Crossref PubMed Scopus (22) Google Scholar). Once bound, concerted cycles of ATP binding, hydrolysis, and release can cause structural motions in the hole of the hexamer that could act to pull the transcript through and away from its biosynthetic complex with RNA polymerase. Previously, Rho was identified as being related to a subclass of DNA helicases (superfamilies IV and V) (21West S.C. Cell. 1998; 86: 177-180Abstract Full Text Full Text PDF Scopus (120) Google Scholar, 22Bird L.E. Subramanya H.S. Wigley D.B. Curr. Opin. Struct. Biol. 1998; 8: 14-18Crossref PubMed Scopus (147) Google Scholar). All the proteins in this group contain seven common sequence motifs, possess a hexameric quaternary structure, and couple NTP hydrolysis to 5′- to 3′-translocation along a nucleic acid. Biochemical evidence obtained with two members of this subclass, DnaB (23Jezewska M.J. Rajendran S. Bujalowska D. Bujalowski W. J. Biol. Chem. 1998; 273: 10515-10529Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar) and the T7 gene 4 product (24Egelman H.H., Yu, X. Wild R. Hingorani M.M. Patel S.S. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3869-3873Crossref PubMed Scopus (252) Google Scholar), indicate that they migrate along single-stranded DNA by pulling the DNA through the center of their respective hexameric ring structures. Because Rho is structurally related to these proteins, it could readily have a similar mechanism for nucleic acid translocation. To probe the points of interaction of Rho with RNA, several mutational derivatives of Rho-containing single cysteine residues were prepared. The positions of the cysteines were chosen based on the known structure of the RNA-binding domain and the proposed structural model of the hexameric ATP-binding domains of Rho (17Wood T.C. Theory and Application of Protein HomologyPh.D. Dissertation. University of Virginia, 1999Google Scholar). The mutants were then modified with the cysteine-specific, photo-activable cross-linkerN-[4-(p-azidosalicylamidobutyl]-3′-(2′-pyridyldithio)propionamide (APDP),1 and the interactions of these modified proteins with various forms of λ cro RNA was analyzed by measuring yields of cross-linked complexes. All restriction enzymes, T4 DNA ligase, T4 RNA ligase, T4 polynucleotide kinase, and T4 DNA polymerase were purchased from New England BioLabs Inc. APDP and 5,5′-dithiobis(2-nitrobenzoate) (DTNB) were purchased from Pierce Chemicals. The oligonucleotides were purchased from either Life Technologies, Inc. or Integrated DNA Technologies. All deoxyribonucleotides, ribonucleotides, and Proteinase K were purchased from Roche Molecular Biochemicals. Radioactive nucleotides were purchased from ICN Radiochemicals. Bio-Rex 70 resin was purchased from Bio-Rad. T7 RNA polymerase was provided by Lislott Richardson (Indiana University). MGP1-2 helper phage was a gift from Stanley Tabor (Havard University Medical School). The p39-AS plasmid containing the C202S mutation was a gift from Terry Platt (University of Rochester). pA4 and pB3 were gifts from Bill Scott (University of California, Santa Cruz). pCB111, a plasmid containing the E. coli rho gene under control of the T7 promoter (25Richardson L.V. Richardson J.P. Gene. 1992; 118: 103-107Crossref PubMed Scopus (12) Google Scholar), and a p39-AS derivative, containing the E155K and C202S mutations in the rho gene (26Dombroski A.J. Platt T. