Portal de Periódicos da CAPES

A risk haplotype in the Solute Carrier Family 22A4/22A5 gene cluster influences phenotypic expression of Crohn’s disease

2005; Elsevier BV; Volume: 128; Issue: 2 Linguagem: Inglês

10.1053/j.gastro.2004.11.056

1528-0012

William G. Newman, Xiangjun Gu, Richard F. Wintle, David W. Cescon, Mehrdad Yazdanpanah, Xiangdong Liu, Vanya Peltekova, Mark Van Oene, Christopher I. Amos, Katherine A. Siminovitch,

Eosinophilic Esophagitis

Background & Aims: Previously, we identified 2 functionally relevant polymorphisms in the SLC22A4/22A5 genes at the IBD5 locus that alter gene/protein function and comprise a 2-allele haplotype (SLC22A-TC) associated with increased risk for Crohn's disease (CD). Here we examine the contribution of this susceptibility haplotype alone and in combination with CARD15 variants to CD subphenotypes and to susceptibility to ulcerative colitis (UC). Methods: Phenotype-genotype associations were evaluated in a Canadian cohort including 507 patients with CD, 216 patients with UC, and 352 ethnically matched controls genotyped for SLC22A4 C1672T, SLC22A5 G-207C, and the major CD-associated CARD15 variants. Results: The SLC22A-TC haplotype was strongly associated (P < .0001) with CD in the non-Jewish subgroup of this cohort, and the combination of SLC22A-TC homozygosity and one or more of the common CARD15 disease susceptibility alleles engendered a 7.5-fold increase in risk for CD (P = 9 × 10−8) and a 4.5-fold increase in risk for ileal disease (P = .001). The risk haplotype showed only a suggestive association with CD in the Jewish subgroup and no association with UC in the cohort or in subgroups stratified by CARD15 genotypes. Conclusions: The SLC22A-TC haplotype acts together with CARD15 disease susceptibility alleles to increase risk for CD and ileal disease among CD patients but does not contribute to risk for UC in this Canadian cohort. The association of the SLC22A-TC haplotype and CARD15 alleles with ileal disease suggests that these variants have biologically intertwined effects in the pathogenesis of CD. Background & Aims: Previously, we identified 2 functionally relevant polymorphisms in the SLC22A4/22A5 genes at the IBD5 locus that alter gene/protein function and comprise a 2-allele haplotype (SLC22A-TC) associated with increased risk for Crohn's disease (CD). Here we examine the contribution of this susceptibility haplotype alone and in combination with CARD15 variants to CD subphenotypes and to susceptibility to ulcerative colitis (UC). Methods: Phenotype-genotype associations were evaluated in a Canadian cohort including 507 patients with CD, 216 patients with UC, and 352 ethnically matched controls genotyped for SLC22A4 C1672T, SLC22A5 G-207C, and the major CD-associated CARD15 variants. Results: The SLC22A-TC haplotype was strongly associated (P < .0001) with CD in the non-Jewish subgroup of this cohort, and the combination of SLC22A-TC homozygosity and one or more of the common CARD15 disease susceptibility alleles engendered a 7.5-fold increase in risk for CD (P = 9 × 10−8) and a 4.5-fold increase in risk for ileal disease (P = .001). The risk haplotype showed only a suggestive association with CD in the Jewish subgroup and no association with UC in the cohort or in subgroups stratified by CARD15 genotypes. Conclusions: The SLC22A-TC haplotype acts together with CARD15 disease susceptibility alleles to increase risk for CD and ileal disease among CD patients but does not contribute to risk for UC in this Canadian cohort. The association of the SLC22A-TC haplotype and CARD15 alleles with