Differential Activity of Progesterone and Glucocorticoid Receptors on Mouse Mammary Tumor Virus Templates Differing in Chromatin Structure
1997; Elsevier BV; Volume: 272; Issue: 22 Linguagem: Inglês
10.1074/jbc.272.22.14227
ISSN1083-351X
AutoresCatharine L. Smith, Han Htun, Ronald G. Wolford, Gordon L. Hager,
Tópico(s)Reproductive System and Pregnancy
ResumoIn vivo, transcription factors interact with promoters having complex nucleoprotein structures. The transiently expressed progesterone receptor (PR) efficiently activates a transfected mouse mammary tumor virus (MMTV) promoter but is a poor activator of the MMTV promoter when it acquires an ordered chromatin structure as an endogenous, replicating gene. We show that the deficiency in PR activity is not due to insufficient expression of either B or A isoforms or competition between the two types of MMTV templates. Rather, this deficiency reflects an inability to induce the chromatin remodeling event that is required for activation of the replicated MMTV template. To determine whether this characteristic is common to transiently expressed steroid receptors or specific to the PR, we examined the activity of transiently expressed glucocorticoid (GR) receptor. Unlike the PR, the transiently expressed GR is an effective activator of both MMTV templates and efficiently induces the necessary chromatin remodeling event at the replicated template. These results indicate that the GR and PR have unique requirements for activation of promoters with ordered chromatin structure. These differences may provide a mechanism for establishing target gene specificity in vivo for steroid receptors that recognize and bind to identical DNA sequences. In vivo, transcription factors interact with promoters having complex nucleoprotein structures. The transiently expressed progesterone receptor (PR) efficiently activates a transfected mouse mammary tumor virus (MMTV) promoter but is a poor activator of the MMTV promoter when it acquires an ordered chromatin structure as an endogenous, replicating gene. We show that the deficiency in PR activity is not due to insufficient expression of either B or A isoforms or competition between the two types of MMTV templates. Rather, this deficiency reflects an inability to induce the chromatin remodeling event that is required for activation of the replicated MMTV template. To determine whether this characteristic is common to transiently expressed steroid receptors or specific to the PR, we examined the activity of transiently expressed glucocorticoid (GR) receptor. Unlike the PR, the transiently expressed GR is an effective activator of both MMTV templates and efficiently induces the necessary chromatin remodeling event at the replicated template. These results indicate that the GR and PR have unique requirements for activation of promoters with ordered chromatin structure. These differences may provide a mechanism for establishing target gene specificity in vivo for steroid receptors that recognize and bind to identical DNA sequences. In the living cell, transcription and replication take place in the context of chromatin. Factors must interact with promoters and other important DNA regions that have complex nucleoprotein architecture. Inactive genes, particularly those that are tissue-specific, are characterized by chromatin structure which is inaccessible to factors and nucleases (reviewed in Ref. 1van Holde K.E. Chromatin.Springer-Verlag, Heidelberg. 1988; Google Scholar). During development, newly expressed transcription factors must interact with these repressive structures to activate their target promoters. The mouse mammary tumor virus (MMTV) 1The abbreviations used are: MMTV, mouse mammary tumor virus; BES, 2-[bis(2-hydroxyethyl)amino]ethanesulfonic acid; IL2R, interleukin 2 receptor; PR, progesterone receptor; GR, glucocorticoid receptor; bp, base pair(s); PBS, phosphate-buffered saline; CAT, chloramphenicol acetyltransferase; LTR, long terminal repeat; HA, hemagglutinin; Dex, dexamethasone; GRE, glucocorticoid response element(s). promoter is an in vivo model for the role of chromatin structure in transcription. In its stably replicating form, the MMTV LTR exists as an ordered array of nucleosomes (2Richard-Foy H. Hager G.L. EMBO J. 1987; 6: 2321-2328Crossref PubMed Scopus (450) Google