Comprehensive Analysis of Expression and Function of 51 Sarco(endo)plasmic Reticulum Ca2+-ATPase Mutants Associated with Darier Disease
2006; Elsevier BV; Volume: 281; Issue: 32 Linguagem: Inglês
10.1074/jbc.m601966200
ISSN1083-351X
AutoresYuki Miyauchi, Takashi Daiho, Kazuo Yamasaki, Hidetoshi Takahashi, Akemi Ishida‐Yamamoto, Stefánia Dankó, Hiroshi Suzuki, Hajime Iizuka,
Tópico(s)Hedgehog Signaling Pathway Studies
ResumoWe examined possible defects of sarco(endo)plasmic reticulum Ca2+-ATPase 2b (SERCA2b) associated with its 51 mutations found in Darier disease (DD) pedigrees, i.e. most of the substitution and deletion mutations of residues reported so far. COS-1 cells were transfected with each of the mutant cDNAs, and the expression and function of the SERCA2b protein was analyzed with microsomes prepared from the cells and compared with those of the wild type. Fifteen mutants showed markedly reduced expression. Among the other 36, 29 mutants exhibited completely abolished or strongly inhibited Ca2+-ATPase activity, whereas the other seven possessed fairly high or normal ATPase activity. In four of the aforementioned seven mutants, Ca2+ transport activity was significantly reduced or almost completely lost, therefore uncoupled from ATP hydrolysis. The other three were exceptional cases as they were seemingly normal in protein expression and Ca2+ transport function, but were found to have abnormalities in the kinetic properties altered by the three mutations, which happened to be in the three DD pedigrees found by us previously (Sato, K., Yamasaki, K., Daiho, T., Miyauchi, Y., Takahashi, H., Ishida-Yamamoto, A., Nakamura, S., Iizuka, H., and Suzuki, H. (2004) J. Biol. Chem. 279, 35595-35603). Collectively, our results indicated that in most cases (48 of 51) DD mutations cause severe disruption of Ca2+ homeostasis by the defects in protein expression and/or transport function and hence DD, but even a slight disturbance of the homeostasis will result in the disease. Our results also provided further insight into the structure-function relationship of SERCAs and revealed critical regions and residues of the enzyme. We examined possible defects of sarco(endo)plasmic reticulum Ca2+-ATPase 2b (SERCA2b) associated with its 51 mutations found in Darier disease (DD) pedigrees, i.e. most of the substitution and deletion mutations of residues reported so far. COS-1 cells were transfected with each of the mutant cDNAs, and the expression and function of the SERCA2b protein was analyzed with microsomes prepared from the cells and compared with those of the wild type. Fifteen mutants showed markedly reduced expression. Among the other 36, 29 mutants exhibited completely abolished or strongly inhibited Ca2+-ATPase activity, whereas the other seven possessed fairly high or normal ATPase activity. In four of the aforementioned seven mutants, Ca2+ transport activity was significantly reduced or almost completely lost, therefore uncoupled from ATP hydrolysis. The other three were exceptional cases as they were seemingly normal in protein expression and Ca2+ transport function, but were found to have abnormalities in the kinetic properties altered by the three mutations, which happened to be in the three DD pedigrees found by us previously (Sato, K., Yamasaki, K., Daiho, T., Miyauchi, Y., Takahashi, H., Ishida-Yamamoto, A., Nakamura, S., Iizuka, H., and Suzuki, H. (2004) J. Biol. Chem. 279, 35595-35603). Collectively, our results indicated that in most cases (48 of 51) DD mutations cause severe disruption of Ca2+ homeostasis by the defects in protein expression and/or transport function and hence DD, but even a slight disturbance of the homeostasis will result in the disease. Our results also