ileal disease suggests that these variants have biologically intertwined effects in the pathogenesis of CD. Crohn's disease (CD) and ulcerative colitis (UC) are chronic inflammatory bowel diseases (IBDs) with a combined population prevalence of up to 5/1000.1Loftus Jr, E.V. Sandborn W.J. Epidemiology of inflammatory bowel disease.Gastroenterol Clin North Am. 2002; 31: 1-20Google Scholar CD may affect any part of the gastrointestinal tract, although the distal ileum is most commonly involved, and the inflammation is transmural and characteristically complicated by strictures, perforation, and/or fistulae. By contrast, inflammation in UC is restricted to the mucosa and to the large bowel. Both of these conditions seem to have a multifactorial etiology involving a complex interplay of genetic and environmental interactions and prominent roles for intestinal microflora and imbalance in T-cell cytokine responses.2Fiocchi C. Inflammatory bowel disease etiology and pathogenesis.Gastroenterology. 1998; 115: 182-205Google Scholar, 3Elson C.O. Genes, microbes, and T cells—new therapeutic targets in Crohn's disease.N Engl J Med. 2002; 346: 614-616Google Scholar The familial occurrence of IBD has been recognized for more than 40 years,4Kirsner J.B. Spencer J.A. Familial occurrences of ulcerative colitis, region enteritis and ileocolitis.Ann Intern Med. 1963; 59: 133-144Google Scholar and data on twin concordance,5Orholm M. Binder V. Sorensen T.I. Rasmussen L.P. Kyvik K.O. Concordance of inflammatory bowel disease among Danish twins. Results of a nationwide study.Scand J Gastroenterol. 2000; 35: 1075-1081Google Scholar family aggregation,6Orholm M. Munkholm P. Langholz E. Nielsen O.H. Sorensen I.A. Binder V. Familial occurrence of inflammatory bowel disease.N Engl J Med. 1991; 324: 84-88Google Scholar and, most recently, from genome-wide screens of IBD families have provided compelling evidence of the significant contributions of heritable factors to these conditions.7Newman B. Siminovitch K.A. Inflammatory bowel disease Crohn's disease and the success of NODern genetics.Clin Invest Med. 2003; 26: 303Google Scholar Cumulative linkage data from genome screens and locus-specific replication studies have also confirmed the multigenic basis of IBD, with the available data suggesting that, at a minimum, IBD susceptibility loci are present on chromosomes 16q, 12q, 6p, 14q, 5q, and 19p.8Hugot J.P. Laurent-Puig P. Gower-Rousseau C. Olson J.M. Lee J.C. Beaugerie L. Naom I. Dupas J.L. Van Gossum A. Orholm M. Bonaiti-Pellie C. Weissenbach J. Mathew C.G. Lennard-Jones J.E. Cortot A. Colombel J.F. Thomas G. Mapping of a susceptibility locus for Crohn's disease on chromosome 16.Nature. 1996; 379: 821-823Google Scholar, 9Cavanaugh J. International collaboration provides convincing linkage replication in complex disease through analysis of a large pooled data set Crohn disease and chromosome 16.Am J Hum Genet. 2001; 68: 1165-1171Google Scholar, 10Duerr R.H. Barmada M.M. Zhang L. Davis S. Preston R.A. Chensny L.J. Brown J.L. Ehrlich G.D. Weeks D.E. Aston C.E. Linkage and association between inflammatory bowel disease and a locus on chromosome 12.Am J Hum Genet. 1998; 63: 95-100Google Scholar, 11Curran M.E. Lau K.F. Hampe J. Schreiber S. Bridger S. Macpherson A.J. Cardon L.R. Sakul H. Harris T.J. Stokkers P. Van Deventer S.J. Mirza M. Raedler A. Kruis W. Meckler U. Theuer D. Herrmann T. Gionchetti P. Lee J. Mathew C. Lennard-Jones J. Genetic analysis of inflammatory bowel disease in a large European cohort supports linkage to chromosomes 12 and 16.Gastroenterology. 