Scholar) that occur along the DNA in a frequency-biased distribution of translational frames (3Fragoso G. John S. Roberts M.S. Hager G.L. Genes Dev. 1995; 9: 1933-1947Crossref PubMed Scopus (155) Google Scholar). All of the glucocorticoid response elements (GREs) in the promoter are associated with the B family of nucleosome frames. Upon activation of the glucocorticoid receptor (GR) this nucleosome region undergoes a transition in structure, which allows the previously excluded factors NF1 and OTF1 to bind to their sites on the promoter (4Cordingley M.G. Riegel A.T. Hager G.L. Cell. 1987; 48: 261-270Abstract Full Text PDF PubMed Scopus (313) Google Scholar, 5Lee H.-L. Archer T.K. Mol. Cell. Biol. 1994; 14: 32-41Crossref PubMed Google Scholar) and may involve the loss of histone H1 (6Bresnick E.H. Bustin M. Marsaud V. Richard-Foy H. Hager G.L. Nucleic Acids Res. 1992; 20: 273-278Crossref PubMed Scopus (183) Google Scholar). The GR also either recruits and/or stabilizes the interaction of the TFIID complex with the template (4Cordingley M.G. Riegel A.T. Hager G.L. Cell. 1987; 48: 261-270Abstract Full Text PDF PubMed Scopus (313) Google Scholar,7Archer T.K. Lefebvre P. Wolford R.G. Hager G.L. Science. 1992; 255: 1573-1576Crossref PubMed Scopus (350) Google Scholar, 8Pennie W.D. Hager G.L. Smith C.L. Mol. Cell. Biol. 1995; 15: 2125-2134Crossref PubMed Scopus (42) Google Scholar). In contrast, analysis of transiently transfected MMTV-reporter constructs has revealed that these templates do not have an ordered nucleosomal repeat, that they are constitutively accessible to NF1, OTF1, and various nucleases, and that GR does not induce any transition in nucleoprotein structure (7Archer T.K. Lefebvre P. Wolford R.G. Hager G.L. Science. 1992; 255: 1573-1576Crossref PubMed Scopus (350) Google Scholar). These results indicate that the GR acts bimodally on the stably replicating template as follows: first, to derepress it through the structural transition and second, to activate it by participating in the formation of an active transcription initiation complex (7Archer T.K. Lefebvre P. Wolford R.G. Hager G.L. Science. 1992; 255: 1573-1576Crossref PubMed Scopus (350) Google Scholar). Since the transient template does not undergo the derepression step, its activity is largely a measure of interactions between soluble factors, and it would not be an adequate model for the interactions of transcription factors with components of ordered chromatin in vivo. Because the two MMTV templates have the same LTR sequences but differ in their nucleoprotein structure, functional differences may represent mechanisms by which ordered chromatin structure participates in regulation of the MMTV promoter. Differences in the behavior of the two templates have been observed in response to butyrate treatment (9Bresnick E.H. John S. Berard D.S. Lefebvre P. Hager G.L. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 3977-3981Crossref PubMed Scopus (114) Google Scholar), activation of cAMP signaling (8Pennie W.D. Hager G.L. Smith C.L. Mol. Cell. Biol. 1995; 15: 2125-2134Crossref PubMed Scopus (42) Google Scholar), and in the kinetics of GR-induced activation (5Lee H.-L. Archer T.K. Mol. Cell. Biol. 1994; 14: 32-41Crossref PubMed Google Scholar). Similar functional differences have been observed in other systems (10Bulla G.A. DeSimone V. Cortese R. Fournier R.E. Genes Dev. 1992; 6: 316-327Crossref PubMed Scopus (43) Google Scholar, 11Cannon P. Kim S.H. Ulich C. Kim S. J. Virol. 1994; 68: 1993-1997Crossref PubMed Google Scholar). The MMTV promoter can also be activated by progesterone, mineralocorticoid, and androgen receptors, all of which bind to the same DNA sequences (12Arriza J.L. Weinberger C. Cerelli G. Glaser T.M. Handelin B.L. Housman D.E. Evans R.M. Science. 1987; 237: 268-275Crossref PubMed Scopus (1651) Google Scholar, 13Cato A.C. Miksicek R. Sch:utz G. Arnemann J. Beato M. EMBO J. 1986; 5: 2237-2240Crossref PubMed Scopus (271) Google Scholar, 14Ham J. Thomson A. Needham M. Webb P. Parker M. Nucleic Acids Res. 1988; 16: 5263-5276Crossref PubMed Scopus (270) Google Scholar, 15Darbre P. Page M. King R.J. Mol. Cell. Biol. 1986; 6: 2847-2854Crossref PubMed Scopus (100) Google Scholar, 16Gowland P.L. Buetti E. Mol. Cell. Biol. 1989; 9: 3999-4008Crossref PubMed Scopus (50) Google Scholar, 17El-Ashry D. Onate S.A. Nordeen S.K. Edwards D.P. Mol. Endocrinol. 