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 2538-2542Crossref PubMed Scopus (73) Google Scholar), were partially digested with Pst I. The resulting 5926-base pair fragment from pCB111 and the 567-base pair fragment from the p39-AS derivative were ligated overnight at 17 °C with T4 DNA ligase. The resulting plasmid, pBB-1, contains rho with a C202S mutation. This and all subsequent mutations were confirmed by sequence analysis. To create a plasmid that can be used to express C202S,S325C Rho (Cys-325 Rho), pBB-1 was transformed into competent CJ236 (dut −, ung −) cells, and these cells were infected with helper phage M13KO7. The uracil-containing single-stranded DNA template was recovered by polyethylene glycol precipitation followed by phenol/chloroform (1:1) extraction, ethanol precipitation, and resuspension in water. The mutagenic primer (3′-CGATACCGGTTGTAAAATGGACG-5′) was annealed to the purified uracil-containing single-stranded DNA, followed by addition of 1 unit of T4 DNA polymerase, 3 units of T4 DNA ligase, 0.4 mm each of dGTP, dCTP, dATP, and dTTP, and 0.75 mm ATP, which completed synthesis of the second strand. The newly synthesized DNA was transformed into the dut+ , ung + strain DH5αF′, and the cells were plated on LB-ampicillin (50 mg/ml) plates and grown overnight at 37 °C. Plasmid DNA was isolated from several of the plate colonies via standard plasmid mini-prep procedure. A 341-base pair Bst XI to Kpn I restriction fragment from a plasmid with the desired mutation was ligated to the 6152-base pair Bst XI to Kpn I restriction fragment from the parental pBB-1 plasmid. The resulting plasmid, pBB-2, contained therho gene with both the C202S and S325C mutations. Plasmids that could express C202S,S82C Rho (Cys-82 Rho) and C202S,S153C Rho (Cys-153 Rho), respectively, were created using the Stratagene QuikChange mutagenesis kit. Two complementary DNA oligonucleotides containing the required nucleotide changes were used to introduce the respective mutations into the pBB-1 rho gene which contains the C202S mutation as follows: primer 1, 5′-GATGACATCTACGTTTGCCCTAGCCAAATCCG-3′, and primer 2, 5′-CGGATTTGGCTAGGGCAAACGTAGATGTCATC-3′ for the S82C mutation; primer 3, 5′-CGTGGTAACGGTTGTACTGAAGATTTAACTGCTCGC-3′, and primer 4, 5′-GCGAGCAGTTAAATCTTCAGTACAACCGTTACCACG-3′ for the S153C mutation. The plasmids containing Cys-82 Rho and Cys-153 Rho were named pBB-4 and pBB-6, respectively. DH5αF′ cells containing one of the mutant plasmidrho genes were infected with the M13 phage derivative mGP1-2 (27Tabor S. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 4767-4771Crossref PubMed Scopus (1687) Google Scholar). mGP1-2 contains a gene encoding T7 RNA polymerase under control of the E. coli lac promotor. Production of high levels of mutant Rho protein was achieved by induction of a 500-ml LB culture at an A 600 nm = 0.6 with 1.0 mmisopropylthiogalactoside and mGP1-2 (multiplicity of infection of 20–30). The culture was grown at 37 °C for 3 h after induction. The cells were harvested by centrifugation at 7000 rpm for 20 min in a Sorvall RC2-B centrifuge (GS3 rotor). The cells were washed with ice-cold STE (10 mm Tris·HCl, pH 8.0, 0.5 mm EDTA, pH 8.0, and 100 mm NaCl), pelleted as above, and stored at −20 °C. The mutant Rho proteins were purified as described by Nowatzke et al. (28Nowatzke W. Richardson L. Richardson J.P. Methods Enzymol. 