1998; 115: 1066-1071Google Scholar, 12Parkes M. Barmada M.M. Satsangi J. Weeks D.E. Jewell D.P. Duerr R.H. The IBD2 locus shows linkage heterogeneity between ulcerative colitis and Crohn disease.Am J Hum Genet. 2000; 67: 1605-1610Google Scholar, 13Hampe J. Shaw S.H. Saiz R. Leysens N. Lantermann A. Mascheretti S. Lynch N.J. MacPherson A.J. Bridger S. van Deventer S. Stokkers P. Morin P. Mirza M.M. Forbes A. Lennard-Jones J.E. Mathew C.G. Curran M.E. Schreiber S. Linkage of inflammatory bowel disease to human chromosome 6p.Am J Hum Genet. 1999; 65: 1647-1655Google Scholar, 14Rioux J.D. Silverberg M.S. Daly M.J. Steinhart A.H. McLeod R.S. Griffiths A.M. Green T. Brettin T.S. Stone V. Bull S.B. Bitton A. Williams C.N. Greenberg G.R. Cohen Z. Lander E.S. Hudson T.J. Siminovitch K.A. Genomewide search in Canadian families with inflammatory bowel disease reveals two novel susceptibility loci.Am J Hum Genet. 2000; 66: 1863-1870Google Scholar, 15Duerr R.H. Barmada M.M. Zhang L. Pfutzer R. Weeks D.E. High-density genome scan in Crohn disease shows confirmed linkage to chromosome 14q11-12.Am J Hum Genet. 2000; 66: 1857-1862Google Scholar, 16van Heel D.A. Dechairo B.M. Dawson G. McGovern D.P. Negoro K. Carey A.H. Cardon L.R. Mackay I. Jewell D.P. Lench N.J. The IBD6 Crohn's disease locus demonstrates complex interactions with CARD15 and IBD5 disease-associated variants.Hum Mol Genet. 2003; 12: 2569-2575Google Scholar, 17Van Heel D.A. Fisher S.A. Kirby A. Daly M.J. Rioux J.D. Lewis C.M. Inflammatory bowel disease susceptibility loci defined by genome scan meta-analysis of 1952 affected relative pairs.Hum Mol Genet. 2004; 13: 763-770Google Scholar Despite this genetic complexity, the IBD gene at the IBD1 locus on chromosome 16 has been successfully identified as the CARD15/NOD2 gene18Hugot J.P. Chamaillard M. Zouali H. Lesage S. Cezard J.P. Belaiche J. Almer S. Tysk C. O'Morain C.A. Gassull M. Binder V. Finkel Y. Cortot A. Modigliani R. Laurent-Puig P. Gower-Rousseau C. Macry J. Colombel J.F. Sahbatou M. Thomas G. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's disease.Nature. 2001; 411: 599-603Google Scholar, 19Ogura Y. Bonen D.K. Inohara N. Nicolae D.L. Chen F.F. Ramos R. Britton H. Moran T. Karaliuskas R. Duerr R.H. Achkar J.P. Brant S.R. Bayless T.M. Kirschner B.S. Hanauer S.B. Nunez G. Cho J.H. A frameshift mutation in NOD2 associated with susceptibility to Crohn's disease.Nature. 2001; 411: 603-606Google Scholar, 20Hampe J. Cuthbert A. Croucher P.J. Mirza M.M. Mascheretti S. Fisher S. Frenzel H. King K. Hasselmeyer A. MacPherson A.J. Bridger S. van Deventer S. Forbes A. Nikolaus S. Lennard-Jones J.E. Foelsch U.R. Krawczak M. Lewis C. Schreiber S. Mathew C.G. Association between insertion mutation in NOD2 gene and Crohn's disease in German and British populations.Lancet. 2001; 357: 1925-1928Google Scholar and CARD15 variants have been shown to be associated with CD in many independently studied IBD patient populations.21Cuthbert A.P. Fisher S.A. Mirza M.M. King K. Hampe J. Croucher P.J. Mascheretti S. Sanderson J. Forbes A. Mansfield J. Schreiber S. Lewis C.M. Mathew C.G. The contribution of NOD2 gene mutations to the risk and site of disease in inflammatory bowel disease.Gastroenterology. 2002; 122: 867-874Abstract Full Text Full Text PDF Scopus (630) Google Scholar, 22Lesage S. Zouali H. Cezard J.P. Colombel J.F. Belaiche J. Almer S. Tysk C. O'Morain C. Gassull M. Binder V. Finkel Y. Modigliani R. Gower-Rousseau C. Macry J. Merlin F. Chamaillard M. Jannot A.S. Thomas G. Hugot J.P. EPWG-IBD Group; EPIMAD Group; GETAID GroupCARD15/NOD2 mutational analysis and genotype-phenotype correlation in 612 patients with inflammatory bowel disease.Am J Hum Genet. 