SWI/SNF Regulates the Cellular Response to Hypoxia
2008; Elsevier BV; Volume: 284; Issue: 7 Linguagem: Inglês
10.1074/jbc.m808491200
ISSN1083-351X
AutoresNiall S. Kenneth, Sharon Mudie, Patrick van Uden, Sónia Rocha,
Tópico(s)interferon and immune responses
ResumoHypoxia induces a variety of cellular responses such as cell cycle arrest, apoptosis, and autophagy. Most of these responses are mediated by the hypoxia-inducible factor-1α. To induce target genes, hypoxia-inducible factor-1α requires a chromatin environment conducive to allow binding to specific sequences. Here, we have studied the role of the chromatin-remodeling complex SWI/SNF in the cellular response to hypoxia. We find that SWI/SNF is required for several of the cellular responses induced by hypoxia. Surprisingly, hypoxia-inducible factor-1α is a direct target of the SWI/SNF chromatin-remodeling complex. SWI/SNF components are found associated with the hypoxia-inducible factor-1α promoter and modulation of SWI/SNF levels results in pronounced changes in hypoxia-inducible factor-1α expression and its ability to transactivate target genes. Furthermore, impairment of SWI/SNF function renders cells resistant to hypoxia-induced cell cycle arrest. These results reveal a previously uncharacterized dependence of hypoxia signaling on the SWI/SNF complex and demonstrate a new level of control over the hypoxia-inducible factor-1α system. Hypoxia induces a variety of cellular responses such as cell cycle arrest, apoptosis, and autophagy. Most of these responses are mediated by the hypoxia-inducible factor-1α. To induce target genes, hypoxia-inducible factor-1α requires a chromatin environment conducive to allow binding to specific sequences. Here, we have studied the role of the chromatin-remodeling complex SWI/SNF in the cellular response to hypoxia. We find that SWI/SNF is required for several of the cellular responses induced by hypoxia. Surprisingly, hypoxia-inducible factor-1α is a direct target of the SWI/SNF chromatin-remodeling complex. SWI/SNF components are found associated with the hypoxia-inducible factor-1α promoter and modulation of SWI/SNF levels results in pronounced changes in hypoxia-inducible factor-1α expression and its ability to transactivate target genes. Furthermore, impairment of SWI/SNF function renders cells resistant to hypoxia-induced cell cycle arrest. These results reveal a previously uncharacterized dependence of hypoxia signaling on the SWI/SNF complex and demonstrate a new level of control over the hypoxia-inducible factor-1α system. The transcriptional response to hypoxia is mainly controlled by the hypoxia-inducible factor (HIF) 5The abbreviations used are: HIF, hypoxia-inducible factor; PHDs, prolyl-hydroxylases; VHL, von Hippel-Lindau; EPO, erythropoietin; LC3-Licht Chain 3; ANOVA, analysis of variance; ChIP, chromatin immunoprecipitation assay. system (1Bardos J.I. Ashcroft M. Biochim. Biophys. Acta. 2005; 1755: 107-120PubMed Google Scholar). HIF is a heterodimeric transcription factor composed of α and β subunits. To date, there are three α subunits identified and several splice variants of the β subunit (also called ARNT) (1Bardos J.I. Ashcroft M. Biochim. Biophys. Acta. 2005; 1755: 107-120PubMed Google Scholar, 2Rocha S. Trends Biochem. Sci. 2007; 32: 389-397Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar). While HIF-1β is constitutively expressed and its levels remain unchanged, HIF-α subunits are extremely labile at normal oxygen levels. HIF-1α levels are controlled by a class of 2-oxoglutarate dioxygenases called prolyl-hydroxylases (PHDs). There are four PHDs identified so far, but only PHD1, PHD2, and PHD3 have been shown to control HIF-1α. These enzymes catalyze the hydroxylation of specific