provided further insight into the structure-function relationship of SERCAs and revealed critical regions and residues of the enzyme. Sarco(endo)plasmic reticulum Ca2+-ATPases (SERCAs) 2The abbreviations used are: SERCA, sarco(endo)plasmic reticulum Ca2+-ATPase; SR, sarcoplasmic reticulum; EP, phosphoenzyme; E1P, ADP-sensitive phosphoenzyme; E2P, ADP-insensitive phosphoenzyme; DD, Darier disease; MOPS, 3-(N-morpholino)propanesulfonic acid; AMPPCP, adenosine 5′-(β,γ-methylene)triphosphate. catalyze Ca2+ transport coupled with ATP hydrolysis (Fig. 1) and play an essential role in maintaining Ca2+ homeostasis in the cytoplasm and endoplasmic reticulum lumen of cells (1Hasselbach W. Makinose M. Biochem. Z. 1961; 333: 518-528PubMed Google Scholar, 2Ebashi S. Lipmann F. J. Cell Biol. 1962; 14: 389-400Crossref PubMed Scopus (360) Google Scholar, 3Inesi G. Sumbilla C. Kirtley M.E. Physiol. Rev. 1990; 70: 749-776Crossref PubMed Scopus (152) Google Scholar, 4Møller J.V. Juul B. le Maire M. Biochim. Biophys. Acta. 1996; 1286: 1-51Crossref PubMed Scopus (660) Google Scholar, 5MacLennan D.H. Rice W.J. Green N.M. J. Biol. Chem. 1997; 272: 28815-28818Abstract Full Text Full Text PDF PubMed Scopus (439) Google Scholar, 6McIntosh D.B. Adv. Mol. Cell Biol. 1998; 23A: 33-99Google Scholar, 7Toyoshima C. Inesi G. Annu. Rev. Biochem. 2004; 73: 268-292Crossref Scopus (299) Google Scholar). SERCAs have three cytoplasmic domains: phosphorylation (P), nucleotide binding (N), and actuator (A) and 10 transmembrane helices (M1-M10 or 11 in the SERCA2b isoform, M11). In the Ca2+ transport cycle, the ATPase is activated by the binding of two Ca2+ ions from the cytoplasm to the transport sites composed of M4, M5, M6, and M8 (E2 → E1Ca2, step 1). Asp351 in the P domain is then phosphorylated with MgATP to form the phosphorylated intermediate (EP) (step 2). During dephosphorylation of EP, the Ca2+ ions are released into the lumen. In the detailed mechanism, the dephosphorylation process includes the conformational transition of EP associated with Ca2+ release (step 3) and the subsequent hydrolysis of the acylphosphate bond (step 4). The three human SERCA genes encode SERCA isoforms (8Lytton J. MacLennan D.H. J. Biol. Chem. 1988; 263: 15024-15031Abstract Full Text PDF PubMed Google Scholar, 9Zhang Y. Fujii J. Phillips M.S. Chen H.S. Karpati G. Yee W.C. Schrank B. Cornblath D.R. Boylan K.B. MacLennan D.H. Genomics. 1995; 30: 415-424Crossref PubMed Scopus (64) Google Scholar, 10Dode L. De Greef C. Mountian I. Attard M. Town M.M. Casteels R. Wuytack F. J. Biol. Chem. 1998; 273: 13982-13994Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). Mutations in the SERCA2 gene (ATP2A2) and the resulting defects in the SERCA2b housekeeping isoform cause an autosomal dominant genetic skin disease, Darier disease (DD) (11Sakuntabhai A. Ruiz-Perez V. Carter S. Jacobsen N. Burge S. Monk S. Smith M. Munro C.S. O'Donovan M. Craddock N. Kucherlapati R. Rees J.L. Owen M. Lathrop G.M. Monaco A.P. Strachan T. Hovnanian A. Nat. Genet. 1999; 21: 271-276Crossref PubMed Scopus (624) Google Scholar, 12Ruiz-Perez V.L. Carter S.A. Healy E. Todd C. Rees J.L. Steijlen P.M. Carmichael A.J. Lewis H.M. Hohl D. Itin P. Vahlquist A. Gobello T. Mazzanti C. Reggazini R. Nagy G. Munro C.S. Strachan T. Hum. Mol. Genet. 1999; 8: 1621-1630Crossref PubMed Scopus (143) Google Scholar). Over 100 mutations have been found with the DD pedigrees (11Sakuntabhai A. Ruiz-Perez V. Carter S. Jacobsen N. Burge S. Monk S. Smith M. Munro C.S. O'Donovan M. Craddock N. Kucherlapati R. Rees J.L. Owen M. Lathrop G.M. Monaco A.P. Strachan T. Hovnanian A. Nat. Genet. 