2002; 70: 845-857Google Scholar, 23Newman B. Silverberg M.S. Gu X. Zhang Q. Lazaro A. Steinhart A.H. Greenberg G.R. Griffiths A.M. McLeod R.S. Cohen Z. Fernandez-Vina M. Amos C.I. Siminovitch K. CARD15 and HLA DRB1 alleles influence susceptibility and disease localization in Crohn's disease.Am J Gastroenterol. 2004; 99: 306-315Google Scholar Analyses of CARD15 genotypes in relation to CD patient phenotypes have also consistently shown CARD15 variant alleles to be associated with ileal disease and thereby validated the potential utility of genetic data in stratifying patient populations.21Cuthbert A.P. Fisher S.A. Mirza M.M. King K. Hampe J. Croucher P.J. Mascheretti S. Sanderson J. Forbes A. Mansfield J. Schreiber S. Lewis C.M. Mathew C.G. The contribution of NOD2 gene mutations to the risk and site of disease in inflammatory bowel disease.Gastroenterology. 2002; 122: 867-874Abstract Full Text Full Text PDF Scopus (630) Google Scholar, 22Lesage S. Zouali H. Cezard J.P. Colombel J.F. Belaiche J. Almer S. Tysk C. O'Morain C. Gassull M. Binder V. Finkel Y. Modigliani R. Gower-Rousseau C. Macry J. Merlin F. Chamaillard M. Jannot A.S. Thomas G. Hugot J.P. EPWG-IBD Group; EPIMAD Group; GETAID GroupCARD15/NOD2 mutational analysis and genotype-phenotype correlation in 612 patients with inflammatory bowel disease.Am J Hum Genet. 2002; 70: 845-857Google Scholar, 23Newman B. Silverberg M.S. Gu X. Zhang Q. Lazaro A. Steinhart A.H. Greenberg G.R. Griffiths A.M. McLeod R.S. Cohen Z. Fernandez-Vina M. Amos C.I. Siminovitch K. CARD15 and HLA DRB1 alleles influence susceptibility and disease localization in Crohn's disease.Am J Gastroenterol. 2004; 99: 306-315Google Scholar Previously, our group and others have also reported linkage between a locus (IBD5) on chromosome 5q31 and CD.14Rioux J.D. Silverberg M.S. Daly M.J. Steinhart A.H. McLeod R.S. Griffiths A.M. Green T. Brettin T.S. Stone V. Bull S.B. Bitton A. Williams C.N. Greenberg G.R. Cohen Z. Lander E.S. Hudson T.J. Siminovitch K.A. Genomewide search in Canadian families with inflammatory bowel disease reveals two novel susceptibility loci.Am J Hum Genet. 2000; 66: 1863-1870Google Scholar, 24Ma Y. Ohmen J.D. Li Z. Bentley L.G. McElree C. Pressman S. Targan S.R. Fischel-Ghodsian N. Rotter J.I. Yang H. A genome-wide search identifies potential new susceptibility loci for Crohn's disease.Inflamm Bowel Dis. 1999; 5: 271-278Google Scholar Using linkage disequilibrium methods, the IBD5 region was subsequently refined to an ∼250-kilobase interval defined by an 11-allele single nucleotide polymorphism (SNP) haplotype25Rioux J.D. Daly M.J. Silverberg M.S. Lindblad K. Steinhart H. Cohen Z. Delmonte T. Kocher K. Miller K. Guschwan S. Kulbokas E.J. O'Leary S. Winchester E. Dewar K. Green T. Stone V. Chow C. Cohen A. Langelier D. Lapointe G. Gaudet D. Faith J. Branco N. Bull S.B. McLeod R.S. Griffiths A.M. Bitton A. Greenberg G.R. Lander E.S. Siminovitch K.A. Hudson T.J. Genetic variation in the 5q31 cytokine gene cluster confers susceptibility to Crohn disease.Nat Genet. 2001; 29: 223-228Google Scholar since used by several groups to replicate the association of IBD5 with CD.26Giallourakis C. Stoll M. Miller K. Hampe J. Lander E.S. Daly M.J. Schreiber S. Rioux J.D. IBD5 is a general risk factor for inflammatory bowel disease replication of association with Crohn disease and identification of a novel association with ulcerative colitis.Am J Hum Genet. 