proline residues in the oxygen dependent degradation domain of HIF-α that target this subunit for ubiquitination by the Von Hippel Lindau (VHL) system and consequently proteasomal degradation (3Fandrey J. Gorr T.A. Gassmann M. Cardiovasc. Res. 2006; 71: 642-651Crossref PubMed Scopus (182) Google Scholar, 4Bruegge K. Jelkmann W. Metzen E. Curr. Med. Chem. 2007; 14: 1853-1862Crossref PubMed Scopus (80) Google Scholar). However, when oxygen levels are reduced, or cofactors such as iron ions are not available, PHD activity is inhibited, allowing HIF-1α levels to increase, followed by its translocation into the nucleus and transactivation of target genes. Among the HIF-1α targets are PHD2 and PHD3, revealing a negative feedback loop for the system (5Metzen E. Stiehl D.P. Doege K. Marxsen J.H. Hellwig-Burgel T. Jelkmann W. Biochem. J. 2005; 387: 711-717Crossref PubMed Scopus (162) Google Scholar, 6Pescador N. Cuevas Y. Naranjo S. Alcaide M. Villar D. Landazuri M.O. Del Peso L. Biochem. J. 2005; 390: 189-197Crossref PubMed Scopus (167) Google Scholar). Hypoxia induces a variety of possible cellular responses (2Rocha S. Trends Biochem. Sci. 2007; 32: 389-397Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar, 7Kenneth N.S. Rocha S. Biochem. J. 2008; 414: 19-29Crossref PubMed Scopus (210) Google Scholar). These include cell cycle arrest, via p21 and p27 induction (8Gardner L.B. Li Q. Park M.S. Flanagan W.M. Semenza G.L. Dang C.V. J. Biol. Chem. 2001; 276: 7919-7926Abstract Full Text Full Text PDF PubMed Scopus (315) Google Scholar, 9Koshiji M. Kageyama Y. Pete E.A. Horikawa I. Barrett J.C. Huang L.E. EMBO J. 2004; 23: 1949-1956Crossref PubMed Scopus (500) Google Scholar), autophagy (10Zhang H. Bosch-Marce M. Shimoda L.A. Tan Y.S. Baek J.H. Wesley J.B. Gonzalez F.J. Semenza G.L. J. Biol. Chem. 2008; 283: 10892-10903Abstract Full Text Full Text PDF PubMed Scopus (1313) Google Scholar, 11Papandreou I. Lim A.L. Laderoute K. Denko N.C. Cell Death Differ. 2008; 28: 7212-7224Google Scholar) or apoptosis (12Greijer A.E. van der Wall E. J. Clin. Pathol. 2004; 57: 1009-1014Crossref PubMed Scopus (610) Google Scholar). All of these cellular responses have been shown to be dependent and independent of HIF-1α (8Gardner L.B. Li Q. Park M.S. Flanagan W.M. Semenza G.L. Dang C.V. J. Biol. Chem. 2001; 276: 7919-7926Abstract Full Text Full Text PDF PubMed Scopus (315) Google Scholar, 9Koshiji M. Kageyama Y. Pete E.A. Horikawa I. Barrett J.C. Huang L.E. EMBO J. 2004; 23: 1949-1956Crossref PubMed Scopus (500) Google Scholar, 10Zhang H. Bosch-Marce M. Shimoda L.A. Tan Y.S. Baek J.H. Wesley J.B. Gonzalez F.J. Semenza G.L. J. Biol. Chem. 2008; 283: 10892-10903Abstract Full Text Full Text PDF PubMed Scopus (1313) Google Scholar, 11Papandreou I. Lim A.L. Laderoute K. Denko N.C. Cell Death Differ. 2008; 28: 7212-7224Google Scholar, 12Greijer A.E. van der Wall E. J. Clin. Pathol. 2004; 57: 1009-1014Crossref PubMed Scopus (610) Google Scholar). As such, HIF-1α transactivates genes such as BNIP3, a BH3-only Bcl-2 family member that can induce autophagy (2Rocha S. Trends Biochem. Sci. 2007; 32: 389-397Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar). On the other hand, Noxa, a pro-apoptotic protein, has also been shown to be a HIF-1α target (2Rocha S. Trends Biochem. Sci. 2007; 32: 389-397Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar). Autophagy can be considered both a survival and death pathway (13Levine B. Kroemer G. Cell. 2008; 132: 27-42Abstract Full Text Full Text PDF PubMed Scopus (5647) Google Scholar, 14Yu L. Strandberg L. Lenardo M.J. Autophagy. 