1996; 274: 353-363Crossref PubMed Scopus (27) Google Scholar), with one modification. The purification of the protein was stopped after the Bio-Rex 70 column. Analysis of Coomassie Blue-stained SDS-polyacrylamide gels indicated that the protein(s) were greater than 95% pure. Proteins were kept in Rho storage buffer (10 mm Tris·HCl, pH 8.0, 0.1 m EDTA, pH 8.0, 0.1 mm dithiothreitol, 0.1 m KCl, and 50% glycerol) and stored at −20 °C. Protein concentrations were determined by the Bradford assay (29Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (217544) Google Scholar). The modification reactions were done using 1:1 molar mixtures of the Cys-0 Rho to Cys-82 Rho, Cys-153 Rho, and the Cys-325 Rho mutant Rho polypeptides. A 100-μl reaction containing 17 μm (monomer) of both the Cys-0 Rho and one of the mutant Rho polypeptides were mixed in TGES buffer (50 mm Tris·HCl, pH 8.0, 5% glycerol, 1 mm EDTA, and 50 mm KCl) and allowed to equilibrated on ice for 30 min. This 30-min incubation allows for formation of mixed hexamers (30Richardson J.P. Ruteshouser E.C. J. Mol. Biol. 1986; 189: 413-419Crossref PubMed Scopus (33) Google Scholar). The mixed hexamer solutions were then spun through a 1-ml Sephadex G-50 spin column equilibrated in TGES buffer to remove residual dithiothreitol. The eluate from the G-50 column was then mixed with 10 μl of a 50 mm APDP solution in 100% dimethyl sulfoxide and incubated at 22 °C for 3 h in the dark. The unreacted APDP was removed by centrifugation of the solution through a 1-ml Sephadex G-50 spin column. The protein concentration was determined by Bradford assay. The modified protein was stored at −80 °C and was active for up to a month. Reaction of free sulfhydryl groups with 5,5′-dithiobis(2-nitrobenzoate) (DTNB) results in the release of the 2-nitro-5-thiobenzoate anion, which can be detected by its characteristic absorbance at 412 nm (molar absorptivity of 13,600 m−1 cm−1) (31Habeeb A.F.S.A. Methods Enzymol. 1972; 25: 457-464Crossref PubMed Scopus (878) Google Scholar). The various proteins were modified with APDP as above, with the exception that no Cys-0 Rho protein was added to the cysteine-containing mutants. The reactions were done in a total volume of 105 μl. Protein solutions containing at least 25 μg of cysteine-containing residues (final Cys residue concentration of 3.5 μm or higher) in a volume ≤ 40 μl was filled to 50 μl with TGES buffer. 50 μl of detection buffer (0.1 m sodium phosphate, 1.34 mm EDTA, and 6 m guanidine hydrochloride, pH 8.0) and 5.0 μl of freshly prepared DTNB buffer (10.1 mmDTNB, and 0.1 m sodium phosphate, pH 8.0) were added and mixed. The solution was incubated at 22 °C for 25 min. After 25 min, the absorbance of the solution was measured at 412 nm, and the concentration of free sulfhydryl was determined using the Beer-Lambert law. For values in Table III (see below), the assay was performed as described previously by Nowatzke and Richardson (32Nowatzke W.L. Richardson J.P. J. Biol. Chem. 1996; 271: 742-747Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar) with the modification that 20 ng of Rho protein was used per 100-μl reaction. For values in Table IV (see below), the ATPase reaction buffer was TGES buffer, 2 mm MgCl2, 1 mm ATP, 3.6 nm wild type Rho hexamer, and 10 nm RNA (100-μl reaction volume). This buffer was chosen to more closely resemble the buffer conditions of the cross-linking experiments. The concentration of ATP used for these assays was one-fifth the concentration used in the cross-linking studies due to the high background in the colorimetric