1999; 21: 271-276Crossref PubMed Scopus (624) Google Scholar, 12Ruiz-Perez V.L. Carter S.A. Healy E. Todd C. Rees J.L. Steijlen P.M. Carmichael A.J. Lewis H.M. Hohl D. Itin P. Vahlquist A. Gobello T. Mazzanti C. Reggazini R. Nagy G. Munro C.S. Strachan T. Hum. Mol. Genet. 1999; 8: 1621-1630Crossref PubMed Scopus (143) Google Scholar, 13Sakuntabhai A. Burge S. Monk S. Hovnanian A. Hum. Mol. Genet. 1999; 8: 1611-1619Crossref PubMed Scopus (146) Google Scholar, 14Jacobsen N.J.O. Lyons I. Hoogendoorn B. Burge S. Kwok P.-Y. O'Donovan M.C. Craddock N. Owen M.J. Hum. Mol. Genet. 1999; 8: 1631-1636Crossref PubMed Scopus (125) Google Scholar, 15Sakuntabhai A. Dhitavat J. Burge S. Hovnanian A. J. Investig. Dermatol. 2000; 115: 1144-1147Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar, 16Takahashi H. Atsuta Y. Sato K. Ishida-Yamamoto A. Suzuki H. Iizuka H. J. Dermatol. Sci. 2001; 26: 169-172Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar, 17Yang Y. Li G. Bu D. Zhu X. J. Investig. Dermatol. 2001; 116: 482-483Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 18Ringpfeil F. Raus A. DiGiovanna J.J. Korge B. Harth W. Mazzanti C. Uitto J. Bale S.J. Richard G. Exp. Dermatol. 2001; 10: 19-27Crossref PubMed Scopus (88) Google Scholar, 19Chao S.-C. Yang M.-H. Lee J.Y.-Y. Br. J. Dermatol. 2002; 146: 958-963Crossref PubMed Scopus (22) Google Scholar, 20Ikeda S. Mayuzumi N. Shigihara T. Epstein Jr., E.H. Goldsmith L.A. Ogawa H. J. Investig. Dermatol. 2003; 121: 475-477Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar, 21Dhitavat J. Dode L. Leslie N. Sakuntabhai A. Lorette G. Hovnanian A. J. Investig. Dermatol. 2003; 121: 486-489Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 22Wada T. Shirakata Y. Takahashi H. Murakami S. Iizuka H. Suzuki H. Hashimoto K. Br. J. Dermatol. 2003; 149: 185-188Crossref PubMed Scopus (50) Google Scholar, 23Dode L. Andersen J.P. Leslie N. Dhitavat J. Vilsen B. Hovnanian A. J. Biol. Chem. 2003; 278: 47877-47889Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 24Onozuka T. Sawamura D. Yokota K. Shimizu H. Br. J. Dermatol. 2004; 150: 652-657Crossref PubMed Scopus (35) Google Scholar). They include many nonsense mutations, and also substitution and deletion mutations of amino acid residues. The mutations are located throughout the SERCA2b molecule and show no "hot spots" on the primary sequence. To understand how each of the substitution and deletion mutations affects SERCA2b protein, a limited number of mutations had been explored (9 by Ahn et al. (25Ahn W. Lee M.G. Kim K.H. Muallem S. J. Biol. Chem. 2003; 278: 20795-20801Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar), 10 by Dode et al. (23Dode L. Andersen J.P. Leslie N. Dhitavat J. Vilsen B. Hovnanian A. J. Biol. Chem. 2003; 278: 47877-47889Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar), 3 by Sato et al. (26Sato K. Yamasaki K. Daiho T. Miyauchi Y. Takahashi H. Ishida-Yamamoto A. Nakamura S. Iizuka H. Suzuki H. J. Biol. Chem. 2004; 279: 35595-35603Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar) (a total of 20 because of overlap in Refs. 23Dode L. Andersen J.P. Leslie N. Dhitavat J. Vilsen B. Hovnanian A. J. Biol. Chem. 2003; 278: 47877-47889Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar and 25Ahn W. Lee M.G. Kim K.H. Muallem S. J. Biol. Chem. 2003; 278: 20795-20801Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar)). To provide a comprehensive insight into the molecular basis of DD, as well as to understand the basis for each case of the DD pedigrees, it is necessary to analyze further the many unexplored substitution and deletion mutations. We therefore carried out in this study a comprehensive analysis of the expression and function of most of the DD causing substitution and deletion mutations reported, i.e. the 51 mutations shown in Fig. 2. Our results