2008; 4: 567-573Crossref PubMed Scopus (124) Google Scholar). It is characterized by the formation of autophagosomes, which are used to recycle damaged organelles such as mitochondria. Light Chain 3 (LC3) proteins are cleaved during autophagy and the cleaved form associates with autophagosome. The presence of LC3 in autophagosomes as well as the conversion of LC3 to the lower migrating form LC3-II are indicators of autophagy. To induce transcription of genes, transcription factors such as HIF-1α require access to particular sequences in the promoter and enhancer regions of target genes. For this to occur, chromatin must be in an open conformation, to facilitate the binding of large protein complexes. There are several ways of modulating chromatin structure, including histone tail modification, integration of histone variants and nucleosome repositioning resulting from the action of ATP-dependent remodeling complexes (15Jin J. Cai Y. Li B. Conaway R.C. Workman J.L. Conaway J.W. Kusch T. Trends Biochem. Sci. 2005; 30: 680-687Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, 16Shilatifard A. Annu. Rev. Biochem. 2006; 75: 243-269Crossref PubMed Scopus (898) Google Scholar, 17Varga-Weisz P.D. Becker P.B. Curr. Opin. Genet. Dev. 2006; 16: 151-156Crossref PubMed Scopus (83) Google Scholar). SWI/SNF chromatin remodeling complexes represent an evolutionary conserved subgroup of ATP-dependent enzymes. They can cause a spectrum of chromatin rearrangements in an ATP-dependent manner, which can both positively and negatively regulate gene expression (18Simone C. J. Cell Physiol. 2006; 207: 309-314Crossref PubMed Scopus (83) Google Scholar). In humans, several different forms of SWI/SNF complexes have been described. These are composed of eight to twelve subunits, which include an ATPase: either BRG1 or BRM, and a host of BRG1/BRM associated factors (BAFs). BRG1 or BRM, BAF170, BAF155, BAF57, BAF60, BAF53, INI1, and actin, are generally shared between these complexes (19Mohrmann L. Verrijzer C.P. Biochim. Biophys. Acta. 2005; 1681: 59-73Crossref PubMed Scopus (276) Google Scholar). Additional subunits define the character of particular subcomplexes, such as the PBAF complex, which also contains BAF180 and BAF200 (20Yan Z. Cui K. Murray D.M. Ling C. Xue Y. Gerstein A. Parsons R. Zhao K. Wang W. Genes Dev. 2005; 19: 1662-1667Crossref PubMed Scopus (190) Google Scholar). The BRG1 and BRM subunits are catalytic motor subunits while the additional subunits are important in targeting and modulating the activity of the ATPase (18Simone C. J. Cell Physiol. 2006; 207: 309-314Crossref PubMed Scopus (83) Google Scholar, 19Mohrmann L. Verrijzer C.P. Biochim. Biophys. Acta. 2005; 1681: 59-73Crossref PubMed Scopus (276) Google Scholar). Both BRG1 and BRM have been shown to associate with HIF-1α at the EPO promoter and suggested to act as co-activators of HIF-1α in the induction of this particular gene (21Wang F. Zhang R. Beischlag T.V. Muchardt C. Yaniv M. Hankinson O. J. Biol. Chem. 2004; 279: 46733-46741Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). However, to what extent SWI/SNF is involved in the cellular response to hypoxia is currently unknown. Here we have investigated the role of SWI/SNF chromatin-remodeling complex in the response to hypoxia. We find that SWI/SNF is required for HIF-1α function and is important for hypoxia-induced cell cycle arrest. Cells—U2OS osteosarcoma cell line was obtained from the European Collection of Cell Cultures and grown in Dulbecco's Modified Eagle Medium (Lonza) supplemented with 10% fetal bovine serum (Gibco), 50 units/ml penicillin (Lonza), and 50 μg/ml streptomycin (Lonza) for no more than 30 passages. U2OS-HRE luciferase cells were a kind gift from Dr. Margaret Ashcroft (London, UK) and have been described previously (22Bardos J.I. Chau N.M. Ashcroft M. Mol. Cell Biol. 2004; 24: 2905-2914Crossref PubMed Scopus (90) Google