2003; 73: 205-211Google Scholar, 27Mirza M.M. Fisher S.A. King K. Cuthbert A.P. Hampe J. Sanderson J. Mansfield J. Donaldson P. Macpherson A.J. Forbes A. Schreiber S. Lewis C.M. Mathew C.G. Genetic evidence for interaction of the 5q31 cytokine locus and the CARD15 gene in Crohn disease.Am J Hum Genet. 2003; 72: 1018-1022Google Scholar, 28Armuzzi A. Ahmad T. Ling K.L. de Silva A. Cullen S. van Heel D. Orchard T.R. Welsh K.I. Marshall S.E. Jewell D.P. Genotype-phenotype analysis of the Crohn's disease susceptibility haplotype on chromosome 5q31.Gut. 2003; 52: 1133-1139Google Scholar, 29Negoro K. McGovern D.P. Kinouchi Y. Takahashi S. Lench N.J. Shimosegawa T. Carey A. Cardon L.R. Jewell D.P. van Heel D.A. Analysis of the IBD5 locus and potential gene-gene interactions in Crohn's disease.Gut. 2003; 52: 541-546Google Scholar More recently, we have identified 2 novel polymorphisms in the SLC22A4 and SLC22A5 genes within this region and have shown significant association of CD with a 2-allele SLC22A4/SLC22A5 risk haplotype (SLC22A-TC).30Peltekova V.D. Wintle R.F. Rubin L.A. Amos C.I. Huang Q. Gu X. Newman B. Van Oene M. Cescon D. Greenberg G. Griffiths A.M. St George-Hyslop P.H. Siminovitch K.A. Functional variants of OCTN cation transporter genes are associated with Crohn's disease.Nat Genet. 2004; 36: 471-475Google Scholar SLC22A4 and SLC22A5, respectively, encode the organic cation transporters, OCTN1 and OCTN2, known to mediate the transport of carnitine and a wide range of organic cations.31Burckhardt G. Wolff N.A. Structure of renal organic anion and cation transporters.Am J Physiol Renal Physiol. 2000; 278: F853-F866Google Scholar The 2 CD-associated SLC22A4/SLC22A5 polymorphisms (a T substitution of C1672 in exon 9 of the SLC22A4 gene and a G to C transversion in the SLC22A5 promoter region) result in phenylalanine replacement of the leucine residue in OCTN1 codon 503 (L503F) and disrupt a heat shock element 207 base pairs upstream of the OCTN2 translation initiation codon. These alterations both have deleterious biological effects, with the 503F substitution engendering marked changes in OCTN1 transporter activity and the -207C variant impairing OCTN2 promoter function.30Peltekova V.D. Wintle R.F. Rubin L.A. Amos C.I. Huang Q. Gu X. Newman B. Van Oene M. Cescon D. Greenberg G. Griffiths A.M. St George-Hyslop P.H. Siminovitch K.A. Functional variants of OCTN cation transporter genes are associated with Crohn's disease.Nat Genet. 2004; 36: 471-475Google Scholar These functional and genetic data thus identify these SLC22A4/SLC22A5 polymorphisms as the susceptibility alleles within the IBD5 region that contribute to CD susceptibility. The discovery of SLC22A41672T and SLC22A5-207C alleles conferring risk for CD provides an opportunity to determine whether the SLC22A4/SLC22A5 susceptibility alleles, like the CD-associated CARD15 alleles, impact on disease location, age at onset, or other facets of clinical presentation. Accordingly, we have examined and report here on the relationship between the SLC22A4/SLC22A5 susceptibility haplotype and phenotypic characteristics of CD. The relevance of the CD-associated SLC22A4/SLC22A5 alleles to UC as well as their possible interactions with CARD15 alleles are also investigated. All patients were recruited to the study through the Mount Sinai Hospital IBD Genetics Project,32McLeod R.S. Steinhart A.H. Siminovitch K.A. Greenberg G.R. Bull S.B. Blair J.E. Cruz C.R. Barton P.M. Cohen Z. Preliminary report on the Mount Sinai Hospital Inflammatory Bowel Disease Genetics Project.Dis Colon Rectum. 