1989; 3: 1545-1558Crossref PubMed Scopus (115) Google Scholar, 18Cato A.C. Henderson D. Ponta H. EMBO J. 1987; 6: 363-368Crossref PubMed Scopus (203) Google Scholar). Previously we reported that transiently expressed progesterone receptor (PR) could not efficiently activate the stably replicating template even though it significantly induced transcription from the transient MMTV template (19Smith C.L. Archer T.K. Hamlin-Green G. Hager G.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11202-11206Crossref PubMed Scopus (38) Google Scholar). In the current study we further characterized the activity of transiently expressed PR using a highly efficient cell sorting method involving antibody-coupled magnetic beads (20Padmanabhan R. Howard T. Gottesman M.M. Howard B.H. Methods Enzymol. 1993; 218: 637-651Crossref PubMed Scopus (12) Google Scholar) to isolate cells that have taken up exogenous DNA. We find that the deficiency in PR activation of the stably replicating template represents an inability to induce the necessary chromatin remodeling event. We have also asked whether the deficiency in activation of the stably replicating template is specific to the PR or a common feature of transiently expressed receptors by examining the activity of a transiently expressed GR (21Chakraborti P.K. Garabedian M.J. Yamamoto K.R. Simons Jr., S.S. J. Biol. Chem. 1991; 266: 22075-22078Abstract Full Text PDF PubMed Google Scholar). In contrast to the PR, transiently expressed GR can activate both MMTV templates efficiently and induce the chromatin remodeling event. These results indicate that there are intrinsic differences in the way the two receptors interact with the stably replicating MMTV template which are not manifested on the transiently transfected template. These differences will provide insight into how this family of receptors, which recognize the same DNA sequence, are able to specifically regulate different sets of genesin vivo. Cell line 1471.1 has been described previously (22Archer T.K. Cordingley M.G. Marsaud V. Richard-Foy H. Hager G.L. Gustafsson J.A. Eriksson H. Carlstedt-Duke J. Proceedings: 2nd International CBT Symposium on the Steroid/Thyroid Receptor Family and Gene Regulation.Birkhauser Verlag AG, Berlin. 1989; : 221-238Google Scholar). It contains multiple copies of stably replicating MMTV-CAT transcription unit in the context of bovine papilloma virus sequences and expresses GR but not PR. Cell line 904.13 contains 200 copies of stably replicating MMTV-ras transcription unit in the context of bovine papilloma virus sequences and also expresses only GR (3Fragoso G. John S. Roberts M.S. Hager G.L. Genes Dev. 1995; 9: 1933-1947Crossref PubMed Scopus (155) Google Scholar, 7Archer T.K. Lefebvre P. Wolford R.G. Hager G.L. Science. 1992; 255: 1573-1576Crossref PubMed Scopus (350) Google Scholar). Both cell lines were maintained in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) plus 10% charcoal-stripped serum (Hyclone). Magnetic beads coated with goat anti-mouse IgG were purchased from Dynal and the magnetic plates from BioMag. Various monoclonal antibodies directed against the interleukin 2 receptor (IL2R) were obtained from Amersham Corp., Boehringer Mannheim, and Upstate Biotechnologies, Inc. Previously described plasmids used in this study are as follows: pcPRO (chicken PR expression vector) (23Gronemeyer H. Turcotte B. Quirin-Stricker C. Bocquel M.T. Meyer M.E. Krozowski Z. Jeltsch J.M. Lerouge T. Garnier J.M. Chambon P. EMBO J. 1987; 6: 3985-3994Crossref PubMed Scopus (165) Google Scholar), pLTRluc (full-length MMTV LTR driving luciferase) (24Lefebvre P. Berard D.S. Cordingley M.G. Hager G.L. Mol. Cell. Biol. 1991; 11: 2529-2537Crossref PubMed Scopus (74) Google Scholar), and pCMVIL2R (IL2R expression vector) (25Giordano T. Howard T.H. Coleman J. Sakamoto K. Howard B.H. Exp. Cell Res. 1991; 192: 193-197Crossref PubMed Scopus (24) Google Scholar). MMTV-reporter construct pMTVbgln consists of the full-length LTR (−1187 to +103 bp) driving the expression of the rabbit β-globin gene. It was made by inserting aDra I/Bam HI fragment from pM18 (2Richard-Foy H. Hager G.L. EMBO J. 1987; 6: 2321-2328Crossref PubMed Scopus (450) Google Scholar) containing the LTR region into pMggnOVEC (kindly