Scholar). Control and BAF57 shRNA plasmids were obtained from Origene, and stable cell lines were created using the manufacturer's instructions. These cells were maintained in 10% fetal bovine serum/Dulbecco's modified Eagle's medium supplemented with 50 units/ml penicillin, and 50 μg/ml streptomycin and 0.5 μg/ml puromycin (Sigma). DNA Constructs—Expression plasmids for BAF57 (pCMV-XL5-BAF57) and BAF170 (pCMV-XL4-BAF170) were obtained from Origene. GFP-BRG1 was a kind gift from Prof. Tom Owen-Hughes (Dundee, UK) and has been described previously (23Roche K.C. Wiechens N. Owen-Hughes T. Perkins N.D. Oncogene. 2004; 23: 8185-8195Crossref PubMed Scopus (38) Google Scholar). The pGL-HRE luciferase construct was a kind gift from Dr. Margaret Ashcroft (London, UK) and has been previously described (22Bardos J.I. Chau N.M. Ashcroft M. Mol. Cell Biol. 2004; 24: 2905-2914Crossref PubMed Scopus (90) Google Scholar). siRNA Transfection—siRNA duplex oligonucleotides were synthesized by MWG and transfected using Oligofectamine (Invitrogen) and Interferin (Polyplus) per the manufacturer's instructions. siRNA sequences are as follows: Control, AACAGUCGCGUUUGCGACUGG (24van Uden P. Kenneth N.S. Rocha S. Biochem. J. 2008; 412: 477-484Crossref PubMed Scopus (532) Google Scholar); BAF155, CUGUAUUCAUGUGAUUGAA; BAF57, GGAACCAGUGAUAGUAACA; BAF170, AGUCCUUGGUGCAGAAUAA; BRG1, GCAAGAUGUCGAUGAUGAA; BRM, UGACCAUCAUGGAGGAUUATT (21Wang F. Zhang R. Beischlag T.V. Muchardt C. Yaniv M. Hankinson O. J. Biol. Chem. 2004; 279: 46733-46741Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar); HIF-1α, CUGAUGACCAGCAACUUGA (24van Uden P. Kenneth N.S. Rocha S. Biochem. J. 2008; 412: 477-484Crossref PubMed Scopus (532) Google Scholar). Hypoxia Inductions and MG132 Treatment—Cells were incubated at 1% O2 in an in vivo 300 hypoxia work station (Ruskin, UK). Cells were lysed for protein extracts, and RNA extraction in the work station to avoid re-oxygenation. For hypoxia mimetic conditions, cells were treated with 100 μm desferroxamine. MG132 (Merck Biosciences) was added 3 h prior to cell harvesting. PCR and PCR Sequences—Semi-quantitative RT-PCR and PCR was performed as described before (25Rocha S. Campbell K.J. Perkins N.D. Mol. Cell. 2003; 12: 15-25Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar). PCR products were resolved on 2% agarose gels and scanned using in a phosphorimager (FujiFilm FLA-5100) into TIFF format. Quantification was performed using ImageJ software. PCR sequences are as follows: HIF-1α: For, CAT AAA GTC TGC AAC ATG GAA GGT and Rev, ATT TGA TGG GTG AGG AAT GGG TT; β-actin: For, GTG GGA GTG GGT GGA GGC and Rev, TCA ACT GGT CTC AAG TCA GTG; BAF57: For, AGG TTG TGC GGT CTG AAA GT and Rev, ATC GGA ATG TTC TCG TCG TC; BRG1: For, GAC GAG ACC GTC AAC CAG AT and Rev, TTT TCC TCC TCC TCC TCA CA. Chromatin Immunoprecipitation (ChIP)—Proteins were cross-linked with formaldehyde for 10 min. 0.125 mol/liter glycine was added, and cells washed with phosphate-buffered saline. Cells were lysed with lysis buffer (1% SDS, 10 mm EDTA, 50 mm Tris-HCL, pH 8.1, 1 mm PMSF, 1 mg/ml leupeptin, 1 mg/ml aprotonin), followed by sonication and centrifugation. The supernatant was precleared with sheared salmon sperm DNA and protein G-Sepharose beads (Sigma). The supernatant was incubated with specific antibodies overnight, and then with protein G-Sepharose beads for 1 h. After an extensive wash step, the complexes were eluted with buffer (100 mmol/liter NaHCO3, 1% SDS) and incubated with proteinase K. DNA was purified using QIAquick polymerase chain reaction purification kit (Qiagen). PCR was performed using the following primers: HIF-1α promoter: For, CAACAGAGAGCCCAGCAGAG and Rev, CCTGAGGTGGAGGCGGGTTC; HIF-1α coding region: For, TGCTCATCAGTTGCCACTTC