1997; 40: 553-557Google Scholar a study approved by the hospital institutional review board and ethics committee of the University of Toronto. The diagnosis of CD or UC and determination of disease location were based on a minimum of 2 clinical episodes with confirmatory endoscopic, radiologic, or histologic features.33Lennard-Jones J.E. Classification of inflammatory bowel disease.Scand J Gastroenterol Suppl. 1989; 170: 2-6Google Scholar Sites of disease were determined by colonoscopy, barium studies, and histologic findings, with ileal involvement based on small bowel enema and/or laparotomy findings. Because many patients had multiple sites of disease involvement, site of disease was not exclusively assigned and disease location was expressed as proportion of patients with any involvement at specific sites. The patients with CD (Jewish, n = 135; non-Jewish, n = 372) and healthy controls (Jewish, n = 88; non-Jewish, n = 264) represent the subject cohort previously used to demonstrate CD association with the SLC22A4/SLC22A5 haplotype,30Peltekova V.D. Wintle R.F. Rubin L.A. Amos C.I. Huang Q. Gu X. Newman B. Van Oene M. Cescon D. Greenberg G. Griffiths A.M. St George-Hyslop P.H. Siminovitch K.A. Functional variants of OCTN cation transporter genes are associated with Crohn's disease.Nat Genet. 2004; 36: 471-475Google Scholar and their clinical and demographic information has been reported elsewhere.23Newman B. Silverberg M.S. Gu X. Zhang Q. Lazaro A. Steinhart A.H. Greenberg G.R. Griffiths A.M. McLeod R.S. Cohen Z. Fernandez-Vina M. Amos C.I. Siminovitch K. CARD15 and HLA DRB1 alleles influence susceptibility and disease localization in Crohn's disease.Am J Gastroenterol. 2004; 99: 306-315Google Scholar Clinical characteristics of the patients with UC (n = 216) included in this study have not been previously reported. The control subjects were randomly selected from 1000 anonymized samples originally collected as part of a population-based survey of healthy individuals. "Medical treatment" is used to describe disease managed entirely with drugs, whereas "surgical treatment" indicates treatment including at least one bowel resection. Genotyping of the SLC22A4 C1672T, SLC22A5 G-207C, and IGR2078a_1 SNPs was performed as previously described.30Peltekova V.D. Wintle R.F. Rubin L.A. Amos C.I. Huang Q. Gu X. Newman B. Van Oene M. Cescon D. Greenberg G. Griffiths A.M. St George-Hyslop P.H. Siminovitch K.A. Functional variants of OCTN cation transporter genes are associated with Crohn's disease.Nat Genet. 2004; 36: 471-475Google Scholar Briefly, single base extension reactions were performed using polymerase chain reaction primer sequences as follows: C1672T forward, TTTACAGGTGCTTACAACAGAATG; reverse, TCTAAGGTTTCTGGAAGAGTCATT; SNP location, CCTFATTGGAATC[C/T]TCA CCCTTTTTTTC; G-207C forward, GCGCTAGAGGA GCGAGTTC; reverse, CGGTCACCTC GTCGTAGTCCC; SNP location, GCGGCCCAGGCC CG[G/C]AACCTTCCCT; and IGR2078a_1 forward, ACGTTGGATGAGCTGACTGTCATTACCCAC; reverse, ACGTTGGA TGAGTGCTGAGGCTCTGACAAC; SNP location, GGCAGGGTGGGGAGAA[A/G]GCCAG ACTCAGGGTG. Polymorphic alleles were detected using either a Sequenom MassArray (Sequenom, San Diego, CA) or a Beckman Coulter GenomeLab SNPstream (Beckman Coulter, Fullerton, CA). Genotype calls were based on either mass/charge ratio of ionized extension products (Sequenom system) or incorporation of 2 fluorescent dyes corresponding to either possible base at the SNP site and detection via low-density microarray analysis (Beckman system). Genotyping of the CARD15 Arg702Trp, Gly908Arg, Leu1007fsinsC, Pro268Ser, and JW1 (IVS8 + 158 [C → T]) variants was performed using allele-specific polymerase chain reaction amplification, TaqMan biallelic discrimination, or restriction endonuclease digestion as previously described.23Newman B. Silverberg M.S. Gu X. Zhang Q. Lazaro A. Steinhart A.H. Greenberg G.R. Griffiths A.M. McLeod R.S. Cohen Z. Fernandez-Vina M. Amos C.I. Siminovitch K. CARD15 and HLA DRB1 alleles influence susceptibility and disease localization in Crohn's disease.Am J Gastroenterol. 