assay when using 5 mm ATP, thus the MgCl2 concentration was adjusted to one-fifth (2 mm) the amount used in the cross-linking studies.Table IIIEffects of poly(A) and poly(C) on the crosslinking of cro(1–380) to APDP-modified Cys-82 and Cys-325 RhosAPDP-modified RhoCompetitorNonePoly(A)Poly(C)% cro(1–380) cross-linkedCys-821.83 ± 1.500.60 ± 0.030.15 ± 0.11Cys-3251.03 ± 0.390.79 ± 0.290.14 ± 0.11Polynucleotide concentrations were 0.1 μg/μl. Open table in a new tab Table IVPercentage cross-linking of APDP-modified Cys-82 and Cys-325 Rho to the various λ cro derivative RNAsRNACys-82 RhoCys-325 RhoCys-325/Cys-82 + ATPATPase activity− ATP+ ATP− ATP+ ATP% RNA cross-linkedrationmol min−1 μg−1cro(1–380)1.83 ± 1.503.45 ± 1.881.03 ± 0.390.73 ± 0.140.219.1 ± 0.4cro(1–276)0.35 ± 0.122.98 ± 1.130.16 ± 0.020.26 ± 0.090.092.8 ± 0.4cro(1–86)<0.02<0.02<0.02<0.02<0.2cro(216–365)0.99 ± 0.444.62 ± 0.922.84 ± 0.692.91 ± 0.440.636.5 ± 0.8cro(216–347)0.76 ± 0.542.48 ± 0.280.75 ± 0.160.62 ± 0.070.25ND4-aND, not determined.cro(216–313)0.48 ± 0.371.28 ± 0.790.20 ± 0.050.21 ± 0.070.160.2 ± 0.1cro(216–288)0.24 ± 0.140.71 ± 0.450.23 ± 0.040.18 ± 0.070.25<0.2cro(216–276)0.57 ± 0.541.38 ± 1.230.04 ± 0.040.06 ± 0.060.050.7 ± 0.14-a ND, not determined. Open table in a new tab Polynucleotide concentrations were 0.1 μg/μl. Plasmid pIF2 was described by Faus and Richardson (33Faus I. Richardson J.P. Biochemistry. 1989; 28: 3510-3517Crossref PubMed Scopus (44) Google Scholar), and pB3 was described by Gan and Richardson (20Gan E. Richardson J.P. Biochemistry. 1999; 38: 16882-16888Crossref PubMed Scopus (22) Google Scholar). Plasmid pA4, constructed by Dr. William Scott, contained DNA base pairs 210–362 of the λ cro gene flanked by sequences encoding hammerhead ribozymes between theXba I and Hin DIII restriction sites in pUC18. The sequence of the A4 insert (underlined) and the flanking hammerheads is as follows: 5′-CTAGAATGCTACTGATGAGGTTCGCCGAAACGTTCGCGTCTAGCATAAATAACCCCGCTCTTACACATTCCAGCCCTGAAAAAGGGCATCAAATTAAACCACACCTATGGTGTATGCATTTATTTGCATACATTCAATCAATTGTTATCTAAGGAAATACTTACATATGGTTCGTGCAAACAAACGCAACGTCTACCGAAAGGTACTGATGAGGTTCGCCGAAACGTTGCGTTA-3′. The plasmid pA4 was maintained in E. coli DH5αF′. DNA templates were prepared for T7 transcription by linearization of the plasmid with a restriction enzyme as indicated. After digestion with the appropriate restriction enzyme, 25 μg of Proteinase K and 0.2 volume of 5× Proteinase K buffer (50 mm Tris-HCl, pH 7.8, 25 mm EDTA, and 5% SDS) were added and incubated for 90 min at 37 °C. The reaction mixture was then treated with an equal volume of phenol, then treated with an equal volume of chloroform:iso-amyl alcohol (24:1), and ethanol-precipitated. The DNA was washed with 70% ethanol, dried, and resuspended in water. The DNA concentration was determined by absorbance at 260 nm. T7 transcription was carried out in a 100-μl mixture containing 5 pmol of linearized DNA, 40 mm Tris-HCl, pH 8.1, 30 mm MgCl2, 2 mm spermidine, 4 mm each of ATP, CTP, GTP, and UTP, 0.02 n NaOH, and 8 μg of T7 RNA polymerase. The reaction mixture was incubated at 37 °C for 2 h. The RNA was precipitated by addition of 0.1 volume of 8 m LiCl and 3 volumes of 100% ethanol, followed by 30 min at −80 °C. The RNA was pelleted by centrifugation at 13,000 rpm for 30 min at 4 °C, washed with 150 μl of 70% ethanol, and recentrifuged. The pellet was dried and subsequently resuspended in 20 μl of formamide loading dye (98% formamide, 