and Rev, AAAACATTGCGACCACCTTC; ALU chromosome 1: For, CATGTTAAAATTGTCTCTTCGACTGGG and Rev, GTATAGAGAAGGATTTCCTGGAGAGC. Antibodies—Antibodies used were: HIF-1α (MAB1536, R&D Systems), BAF155 (sc-48350, Santa Cruz Biotechnology and ab26304, Abcam), BAF57 (sc-25140, Santa Cruz Biotechnology), BAF170 (sc-17838, Santa Cruz Biotechnology), BRM (sc-, Santa Cruz Biotechnology), BRG1 (07-478, Upstate), acetyl-H3 (06-599, Upstate), β-actin (A5441, Sigma), Glut1 (RB-9052, Neomarkers), PHD2 (ab4561, Abcam), Polymerase II CTD (sc-47701, Santa Cruz Biotechnology); RelB (sc-48366, Santa Cruz Biotechnology), NF-κB2 (sc-848, Santa Cruz Biotechnology). Statistical Analysis—ANOVA and Student's t-tests were performed on the means, and p values were calculated. *, p ≤ 0.050 and **, p ≤ 0.010. Other Experimental Procedures—Western blot, proliferation assays, transfections, and luciferase assays have been described previously (Refs. 26Rocha S. Garrett M.D. Campbell K.J. Schumm K. Perkins N.D. EMBO J. 2005; 24: 1157-1169Crossref PubMed Scopus (139) Google Scholar, 27Schumm K. Rocha S. Caamano J. Perkins N.D. EMBO J. 2006; 25: 4820-4832Crossref PubMed Scopus (109) Google Scholar and references therein). SWI/SNF Components Potentiate HIF-1α Transcriptional Activity—It was previously shown that BRG1 and BRM were important for HIF-1α-mediated induction of the EPO gene in Hep3B cells. Furthermore, both BRM and BRG1 could be found at the EPO promoter with HIF-1α (21Wang F. Zhang R. Beischlag T.V. Muchardt C. Yaniv M. Hankinson O. J. Biol. Chem. 2004; 279: 46733-46741Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). The results in that study suggested that BRG1 and BRM could act as coactivators for HIF-1α. However, this possibility has not yet been proven. To address this question, HIF-1α transcriptional activity was tested in the presence of higher levels of several SWI/SNF subunits (Fig. 1, A and B). U2OS cells were transfected with a luciferase reporter construct possessing 3 copies of the HRE consensus binding site in the presence or absence of BRG1, BAF170, or BAF57. In addition, these cells were exposed to 1% O2 for 24 h prior to harvest, and luciferase activity measured. As can be seen in Fig. 1, increasing the levels of BRG1, BAF170, and BAF57 (Fig. 1A) induced a significant increase in normoxic HIF-1α activity (Fig. 1B). As expected, the increase in HIF-1α activity was much more evident when cells were exposed to hypoxia. These results suggested that SWI/SNF is a general transcriptional coactivator for HIF-1α and also supports the previous observed results when the EPO gene was analyzed in a different cell system (21Wang F. Zhang R. Beischlag T.V. Muchardt C. Yaniv M. Hankinson O. J. Biol. Chem. 2004; 279: 46733-46741Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). SWI/SNF Components Are Required for Full HIF-1α Transcriptional Activity—Because overexpression studies can sometimes result in artifacts, we wanted to investigate the effects of modulating SWI/SNF levels in more physiological conditions. For this purpose, we used siRNA oligonucleotides directed toward several members of the SWI/SNF complex (Fig. 2A). In addition, we used a U2OS cell line, which possesses a stable integrated HIF-1α luciferase reporter, a cell line that has been extensively used to investigate HIF-1α function (22Bardos J.I. Chau N.M. Ashcroft M. Mol. Cell Biol. 2004; 24: 2905-2914Crossref PubMed Scopus (90) Google Scholar, 28Chau N.M. Rogers P. Aherne W. Carroll V. Collins I. McDonald E. Workman P. Ashcroft M. Cancer Res. 2005; 65: 4918-4928Crossref PubMed Scopus (130) Google Scholar). When several of the SWI/SNF components were depleted, it was possible to observe a reduction in normoxic HIF-1α activity. However, this