showed that most of the mutations (48 of the 51) cause severe defects in protein expression and/or Ca2+ transport function. The loss of the transport function was ascribed to markedly reduced ATP hydrolysis or uncoupling from ATP hydrolysis. The remaining three mutations were exceptional in that they exhibited seemingly normal protein expression and Ca2+ transport function but with altered kinetic properties. Results therefore indicated diverse molecular defects as the cause of DD in the 51 pedigrees. On the basis of the atomic structures of SERCA1a, our results also provided further insight into the structure-function relationship of SERCAs.FIGURE 2Locations of DD mutations examined in this study on the secondary structure model of SERCA2b (a) and on the atomic structure of SERCA1a (b). a, the residues with the 51 DD mutations examined in this study are indicated by red circles (substitutions) and dotted red circles (deletions) on the secondary structure model of SERCA2b depicted on the basis of the SERCA1a model, the sequence of human SERCA2b, and its hydropathy profile (5MacLennan D.H. Rice W.J. Green N.M. J. Biol. Chem. 1997; 272: 28815-28818Abstract Full Text Full Text PDF PubMed Scopus (439) Google Scholar, 8Lytton J. MacLennan D.H. J. Biol. Chem. 1988; 263: 15024-15031Abstract Full Text PDF PubMed Google Scholar). Asp351, autophosphorylation site. Blue circles, the side chain oxygen atoms of Glu309 (M4), Asn767, Glu770 (M5), Asn795, Thr798, Asp799 (M6), and Glu907 (M8) (in the numbering of SERCA2b) contribute as the Ca2+ ligands in the high affinity Ca2+-binding sites. The residue Gly509 in SERCA1a is absent in SERCA2b, therefore the numbering of residues after this position in SERCA2b is lower by one than in SERCA1a. SERCA2b possesses the 11th transmembrane helix (M11) in its long extra C terminus region, i.e. 1040 residues in SERCA2b versus 994 residues in SERCA1a (8Lytton J. MacLennan D.H. J. Biol. Chem. 1988; 263: 15024-15031Abstract Full Text PDF PubMed Google Scholar, 11Sakuntabhai A. Ruiz-Perez V. Carter S. Jacobsen N. Burge S. Monk S. Smith M. Munro C.S. O'Donovan M. Craddock N. Kucherlapati R. Rees J.L. Owen M. Lathrop G.M. Monaco A.P. Strachan T. Hovnanian A. Nat. Genet. 1999; 21: 271-276Crossref PubMed Scopus (624) Google Scholar, 64MacLennan D.H. Brandl C.J. Korczak B. Green N.M. Nature. 1985; 316: 696-700Crossref PubMed Scopus (805) Google Scholar, 65Brandl C.J. Green N.M. Korczak B. MacLennan D.H. Cell. 1986; 44: 597-607Abstract Full Text PDF PubMed Scopus (593) Google Scholar, 66Campbell A.M. Kessler P.D. Fambrough D.M. J. Biol. Chem. 1992; 267: 9321-9325Abstract Full Text PDF PubMed Google Scholar). The amino acid sequence of SERCA2b is otherwise highly homologous to that of SERCA1a; actually the residues with the 51 DD mutations examined here and the residues described under "Discussion" and in the supplemental discussion in relation to these DD mutations for the structure/function relationship are all conserved in SERCA1a and 2b. b, residues with the DD mutations examined are shown with the main chain α-carbons (blue, green, and red) on the atomic structure E1Ca2 of SERCA1a (PDB accession code 1SU4 (39Toyoshima C. Mizutani T. Nature. 2004; 430: 529-535Crossref PubMed Scopus (384) Google Scholar, 44Toyoshima C. Nakasako M. Nomura H. Ogawa H. Nature. 2000; 405: 647-655Crossref PubMed Scopus (1619) Google Scholar, 53Toyoshima C. Nomura H. Tsuda T. Nature. 2004; 432: 361-368Crossref PubMed Scopus (382) Google Scholar, 63Toyoshima C. Nomura H. Nature. 