2 mmEDTA, 0.03% (w/v) bromphenol blue, and 0.03% (w/v) xylene cyanol). The resuspended RNA was loaded onto a 6%/7m urea polyacrylamide gel (acrylamide:bis, 19:1) containing 1× TBE buffer (45 mm Tris borate, and 1 mmEDTA) and run in 1× TBE buffer at 30 watts. The RNA was detected by UV shadowing, excised using a sterile razor blade, and placed into a 1.5-ml Eppendorf tube containing 200 μl of phenol, 200 μl of chloroform:iso-amyl alcohol (24:1), and 250 μl of passive elution buffer (50 mm Tris-HCl, pH 8.0, 0.3 m sodium acetate, and 1 mm EDTA). The gel slice was incubated for 10–12 h at 4 °C. The RNA was recovered by removing the aqueous layer, performing two chloroform extractions, followed by ethanol precipitation and 70% ethanol wash. The dried pellet was resuspended in 25 μl of TE buffer (10 mm Tris-HCl, pH 8.0, and 1 mm EDTA), and stored at −80 °C. The concentration of the RNA was determined by its absorbance at 260 nm. To label the 5′-end of the T7 transcripts from the linearized pB3 and pA4 plasmids, which have a free 5′-hydroxyl as a result of cleavage with the 5′-hammerhead, 1 μm RNA was mixed with 10 units of T4 polynucleotide kinase and 2.8 μm[γ-32P]ATP (7000 Ci/mmol) in 50 μl of PNK buffer (70 mm Tris-HCl, pH 7.6, 10 mm MgCl2, and 5 mm dithiothreitol), and the mixture was incubated at 37 °C for 90 min. The RNA was precipitated with ethanol, washed, and resuspended in 20 μl of formamide loading dye. The RNA was loaded onto a 6%/7 m urea polyacrylamide gel and run at 30 watts in 1× TBE buffer. The RNA was isolated as above. All RNAs were stored in TE buffer at −80 °C (see Fig. 1). Taq I and Bgl II pIF2 T7 transcripts were 3′-end-labeled using [5′-32P]cytidine-3′,5′-bisphosphate, which was prepared by mixing 50 pmol of 3′-CMP, 10 units of T4 polynucleotide kinase, and 5 μm[γ-32P]ATP (7000 Ci/mmol) in 50 μl of T4 PNK buffer. The reaction was incubated at 37 °C for 90 min. T4 polynucleotide kinase was inactivated by boiling the reaction solution for 1 min at 95 °C. This solution was stored at −20 °C. To 3′-end label the RNA, 1 μm RNA, 50 μm ATP, 12 units of T4 RNA ligase, and 2 μm[5′-32P]cytidine-3′,5′-bisphosphate were incubated at 4 °C for 10–12 h in 20 μl of 50 mm HEPES (pH 7.5), 10% (v/v) dimethyl sulfoxide, 20 mm MgCl2, 3 mm dithiothreitol, 0.5 ng/μl acetylated bovine serum albumin. The reaction mixture was mixed with 10 μl of formamide loading dye then loaded and run at 30 watts on a 6%/7 murea polyacrylamide gel in 1× TBE buffer. The RNA was located by UV shadowing and purified as above). The APDP-modified Rho proteins were diluted to 10 ng/μl in Rho dilution buffer (40 mmTris-HCl, pH 7.6, 0.1% acetylated bovine serum albumin, 50 mm KCl, 5 mm MgCl2, 0.1% Nonidet P-40). The cross-linking reactions, prepared under subdued light, contained 20 ng of modified Rho, 10 nm32P-labeled RNA, and 5 mm adenine nucleotide (if present) in 20 μl of TGES buffer with 10 mmMgCl2 and were incubated for 2 min at 22 °C. The samples were then placed onto a piece of Parafilm, directly under a mid-range UV 302-nm lamp (Model UVM-57, UVP Products). A polystyrene filter was placed over the samples during irradiation; this helped to filter out shorter wavelength UV light, which can induce nonspecific protein-nucleic acid cross-linking. The samples were irradiated for 2 min at 4 °C. The samples were then mixed with 0.2 volume of SDS loading dye (150 mm Tris-HCl, pH 6.8, 4% SDS, 0.2% bromphenol blue, and 20% glycerol), and