2004; 99: 306-315Google Scholar Expectation-maximization estimation34Bilmes J.A. A gentle tutorial of the EM algorithm and its application to parameter estimation for Gaussian mixture and hidden Markov models (technical report). International Computer Science Institute, Berkeley, CA1998Google Scholar of pairwise haplotype frequencies and linkage disequilibrium calculations were made using the EMLD program (http://request.mdacc.tmc.edu/∼qhuang/Software/pub.htm) and haplotype analysis software in Stata 8.0 (Stata Corp, College Station, TX). The expectation-maximization algorithm incorporates an iterative gene-counting method and maximization of likelihood estimates of haplotype frequencies to provide a maximum likelihood estimate of haplotype frequency distributions among cases and controls.35Stephens M. Donnelly P. A comparison of Bayesian methods for haplotype reconstruction from population genotype data.Am J Hum Genet. 2003; 73: 1162-1169Google Scholar In classifying SLC22A diplotypes, the homozygous risk (+/+) and wild-type (−/−) diplotypes were assigned to individuals with 2 copies of SLC22A-TC or SLC22A wild-type haplotypes, respectively, and the heterozygous SLC22A configuration (+/−) was assigned to individuals having one copy of the SLC22A-TC risk haplotype and one copy of either the SLC22A wild-type haplotype or a haplotype containing one SLC22A risk and one wild-type allele. Contingency table analysis and likelihood ratio testing36Xie X. Ott J. Testing linkage disequilibrium between a disease gene and marker loci.Am J Hum Genet. 1993; 53: 1107Google Scholar were used to evaluate relationships between CD or UC and the SLC22A4 and SLC22A5 genotypes, TC haplotype, and CARD15 variants. Relative risks/odds ratios (ORs) were calculated using standard logistic regression methods and processed by SAS version 8.2 for analyses.37SAS Online Doc Inc. SAS Institute, Inc, S.I. Cary, NC1999Google Scholar Fisher exact test was used to obtain significance in instances in which the number of individuals in any cell was <5. The population attributable risk (PAR) percentages were calculated as previously described.23Newman B. Silverberg M.S. Gu X. Zhang Q. Lazaro A. Steinhart A.H. Greenberg G.R. Griffiths A.M. McLeod R.S. Cohen Z. Fernandez-Vina M. Amos C.I. Siminovitch K. CARD15 and HLA DRB1 alleles influence susceptibility and disease localization in Crohn's disease.Am J Gastroenterol. 2004; 99: 306-315Google Scholar All SNP allele frequencies were checked for consistency with Hardy-Weinberg equilibrium by the χ2 method. Survival curves (years until age of disease diagnosis) were calculated by the Kaplan-Meier method.38Klein J.P. Moeschberger M.L. Survival analysis. Springer, New York1997Google Scholar By genotyping 2 sequentially collected CD patient cohorts for SNPs within the SLC22A4 and SLC22A5 genes, we previously identified 2 variants in these genes that create a 2-allele risk haplotype (SLC22A-TC) significantly enriched in CD cases.30Peltekova V.D. Wintle R.F. Rubin L.A. Amos C.I. Huang Q. Gu X. Newman B. Van Oene M. Cescon D. Greenberg G. Griffiths A.M. St George-Hyslop P.H. Siminovitch K.A. Functional variants of OCTN cation transporter genes are associated with Crohn's disease.Nat Genet. 