provided by S. Rusconi) digested withSma I and Bam HI to remove MMTV LTR sequences from a different MMTV strain. The resulting plasmid contained the MMTV LTR fused to β-globin coding sequence from the second exon. To restore the first exon and intron of the β-globin gene, a polymerase chain reaction fragment containing these sequences was inserted. The C656G expression vector, pCI-nH6HA-C656G, was made by insertion of the C656G cDNA (21Chakraborti P.K. Garabedian M.J. Yamamoto K.R. Simons Jr., S.S. J. Biol. Chem. 1991; 266: 22075-22078Abstract Full Text PDF PubMed Google Scholar) (kindly provided by S. Simons) into pCI-nH6HA. This plasmid is derived from pCI (Promega) into which the sequence (sense strand) 5′ GCTAGCGAAGGAGATCCGCCATGGCCCACCATCACCACCATCACGGATATCCATACGACGTGCCAGATTACGCTCAGCTGGAATTC 3′ was inserted at the Nhe I and Eco RI sites. This sequence contains an initial methionine codon, six histidines, and the hemagglutinin A (HA) epitope. The cDNA was inserted such that the receptor would be expressed with the histidine tag and the HA epitope at its amino terminus. Both the CMV and T7 promoters lie upstream of the cDNA. The high level expression vector for the PR, pnH6HA-cPR(B), was made by inserting anEco RV/Kpn I fragment containing the entire coding sequence of the chicken PR except for the first methionine into the Pvu II and Kpn I sites in the polylinker of pCI-nH6HAfs2, a frameshift variant of pCI-nH6HA. The β-actin plasmid (pT7B-Actn-F) used to make the S1 probe contains a 91-bp polymerase chain reaction fragment from the second exon of the mouse β-actin gene in pT7Blue (Novagen). Cell line 1471.1 was transfected by either calcium phosphate coprecipitation using BES-based buffers (26Chen C. Okayama H. Mol. Cell. Biol. 1987; 7: 2745-2752Crossref PubMed Scopus (4824) Google Scholar) or electroporation. Briefly, cells were transfected with a combination of plasmids. In every case (unless noted) transfection was carried out with the IL2R expression vector along with an MMTV-reporter construct (either pLTRluc or pMTVbgln) and a receptor expression vector (pcPRO, pCI-nH6HA-C656G, or pnH6HA-cPR(B)). Amounts of each DNA used are indicated in the figure legends. Electroporation was carried out in a Cell-porator (Life Technologies, Inc.) at 250 V, 800 microfarads with aliquots of 2 × 107 cells in 300 μl of Dulbecco's modified Eagle's medium. Cells were plated after electroporation and were treated and harvested the following day. Transfection by calcium phosphate coprecipitation using BES-based buffers was carried out overnight at 37 °C, 2.9% CO2 on 10-cm dishes (7 × 105 cells), each receiving a total of 20 μg of DNA. The following day cells were re-fed and transferred to 37 °C, 5% CO2. Cells were treated and harvested 2 days after transfection. Magnetic affinity sorting was carried out as described with some modification (20Padmanabhan R. Howard T. Gottesman M.M. Howard B.H. Methods Enzymol. 1993; 218: 637-651Crossref PubMed Scopus (12) Google Scholar). Prior to sorting goat anti-mouse IgG-coated magnetic beads were mixed with IL2R monoclonal antibody at a ratio of 50 mg bead suspension to 50 μg antibody. Beads were diluted in Medium S (4 mm EGTA, 100 μg/ml chondroitin sulfate, 0.1% gelatin, 10 mm Hepes, pH 8.0, 1 mmMgCl2, 1 mm MgSO4, 8 mg/ml non-fat dry milk, and 100 μg/ml bovine serum albumin, all in PBS without Ca2+ or Mg2+) at a ratio of 15 μl bead suspension (50 mg/ml) to 1 ml Medium S. Cells were washed with PBS and incubated with Medium S/bead mixture for 15 min at 37 °C. The cells were washed again with PBS and harvested by brief trypsinization followed by neutralization with trypsin inhibitor. Flasks containing the cells were placed between magnetic plates to separate the beaded cells from the unbeaded cells. The two resulting cell pools were washed several times with PBS, pelleted, and frozen for later analysis. RNA was isolated from cell pools and subjected to S1 nuclease digestion (8–10 μg of RNA per sample) as described previously (19Smith C.L. Archer T.K. Hamlin-Green G. Hager G.