run on a 10% SDS-polyacrylamide gel (acrylamide:bis, 29:1) at 25 mA in Tris-glycine buffer (25 mm Tris, 250 mm glycine, and 0.1% SDS) (34Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). Rho-RNA cross-linked species were detected by using a 20- × 25-cm Storage Phosphor Screen and PhosphorImager (Molecular Dynamics). The computer program ImageQuaNT (Molecular Dynamics) was used to quantify the cross-linked products. Coordinates for the N-terminal 125 amino acids of Rho were downloaded from the Brookhaven Protein Data Bank, accession code 1A62 (9Allison T.J. Wood T.C. Briercheck D.M. Rastinejad F. Richardson J.P. Rule G.S. Nat. Struct. Biol. 1998; 5: 352-356Crossref PubMed Scopus (67) Google Scholar). The coordinates for the C-terminal region (amino acids 126–419) of Rho were downloaded from the web site of the Department of Biotechnology, University of Virginia (17Wood T.C. Theory and Application of Protein HomologyPh.D. Dissertation. University of Virginia, 1999Google Scholar). Modeling of the Rho monomer was performed using the InsightII visualizer software obtained from Molecular Simulations, Inc. Variants of Rho protein containing single cysteine residues at different positions were created by site-directed mutagenesis. Wild-type Rho contains a single cysteine at position 202. Dombroski and Platt (26Dombroski A.J. Platt T. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 2538-2542Crossref PubMed Scopus (73) Google Scholar) showed that it could be changed to a serine or an alanine without affecting the function of Rho. Starting with a rho gene containing the C202S mutation, derivatives with single cysteines at other positions were made. The positions were chosen based on the proposed quaternary structure of E. coli Rho (Fig.2) (17Wood T.C. Theory and Application of Protein HomologyPh.D. Dissertation. University of Virginia, 1999Google Scholar). All the residues changed were predicted to be solvent-exposed serines. The changes were thus expected to have minimal perturbation of wild-type function and allow for a high potential for modification with a cysteine-reactive cross-linking moiety. Position 325 is in a section called the R loop and is believed to be near a proposed secondary RNA-binding site located in the center of the Rho hexamer (13Miwa Y. Horiguchi T. Shigesada K. J. Mol. Biol. 1995; 254: 815-837Crossref PubMed Scopus (88) Google Scholar). Position 82 is in close proximity to the RNA-binding cleft in the RNA-binding domain (9Allison T.J. Wood T.C. Briercheck D.M. Rastinejad F. Richardson J.P. Rule G.S. Nat. Struct. Biol. 1998; 5: 352-356Crossref PubMed Scopus (67) Google Scholar, 10Bogden C.E. Fass D. Bergman N. Nichols M.D. Berger J.M. Mol. Cell. 1999; 3: 487-493Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar), and position 153 is a residue on a large loop on the outside of the hexamer (17Wood T.C. Theory and Application of Protein HomologyPh.D. Dissertation. University of Virginia, 1999Google Scholar). The mutant proteins were purified and tested for retention of normal function by measuring their ATPase activity with λ cro mRNA. Mutant Rhos that are defective in transcript termination have very reduced ATPase activity with this natural Rho-terminated transcript (35Martinez A. Burns C.M. Richardson J.P. J. Mol. Biol. 1996; 257: 909-918Crossref PubMed Scopus (32) Google Scholar). The results (Table I) show that the specific activities of the pure Cys-8
Referência(s)