effect was even more evident when cells were exposed to hypoxic stress by the addition of the hypoxia mimetic Desferroxamine (DFX) (Fig. 2B). Interestingly, depletion of BRM had no effect on HIF-1α activity in this cell line despite the effectiveness of the siRNA. These results support the gain of function experiments depicted in Fig. 1 and indicate that endogenous SWI/SNF is required for HIF-1α activity. Furthermore, these results suggest that BRG1 is the catalytic subunit responsible for modulating HIF-1α activity in these cells. SWI/SNF Components Are Required for HIF-1α Expression and Activity—Our gain and loss of function experiments for members of the SWI/SNF complex indicated that this remodeling complex is important for HIF-1α activity. We next determined the effects of SWI/SNF depletion on the levels of endogenous HIF-1α target genes following exposure to hypoxia (Fig. 3). Consistent with the hypothesis that the SWI/SNF complex could act as a HIF-1α coactivator, the induction of Glut1 (a well known HIF-1α target) by hypoxia was compromised in cells depleted of BRG1 or BAF170 (Fig. 3A, 3rd line from the top). Unexpectedly, depletion of BAF170 and BRG1 resulted in a reduction in HIF-1α protein levels following hypoxia (Fig. 3A, top line). Although HIF-1α protein levels are mostly regulated by the activity of PHD2 in these cells (29Berra E. Benizri E. Ginouves A. Volmat V. Roux D. Pouyssegur J. EMBO J. 2003; 22: 4082-4090Crossref PubMed Scopus (1101) Google Scholar), PHD2 levels were not increased above control (Fig. 3A, second line from the top), indicating that the mechanism behind HIF-1α reduction is not dependent on PHD elevation. In addition, depletion of BAF170 also resulted in reduction of BAF57 levels. This is in agreement with a recent study where the concept of a stoichiometric complex between BAF170, BAF57, and BAF155 was proposed, and the authors demonstrated that depletion of either of these proteins rendered them susceptible for proteasomal degradation (30Chen J. Archer T.K. Mol. Cell Biol. 2005; 25: 9016-9027Crossref PubMed Scopus (98) Google Scholar). We had previously observed that modulating BAF57 levels had a strong effect on HIF-1α activity (Figs. 1 and 2). Depletion of BAF57 and BAF155 (another member of the subcomplex) was performed, and the effects on HIF-1α and HIF-1α target levels analyzed (Fig. 3B). A severe impairment of HIF-1α expression following hypoxia could be observed in the absence of BAF57 (Fig. 3B, top line). Furthermore, Glut1 induction following hypoxia was also abolished (Fig. 3B, 3rd line from the top). This could be due to reduced levels of HIF-1α or to an inhibition of HIF-1α transcriptional activity (Fig. 2). Consistent with being a HIF-1α target gene (5Metzen E. Stiehl D.P. Doege K. Marxsen J.H. Hellwig-Burgel T. Jelkmann W. Biochem. J. 2005; 387: 711-717Crossref PubMed Scopus (162) Google Scholar), PHD2 levels were also reduced compared with control samples (Fig. 3B, 2nd line from the top). Interestingly, we could still detect increases in PHD2 in response to hypoxia, suggesting that either there is enough HIF-1α remaining to transactivate PHD2 or that other factors apart from HIF-1α can induce PHD2 following hypoxia. When BAF155 was depleted, BAF57 levels were also reduced, which could contribute to the partial reduction of HIF-1α expression (Fig. 3B, 4th and 5th line). We extended our analysis to the other catalytic subunit, BRM (Fig. 3C). We could not detect any effect of BRM depletion on either HIF-1α levels (Fig. 3C, top line) or target gene activation (Fig. 3C, 2nd and 3rd lines from the top). These results indicate that BRG1 is the catalytic subunit responsible for the modulation of HIF-1α and that BRM cannot compensate for BRG1 in this