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11202-11206Crossref PubMed Scopus (38) Google Scholar), except pMTVbgln digested with Sac I and pT7B-Actn-F digested with eitherEco RI or Spe I were used as templates to make single-stranded probes by multiple rounds of linear primer extension with Taq polymerase and short oligonucleotides homologous to β-globin or β-actin coding sequences. S1 digestion products were separated on 8% denaturing gels that were dried and exposed to PhosphorImaging screens. All quantitation was carried out using ImageQuant software (Molecular Dynamics). Cell extracts used in assays for CAT and luciferase activity were made from sorted cell pools by resuspension of cell pellets in 0.25m Tris, pH 7.5, and three cycles of freezing and thawing. Cellular debris was pelleted, and the supernatant was used in the assays. Protein concentrations were determined by the method of Bradford using protein assay dye (Bio-Rad). Five μg of cellular extract protein from each sample was used for CAT analysis (27Gorman C.M. Moffat L.F. Howard B.H. Mol. Cell. Biol. 1982; 2: 1044-1051Crossref PubMed Scopus (5292) Google Scholar). Visualization of the products was carried out using a Molecular Dynamics PhosphorImager and quantitation with ImageQuant software. Luciferase assays were carried out as described previously (24Lefebvre P. Berard D.S. Cordingley M.G. Hager G.L. Mol. Cell. Biol. 1991; 11: 2529-2537Crossref PubMed Scopus (74) Google Scholar) except that a Microlumat LB 96 P (EGG Berthold) machine was used to measure the luminescence. All values for luciferase activity were normalized to the amount of cellular protein used for each sample. Cytosolic extracts for immunoblotting of steroid receptors were made as follows. Cells from sorted pools were washed with PBS, pelleted, and resuspended in HEGDM (10 mm Hepes, pH 7.4, 1 mm EDTA, 10 mm sodium molybdate, 2 mm dithiothreitol, 10% glycerol) containing 0.1% Nonidet P-40 and a protease inhibitor mixture (0.1 mmphenylmethylsulfonyl fluoride, 0.1 mm benzamidine, 1 μg/ml leupeptin, 5 μg/ml aprotinin). Cell membranes were allowed to lyse for several minutes, and nuclei and cellular debris were pelleted 5 min at 12,000 × g. The supernatants were stored at −80 °C. Proteins were separated by SDS-polyacrylamide gel electrophoresis (3% stacking gel, 8% separating gel) and transferred to Immobilon or Hybond nitrocellulose (Amersham Corp.) for 3–4 h in Tris glycine buffer with 20% methanol at 300 mA. Membranes were blocked for 1 h at room temperature in either Tris-buffered saline (TBS) (10 mm Tris, pH 7.5, 0.14 m NaCl, 2.7 mm KCl, 0.7 mm CaCl2, 0.5 mm MgCl2) containing 2% nonfat dry milk (for anti-GR, -PR antibodies) or 2.5% blocking reagent (Boehringer Mannheim) in 100 mm maleic acid, pH 7.5, 150 mmNaCl (for anti-HA antibody). Incubation with primary antibodies was carried out overnight at 4 °C. Primary antibodies include PA512 (Affinity Bioreagents) against the GR, 12CA5 (kindly provided by W. Dixon and J. Campbell) against the HA epitope, and PR22 (kindly provided by D. Toft) against both isoforms of the chicken PR. Blots were washed several times with TBS containing either 0.1% Tween 20 (for anti-GR, -PR antibodies) or 0.4% Tween 20 (for anti-HA antibody) before exposure to the appropriate secondary antibody for 2 h. Blots were washed as above and exposed to reagents provided in an ECL or ECF kit (Amersham Corp.). In the case of detection by enhanced chemiluminescence, the membranes were exposed to XAR-5 film (Kodak) for 1 min or less. For analysis with ECF, membranes were scanned with a Molecular Dynamics Storm 860 instrument in the blue fluorescence mode. Cells transfected with the IL2R expression vector and either pcPRO, pCI-nH6HA-C656G, or pnH6HA-cPR(B) were treated with hormones for 1 h in Medium S. Antibody-coated beads were added 15 min before harvest. Cells were harvested by brief trypsinization and neutralization with trypsin inhibitor. After a brief sort, nuclei were isolated from sorted cell populations as described previously (8Pennie W.D. Hager G.L. Smith C.L. Mol. Cell. Biol. 1995; 15: 2125-2134Crossref PubMed Scopus (42) Google Scholar). Sac I digestion of nuclei was carried out at 30 °C for 15 min in 50 mmNaCl, 50 mm Tris, pH 8.0, 1 mmMgCl2, 1 mm β-mercaptoethanol, 2.5% glycerol at a Sac I concentration of 10 units per μg of DNA. The reaction was terminated by the addition of 5 volumes of 10 mm Tris, pH 7.5, 10 mm EDTA, 0.5% SDS, and 100 μg/ml proteinase K. DNA was purified by phenol/chloroform/isoamyl alcohol extraction and digested to completion with Dpn II. An