2002; 418: 605-611Crossref PubMed Scopus (809) Google Scholar). The colors of the α-carbons indicate the DD mutants with largely reduced protein expression (blue; less than 30% of the wild-type level, see Fig. 3), those with largely reduced Ca2+-ATPase activity (green; less than 30% of the wild-type activity, see Fig. 4), and those with high or normal Ca2+-ATPase activity (red; higher than 50% of the wild-type activity, see Fig. 4). Asp351,Ca2+ ions (yellow spheres) at the high affinity sites, three cytoplasmic domains P (pink), N (blue), and A (yellow), 10 transmembrane helices (M1-M10), L6-7 (loop connecting M6 and M7), and L7-8 are indicated. The color for M1-M10 changes gradually from red to blue.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Mutagenesis and Expression—The Stratagene QuikChange™ site-directed mutagenesis method (Stratagene, La Jolla, CA) was utilized for the substitution and deletions of residues in human SERCA2b cDNA in plasmid pGEM7-Zf(+) (Promega). Appropriate restriction fragments with the desired mutation were excised and ligated back into the corresponding region of the full-length SERCA2b cDNA in the plasmid. The full-length SERCA2b cDNA was then excised and ligated into the pMT2 expression vector (27Kaufman R.J. Davies M.V. Pathak V.K. Hershey J.W.B. Mol. Cell. Biol. 1989; 9: 946-958Crossref PubMed Scopus (333) Google Scholar). The pMT2 DNA was transfected into COS-1 cells using the liposome-mediated transfection method. Microsomes were prepared from the cells as described previously (28Maruyama K. MacLennan D.H. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 3314-3318Crossref PubMed Scopus (264) Google Scholar). The "control microsomes" were prepared from COS-1 cells transfected with the pMT2 vector containing no SERCA2b cDNA. The amount of expressed SERCA2b protein was quantified by an enzyme-linked immunosorbent assay with SERCA2b-specific monoclonal antibody IID8 (Affinity Bioreagents, Golden, CO), and the expression level of the mutant in the microsomes was obtained as a value relative to that of the wild type. The amount of intrinsic SERCA2b in the control microsomes was less than 1% of the amount of SERCA2b in the microsomes from the cells transfected with the wild-type cDNA. RNA Preparation and Northern Blot Analysis—Total RNA was extracted by the RNeasy Mini Kit (Qiagen) from COS-1 cells transfected with the pMT2 vector containing wild-type or mutant SERCA2b cDNA, and 0.5 μg of total RNA was electrophoresed and blotted onto Hybond N+ nylon membrane (Amersham Biosciences). Hybridization was performed with a digoxigenin-labeled RNA probe for the region (nucleotides 2249-2620) of SERCA2b cDNA. Digoxigenin labeling of the probe was performed with the DIG Northern Starter Kit (Roche Applied Science). Digoxigenin-labeled actin RNA probe (Roche Applied Science) was used as the control probe. After washing the blotted membrane, digoxigenin-labeled RNA was detected with anti-digoxigenin Fab fragments and visualized by the chemiluminescence technique with CDP-Star (Roche Applied Science). Quantitative Real Time Reverse Transcriptase-PCR—The SERCA2b mRNA level in 0.02 μg of the total RNA was determined by the real time reverse transcriptase-PCR with the LightCycler™ system and the LightCycler-RNA Master SYBR® Green I (Roche Molecular Biochemicals). Melting curve analysis was performed to enhance specificity of the amplification reaction, and LightCycler software version 3.5 was used to evaluate the amplification efficiency and thus quantify the relative mRNA level in comparison with the internal standard curve obtained with the cells transfected with wild-type SERCA2b. The mRNA levels of the mutants relative to the wild-type level thus obtained were corrected by the mRNA level of glucose-6-phosphate dehydrogenase. The primers used for SERCA2b were GGCAATCTACAACAACATGAAAC (forward) and GTAGGAAATGACTCAGCTTGG (reverse), and for glyceraldehyde-3-phosphate