particular cell line. SWI/SNF Components Regulate HIF-1α Expression by Proteasomal-independent Mechanisms—Results presented in Fig. 3 indicate that HIF-1α expression requires the SWI/SNF chromatin remodeling complex. Given that we did not observe any increase in PHD2 levels, we hypothesized that SWI/SNF control over the HIF-1α system was distinct from the traditional proteasomal degradation mechanism. To test this possibility, we analyzed HIF-1α levels in the presence or absence of SWI/SNF components when the proteasome is inhibited (Fig. 4A). As it can be seen in Fig. 4A, in normal conditions, HIF-1α levels are not detectable; however, in the presence of the proteasomal inhibitor MG132, it is possible to observe a robust stabilization of HIF-1α protein. As expected, when a HIF-1α siRNA knockdown was performed, no detectable HIF-1α could be seen, even in the presence of MG132 (Fig. 4A, last lane). When BRG1 was depleted, HIF-1α levels were decreased when compared with control (Fig. 4A). On the other hand, depletion of BRM resulted in no differences in HIF-1α levels. However, the most dramatic effects were obtained when BAF57 or BAF155 were depleted. Depletion of BAF57 or BAF155 resulted in the same reduction of HIF-1α as was observed with direct HIF-1α knockdown (Fig. 4A). These results suggest that SWI/SNF regulates HIF-1α expression through a mechanism that is not dependent on the proteasome. This possibility is also supported by gain of function experiments, where increased levels of BRG1, BAF170, and BAF57 in the presence of MG132 for a reduced period of time also result in increased stabilization of HIF-1α (Fig. 4B). SWI/SNF Components Are Required for HIF-1α mRNA Expression—Recently, we and others (24van Uden P. Kenneth N.S. Rocha S. Biochem. J. 2008; 412: 477-484Crossref PubMed Scopus (532) Google Scholar, 31Gorlach A. Bonello S. Biochem. J. 2008; 412: e17-19Crossref PubMed Google Scholar, 32Rius J. Guma M. Schachtrup C. Akassoglou K. Zinkernagel A.S. Nizet V. Johnson R.S. Haddad G.G. Karin M. Nature. 2008; 453: 807-811Crossref PubMed Scopus (1182) Google Scholar) have shown that HIF-1α levels can be actively changed by regulation of HIF-1α mRNA production by mechanisms involving the NF-κB family of transcription factors. As depletion of BAF57 and BAF155 reduced HIF-1α protein levels to the same degree as depletion of HIF-1α itself (Fig. 4A), we next analyzed HIF-1α mRNA levels under conditions of reduced BRG1 and BAF57 availability (Fig. 5). It is possible to observe in Fig. 5A, that reduction of BRG1 or BAF57 resulted in a significant reduction of HIF-1α mRNA levels. This is also evident when cells were treated with hypoxia. The difference between BAF57 and BRG1 effects could be attributed to the relative siRNA efficiency. While the siRNA for BAF57 is highly efficient (90% reduction of BAF57 mRNA), BRG1 siRNA results in a 70% reduction of BRG1 mRNA (supplemental Fig. S1). Despite the difference in levels, these results suggest that BAF57 and BRG1 are required for HIF-1α mRNA expression. Because the SWI/SNF complex remodels chromatin in both positive and negative fashions, we investigated if the HIF-1α promoter was a target for SWI/SNF (Fig. 5, B–D). Using chromatin immunoprecipitation, we could detect hallmarks of active transcription such as H3 acetylation and RNA polymerase II occupancy (Fig. 5B). In contrast, when a region of chromosome 1, containing Alu repeats was analyzed, no detectable acetylated H3 could be observed. The absence of acetylated H3 is consistent with a previous report for this area of chromosome 1 (33Hakimi M.A. Bochar D.A. Schmiesing J.A. Dong Y. Barak O.G. Speicher D.W. Yokomori K. Shiekhattar R. Nature. 