end-labeled oligonucleotide containing MMTV-transcribed sequences (+1 to +27 bp) was used in multiple rounds of linear amplification withTaq polymerase to detect digestion products. We have designed a system in which the activity of transiently expressed steroid receptors can be monitored on two types of MMTV templates. The first stably replicates, being either episomal or integrated, and consists of the full-length LTR driving expression of the CAT gene (22Archer T.K. Cordingley M.G. Marsaud V. Richard-Foy H. Hager G.L. Gustafsson J.A. Eriksson H. Carlstedt-Duke J. Proceedings: 2nd International CBT Symposium on the Steroid/Thyroid Receptor Family and Gene Regulation.Birkhauser Verlag AG, Berlin. 1989; : 221-238Google Scholar). Its chromatin structure is characterized by an ordered array of non-randomly positioned nucleosomes (2Richard-Foy H. Hager G.L. EMBO J. 1987; 6: 2321-2328Crossref PubMed Scopus (450) Google Scholar, 3Fragoso G. John S. Roberts M.S. Hager G.L. Genes Dev. 1995; 9: 1933-1947Crossref PubMed Scopus (155) Google Scholar). The access of general transcription factors such as NF1 and OTF1 to this template is largely inhibited in the absence of hormone (4Cordingley M.G. Riegel A.T. Hager G.L. Cell. 1987; 48: 261-270Abstract Full Text PDF PubMed Scopus (313) Google Scholar, 5Lee H.-L. Archer T.K. Mol. Cell. Biol. 1994; 14: 32-41Crossref PubMed Google Scholar) reflecting a structure that is repressive to transcription. The activated GR binds to its sites that lie within the B family of nucleosomes and causes a structural transition that results in a more open and accessible structure (2Richard-Foy H. Hager G.L. EMBO J. 1987; 6: 2321-2328Crossref PubMed Scopus (450) Google Scholar, 28Archer T.K. Cordingley M.G. Wolford R.G. Hager G.L. Mol. Cell. Biol. 1991; 11: 688-698Crossref PubMed Scopus (294) Google Scholar). The second template is a transiently transfected reporter construct consisting of the full-length LTR driving the expression of the luciferase or β-globin genes. Its nucleoprotein structure is characterized by the lack of an ordered nucleosome repeat and a constitutively open conformation, which allows access of transcription factors NF1 and OTF1 in the absence of hormone (7Archer T.K. Lefebvre P. Wolford R.G. Hager G.L. Science. 1992; 255: 1573-1576Crossref PubMed Scopus (350) Google Scholar). Activated GR does not induce any apparent transition in structure but does cause the increased association of the TFIID complex with the template. Since these two types of MMTV template have the same LTR sequence, differences in their function are most likely a result of their differing structures. To measure the activity of transfected receptors on stably replicating templates, it was necessary to sort the transfected cells into a fraction enriched in those cells that express the exogenous DNA, because the receptors are expressed in only a fraction of the total cell population. In our previous study (19Smith C.L. Archer T.K. Hamlin-Green G. Hager G.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11202-11206Crossref PubMed Scopus (38) Google Scholar) this was accomplished by fluorescence-activated cell sorting, a lengthy procedure that was limited for the number of conditions examined. In this study we have employed a highly efficient magnetic affinity-based cell sorting procedure (20Padmanabhan R. Howard T. Gottesman M.M. Howard B.H. Methods Enzymol. 1993; 218: 637-651Crossref PubMed Scopus (12) Google Scholar) (Fig. 1). Cells containing stably replicating MMTV templates were transfected with an MMTV-reporter construct, a receptor expression vector, and an expression vector for the Tac subunit (29Waldmann T.A. Science. 1986; 232: 727-732Crossref PubMed Scopus (356) Google Scholar) of interleukin 2 receptor (IL2R). Monoclonal antibodies that recognize the extracellular region of the IL2R subunit were used to coat magnetic beads with anti-mouse immunoglobulins attached. These beads bound only to cells that took up exogenous DNA and expressed the IL2R. After trypsinization, the beaded cells were separated from the non-transfected cells with the use of magnets. The cell pools were then used as sources of RNA, DNA, or cytosolic fractions. The IL2R-expressing population of cells is highly enriched for the transient template and the transiently expressed receptor. Previously we determined that, unlike endogenous GR, transiently expressed PR was not able to significantly activate an integrated MMTV template (19Smith C.L. Archer T.K. Hamlin-Green G. Hager G.