dehydrogenase, CATGTTCGTCATGGGTGTGA (forward) and AGTGAGCTTCCCGTTCAGCTC (reverse). ATPase Activity—The rate of ATP hydrolysis was determined at 37 °C in a mixture containing 20 μg/ml microsomal protein, 1 mm ATP, 1 μm A23187, 7 mm MgCl2, 0.1 m KCl, 5 mm NaN3, 50 mm MOPS/Tris (pH 7.0), and 1.84 mm CaCl2 with 2 mm EGTA (3.2 μm free Ca2+ (pCa 5.5)). When the Ca2+ concentration dependence was determined, the CaCl2 concentration was varied in the presence of 2 mm EGTA. The reaction was terminated by the addition of ice-cold trichloroacetic acid, and the amount of Pi released was quantified by the Youngburg and Youngburg method (29Youngburg G.E. Youngburg M.V. J. Lab. Clin. Med. 1930; 16: 158-166Google Scholar). Total Ca2+-ATPase activity of the microsomes was obtained as above, but by subtracting the Ca2+-independent ATPase activity, determined in the presence of 5 mm EGTA without added CaCl2. The Ca2+-ATPase activity of the expressed SERCA2b was then obtained by subtracting the Ca2+-ATPase activity of the control microsomes (background level) from that of the microsomes expressing SERCA2b. This background level was as low as 3% of the activity of those microsomes expressing the wild-type SERCA2b from its cDNA. The Ca2+-ATPase activity of the expressed wild type in the microsomes thus obtained was 122.6 ± 3.7 nmol/min/mg of microsomal protein (n = 5). The Ca2+-ATPase activity of each of the mutants was normalized to its protein expression level relative to that of the wild type (determined as above), thus the specific Ca2+-ATPase activity of each of the mutants relative to that of the wild type was obtained. Ca2+ Transport Activity—Oxalate-dependent and thapsigargin-sensitive Ca2+ transport was assayed as described previously (30Daiho T. Yamasaki K. Suzuki H. Saino T. Kanazawa T. J. Biol. Chem. 1999; 274: 23910-23915Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar) at 25 °C in the presence and absence of 0.5 μm thapsigargin in a mixture containing 20 μg/ml microsomal protein, 1 mm ATP, 7 mm MgCl2, 0.1 m KCl, 20 mm MOPS/Tris (pH 7.0), 5 mm potassium oxalate, and 0.462 mm 45CaCl2 with 0.5 mm EGTA (3.2 μm free 45Ca2+ (pCa 5.5)). The Ca2+ transport activity of the SERCA2b expressed from its cDNA in the microsomes was obtained by subtracting the thapsigargin-sensitive activity of the control microsomes (background level) from that of the microsomes expressing SERCA2b from its cDNA. This background level was as low as 1% of the activity of microsomes expressing the wild-type SERCA2b from its cDNA. The Ca2+ transport activity of the expressed wild type in the microsomes thus obtained was 68.1 ± 4 nmol/min/mg of microsomal protein (n = 4). The Ca2+ transport activity of each of the mutants was normalized to its protein-expression level relative to that of the wild type (determined as above), thus the specific Ca2+ transport activity of each of the mutants relative to that of the wild type was obtained. Formation of EP—Phosphorylation of SERCA2b in microsomes with [γ-32P]ATP or 32Pi was performed under conditions described in the figure legends and Table 1. The reaction was quenched with ice-cold trichloroacetic acid containing Pi. The precipitated proteins were separated by 5% SDS-polyacrylamide gel electrophoresis at pH 6.0 according to the Weber and Osborn method (31Weber K. Osborn M. J. Biol. Chem. 1969; 244: 4406-4412Abstract Full Text PDF PubMed Google Scholar). The radioactivity associated with the separated SERCA2b was quantitated by digital autoradiography as described previously (32Daiho T. Suzuki H. Yamasaki K. Saino T. Kanazawa T. FEBS Lett. 1999; 444: 54-58Crossref PubMed Scopus (27) Google Scholar). The amount of EP formed with the expressed SERCA2b was obtained by