2002; 418: 994-998Crossref PubMed Scopus (234) Google Scholar). Acetylation of lysine residues in the H3 tails generates specific docking sites for bromodomain containing proteins (34Hassan A.H. Prochasson P. Neely K.E. Galasinski S.C. Chandy M. Carrozza M.J. Workman J.L. Cell. 2002; 111: 369-379Abstract Full Text Full Text PDF PubMed Scopus (420) Google Scholar, 35Hassan A.H. Awad S. Al-Natour Z. Othman S. Mustafa F. Rizvi T.A. Biochem. J. 2007; 402: 125-133Crossref PubMed Scopus (52) Google Scholar, 36Singh M. Popowicz G.M. Krajewski M. Holak T.A. Chembiochem. 2007; 8: 1308-1316Crossref PubMed Scopus (44) Google Scholar). Bromodomains are found in chromatin-associated proteins (34Hassan A.H. Prochasson P. Neely K.E. Galasinski S.C. Chandy M. Carrozza M.J. Workman J.L. Cell. 2002; 111: 369-379Abstract Full Text Full Text PDF PubMed Scopus (420) Google Scholar, 36Singh M. Popowicz G.M. Krajewski M. Holak T.A. Chembiochem. 2007; 8: 1308-1316Crossref PubMed Scopus (44) Google Scholar), including chromatin remodeling enzymes such as SWI/SNF. As such, when antibodies for BRG1, BAF57, and BAF155 were used, we could detect specific occupancy of these components at the HIF-1α promoter but not in a control region of the gene (Fig. 5C). Importantly, in the presence of hypoxia, we can still detect BRG1 occupancy at the HIF-1α promoter (Fig. 5D). The observation that SWI/SNF components are present at the HIF-1α promoter (Fig. 5, C and D) combined with the effects on HIF-1α mRNA (Fig. 5A) and protein levels (Figs. 3 and 4) indicate that HIF-1α is a target of SWI/SNF and that this complex is fundamental for HIF-1α expression. BAF57 Is Required for SWI/SNF and NF-κB Function at the HIF-1α Promoter—In all of our experiments, the most dramatic changes of HIF-1α levels were observed following depletion of one SWI/SNF component, in particular, BAF57. BAF57 does not possess catalytic activity although studies have demonstrated that it possesses DNA binding and promoter targeting activity (19Mohrmann L. Verrijzer C.P. Biochim. Biophys. Acta. 2005; 1681: 59-73Crossref PubMed Scopus (276) Google Scholar). It has been shown to be important for estrogen and androgen receptor functions and recently also in thyroid hormone responses (37Link K.A. Burd C.J. Williams E. Marshall T. Rosson G. Henry E. Weissman B. Knudsen K.E. Mol. Cell Biol. 2005; 25: 2200-2215Crossref PubMed Scopus (104) Google Scholar, 38Garcia-Pedrero J.M. Kiskinis E. Parker M.G. Belandia B. J. Biol. Chem. 2006; 281: 22656-22664Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 39Heimeier R.A. Hsia V.S. Shi Y.B. Mol. Endocrinol. 2008; 22: 1065-1077Crossref PubMed Scopus (24) Google Scholar). Given its DNA binding ability and our own results concerning alteration of HIF-1α levels, we tested if BAF57 was necessary for SWI/SNF function at the HIF-1α promoter (Fig. 6). For this purpose, we created stable U2OS cells where BAF57 was selectively reduced (Fig. 6A). These cells behaved similarly to cells with transient BAF57 depletion, where HIF-1α expression is reduced even following prolonged exposure to hypoxia (Fig. 6A, top panel). Using these BAF57 knockdown cells, we performed ChIPs for other SWI/SNF components at the HIF-1α promoter. When compared with control cells, BAF57-depleted cells presented a reduced recruitment of BAF155 and BRG1 to the HIF-1α promoter (Fig. 6B, quantified in supplemental Fig. S2A). We had previously observed that RNA polymerase II subunits could be detected at the HIF-1α promoter (Fig. 5B), suggestive of active transcription. As BAF57 depletion resulted in lower HIF-1α mRNA, we investigated if this was also evident in RNA polymerase recruitment. When BAF57 was depleted, we observed around 50% reduction in RNA polymerase II recruitment to the HIF-1α promoter (Fig. 6C, quantified in
Referência(s)