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11202-11206Crossref PubMed Scopus (38) Google Scholar). In contrast, a transient MMTV template was efficiently activated by PR. Because of the length of the FACS-based sorting procedure, we could not, in the same experiment, sort dexamethasone (Dex)-treated cells in addition to non-treated and R5020-treated cells. Therefore, we were unable to directly compare the abilities of the endogenous GR and the transiently expressed PR to activate the transient template. Since its nucleoprotein structure is non-ordered and accessible, activation of the transient template is most likely a reflection of interactions between soluble factors and DNA rather than between soluble factors and chromatin components. Therefore, the activity of the various receptors on this template is a measure of their potential as transactivators at the MMTV promoter in a given cell type. Determination of relative transactivation potentials is important for assessing the abilities of various receptors to activate the stably replicating template and evaluating the impact of nucleoprotein architecture on this process. Using the magnetic affinity cell sorting procedure, we examined the activity of the transiently expressed PR relative to the endogenous GR. Cells were transfected with expression vectors for the IL2R and the chicken PR as well as an MMTV/β-globin reporter construct. After sorting, RNA was isolated and analyzed by S1 nuclease protection assay with a probe that differentiates between transcripts generated from the stably replicating and transient MMTV templates. Also included was a probe to detect β-actin transcripts that served as an internal standard. Fig. 2 A shows a representative experiment. Both the endogenous GR and the transiently expressed PR activated the transient MMTV template to approximately the same extent. However, whereas the GR induced a large increase in the level of mRNA generated from the stably replicating template (40-fold in this experiment), the PR induced only a weak response (4-fold). Fig.2 B shows the average relative activities of the two receptors from multiple experiments. The transiently expressed PR is approximately 7 times less active than the endogenous GR on the stable template but is just as efficient in activating the transient template. One possible explanation for the differential in transactivation is that the two template types compete for the PR, the transient template being more successful, perhaps given its quantity or more accessible structure. Therefore, we carried out the same experiment in the absence of the MMTV-reporter construct. Fig. 2 C shows that the PR was still a weak activator (5-fold induction in this experiment) of the stable template. Therefore, the function of the PR at the stably replicating template is independent of the relative amounts of templates present and reflects a true deficiency in activity uniquely associated with some property of the stably replicated template. To determine whether the concentration of PR in the transfected cells affected its ability to transactivate the two templates, titration of the transfected PR expression vector was carried out. Increasing amounts were transfected into 1471.1 cells along with the IL2R expression vector, and an MMTV-reporter construct, in which the full-length LTR directs expression of luciferase. Fig.3, A and B, shows the titration curves for the stably replicating and transient MMTV templates. In each case the induction by Dex remained relatively constant over the range of PR expression vector transfected. For the transient template, inductions by R5020 increased (reaching the level of Dex inductions), peaked, and then declined, probably due to squelching. In the case of the stable template, R5020 inductions increased initially and then plateaued at a low level, approximately 20% of the Dex induction, which correlates well with the RNA data shown in Fig. 2 B. An immunoblot of cytosols from transfected cells shows the accumulation of PR as the amount of expression vector transfected increased (Fig.3 C). The ex
Referência(s)