subtracting the background radioactivity with the control microsomes. This background level was less than 5% of the radioactivity of EP formed with the expressed wild-type SERCA2b.TABLE 1Summary for functional properties of DD-causing mutants The 36 DD mutants, whose protein expression levels were higher than 30% of that of the wild type, were subjected to functional analyses, and the data obtained are summarized. The specific Ca2+ -ATPase activity of each of the mutants relative to that of the wild type (WT) was determined as described in the legend to Fig. 4, and shown in the fourth column. The mutants are placed from the top row in the table according to their activities thus obtained (i.e. from highest to lowest). The specific Ca2+ transport activity of each of the mutants relative to that of the wild type was determined in Fig. 5. The amount of EP formed from [γ-32P]ATP of the mutant was determined at steady state and at 0 °C, pCa 5.5, and normalized to its expression level relative to that of the wild type as described in the legend to Fig. 6. K0.5 and the Hill coefficient (n) were determined in the Ca2+ dependence of this EP formation at 0 °C by fitting the data to the Hill equation. EP formation from [γ-32P]ATP was also performed at 25 °C, 10 mm Ca2+ for 10 s in a mixture containing 40 μg/ml of microsomal protein, 0.1 mm [γ-32P]ATP, 5 mm MgCl2, 80 mm KCl, 30 mm Tris-HCl (pH 7.5), and 10 mm CaCl2, and the amount of EP in the mutant was calculated as above. The amount of EP formed with the wild type was 126 ± 6 (n = 6) pmol/mg of microsomal protein, and nearly the same as that at 0 °C and pCa 5.5. EP formation from 32Pi was performed in the absence of Ca2+ at 25 °C for 10 min in a mixture containing 40 μg/ml of microsomal protein, 0.1 mm 32Pi, 1 μm A23187, 10 mm MgCl2, 35% (v/v) Me2SO, 50 mm MES/Tris (pH 6.0), and 5 mm EGTA, i.e. under the conditions previously demonstrated by Barrabin et al. (70Barrabin H. Scofano H.M. Inesi G. Biochemistry. 1984; 23: 1542-1548Crossref PubMed Scopus (83) Google Scholar) with SR Ca2+ -ATPase to phosphorylate virtually all the phosphorylation sites. The amount of EP formed with the mutant was calculated as above. The amount of EP formed with the wild type was 134 ± 9 (n = 4) pmol/mg of microsomal protein. All the values are the mean values obtained in three to eight independent experiments (shown without the standard deviations for simplicity, but see figures for the deviations). In the second and third columns, the locations of the DD mutation in the gene and in the enzyme protein are indicated with the exon number and the region in the tertiary structure, respectively. The line below the mutant V843F was drawn to distinguish the first seven mutants (L321F–V843F) that possess the high specific ATPase activity (higher than 50% of that of wild type).DD mutantExonLocationCa2+ -ATPase activityCa2+ -transport activityEP from ATP at 0 °C, pCa 5.5K0.5 and Hill coefficient for Ca2+ activation of EP formation from ATPEP from ATP at 25 °C, pCa 2.0EP from Pi%%%Mn%%WT1001001001.1E-071.7100100L321F8M4/P domain junction123124585.7E-07aData taken from our previous analysis on EP formation from ATP (26)1.551116I274V8L3–485671211.5E-07aData taken from our previous analysis on EP formation from ATP (26)1.311176M719115P domain7082844.5E-07aData taken from our previous analysis on EP formation from ATP (26)2.27579N767S15M5672855.9E-07bDetermined at 25 °C. K0.5 of the wild type was 1.3E-07 m and essentially the same as that at 0 °C2.1115105G807R16M66328471.5E-071.179119A803T16M6560361.4E-072.210694V843F17M755406.9E-07bDetermined at 25 °C. K0.5 of the wild type was 1.3E-07 m and essentially the same as that at 0 °C2.76561M699I14P domain2612731.4E-072.210049S916Y19L8–9240505458Q108H2M22212634.9E-070.77695A838P16M7191606857S920Y19L8–919012816S186P7A domain1814841.1E-071.210559P680L14P domain1411041.9E-072.512852G310V8M49032.9E-07bDetermined at 25 °C. K0.5 of the wild type was 1.3E-07 m and essentially the same as that at 0 °C1.26078N39D1A domain51575455D702N15P domain4479215S765L15M5400822F487S12N domain30216161N809I16M6200128C344Y8P domain11184182131C318R8M4109417595G23E1A domain10264034N39T1A domain00778564ΔL412A domain/M1 linker00949943ΔP422A domain/M1 linker0011011874L65S3M100798761D149N5A domain001167P160H6A domain00677158P160L6A domain00697570S186F7A domain00616621G211D8A domain00808171K683E14P domain00110K683R14P domain002430G703S15P domain00106625G769R15M500231a Data taken from our previous analysis on EP formation from ATP (26Sato K. Yamasaki K. Daiho T. Miyauchi Y. Takahashi H. Ishida-Yamamoto A. Nakamura S. Iizuka H. Suzuki H. J. Biol. Chem. 2004; 279: 35595-35603Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar)b Determined at 25 °C. K0.5 of the wild type was 1.3E-07 m and essentially the same as that at 0 °C Open table in a new tab Miscellaneous—Protein concentrations were determined using the method of Lowry et al. (33Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar) with bovine serum albumin as the standard. Free Ca2+ concentrations were calculated as described previously (34Kubota T. Daiho T. Kanazawa T. Biochim. Biophys. Acta. 1993; 1163: 131-143Crossref PubMed Scopus (25) Google Scholar). Data were analyzed using Origin software (Microcal Software, Inc., Northampton, MA). Three-dimensional models of the enzyme were reproduced by the program VMD (35Humphrey W. Dalke A. Schulten K. J. Mol. Graphics. 1996; 14: 33-38Crossref PubMed Scopus (39882) Google Scholar). Effects of DD Mutations on Protein Expression and ATPase Activity—Each of the 51 DD-causing substitution and deletion mutations was introduced into SERCA2b cDNA, and the mutant cDNA or wild-type cDNA was transfected into COS-1 cells. The expression level of the mutant protein in microsomes prepared from the cells was determined and compared with that of the wild-type protein (Fig. 3a). The amount of intrinsic wild-type SERCA2b protein in the control microsomes (prepared from the control cells transfected with the vector without having the SERCA2b cDNA) was less than 1% of the wild-type protein expressed with the cDNA. Depending on the mutations introduced, the expression of mutants varied significantly from undetectable levels to those comparable with the wild-type level. Expression levels of the 15 mutants were less than 30% of the wild-type level, thus very low. There were no hot spots on the primary and tertiary structures for the markedly reduced expression (see Figs. 2b and 3b). Such markedly reduced expression occurred with the specific mutations in the cytoplasmic, transmembrane, and lumenal regions of the enzyme. The transcription levels were checked by the Northern blot analysis and more quantitatively by the real time reverse transcriptase-PCR method for these 15 mutants and three more mutants of the relatively low protein expression (30-40% of the wild-type level). We found, first of all, that the mRNA levels of all these mutants as well as of the wild type were ∼500 to 800 times higher than the intrinsic wild-type SERCA2b mRNA level of the control cells, showing their extremely high transcription levels and suggesting high transfection efficiency. In the Northern blot analysis, the size of the mRNA of all these mutants and that of the wild type in the expression vector were shown to be exactly the same and their expression levels were very similar with no major reduction in the mutants (data not shown). The more quantitative co
Referência(s)