2004; 36: 471-475Google Scholar The relevance of this haplotype to IBD subphenotypes was now investigated in these patients with CD as well as a cohort of patients with UC; the demographic and clinical characteristics of these patients are shown in Table 1. Importantly, the SLC22A4/SLC22A5 CD risk variants are in strong linkage disequilibrium with one another (D′ = .87; r2 = .52) as well as with other polymorphic alleles within a so-called "IBD5 risk haplotype" shown previously to be associated with, although not causally relevant to, CD.25Rioux J.D. Daly M.J. Silverberg M.S. Lindblad K. Steinhart H. Cohen Z. Delmonte T. Kocher K. Miller K. Guschwan S. Kulbokas E.J. O'Leary S. Winchester E. Dewar K. Green T. Stone V. Chow C. Cohen A. Langelier D. Lapointe G. Gaudet D. Faith J. Branco N. Bull S.B. McLeod R.S. Griffiths A.M. Bitton A. Greenberg G.R. Lander E.S. Siminovitch K.A. Hudson T.J. Genetic variation in the 5q31 cytokine gene cluster confers susceptibility to Crohn disease.Nat Genet. 2001; 29: 223-228Google Scholar Analysis of the 3-allele haplotypes created by the SLC22A4 C1617T and SLC22A5 G-207C SNPs together with a representative IBD5 risk haplotype polymorphism, IGR2078a_1 G/A, confirm the linkage disequilibrium between these polymorphisms, with the 2 haplotypes with the full complement of either "risk" (T-C-A) or "nonrisk" (C-G-G) alleles together constituting more than 80% of all haplotypes occurring in this population (Table 2). Among all haplotypes in the study population, 687 (haplotypes 1–4) contained an IGR2078a_1 risk (A) allele; of these, only 60 or 8.7% (haplotypes 2–4) lack dual SLC22A4/SLC22A5 risk alleles. Moreover, in the absence of SLC22A4/SLC22A5 risk alleles, the IGR2078a_1 risk allele does not occur more frequently in patients compared with controls (P = .50). By contrast, the SLC22A-TC haplotype and risk alleles occur in the absence of an IGR2078a_1 risk allele (haplotypes 5–7) in 16.1% of all cases and do so significantly more frequently (P = 1 × 10−6) in patients than in controls (11.2%). These findings are consistent with a disease-causative rather than mere disease-associated relationship between the SLC22A-TC alleles and CD and indicate a need to use SLC22A4/SLC22A5 genotypes rather than IBD5 haplotype surrogate markers to investigate IBD5 effects on disease susceptibility and behavior.Table 1Clinical and Demographic Characteristics of Patients With CD and UCCD (n = 507)UC (n = 216)Male sex4644.9Family history of IBD (CD or UC)46.939.7Average age at diagnosis (y)20.718.5Age range at diagnosis (y)3–662–69Non-Jewish/Jewish white ethnicity70.6/26.669.9/25.5Medical/surgical treatment44.7/55.339.4/60.6Active smoker15.99.7Disease location Ileum70.6— Right colon45.433 Transverse colon31.555.7 Left colon36.197.3 Perianal29.63.9NOTE. Unless otherwise indicated, numbers shown represent percentages in each subgroup. Open table in a new tab Table 2Frequencies of Haplotype Groups Defined by SLC22A4 C1672T, SLC22A5 G-207C, and IGR2078a_1 G/A PolymorphismsHaplotypeaOrder of SNP positions within the haplotypes is SLC22A4 C1672T, SLC22A5 G-207C, and IGR2078a_1 G/A. Risk alleles are in bold.Overall haplotype frequency (%)(n = 1430)Non-Jewish (%)Jewish (%)CD(n = 524)Controls(n = 530)CD(n = 208)Controls(n = 168)1 T-C-A627 (43.9)253 (48.3)202 (38.1)102 (49.0)70 (41.7)2 C-C-A16 (1.1)12 (2.3)3 (0.6)1 (0.5)0 (0.0)3 T-G-A23 (1.6)12 (2.3)2 (0.4)4 (1.9)5 (3.0)4 C-G-A21 (1.5)4 (0.7)8 (1.5)6 (2.9)3 (1.8)5 T-C-G31 (2.2)16 (3.0)9 (1.7)3 (1.4)3 (1.8)6 C-C-G68 (4.8)3 (0.6)4 (0.8)34 (16.3)27 (16.1)7 T-G-G97 (6.8)58 (11.1)35 (6.6)4 (1.9)0 (0.0)8 C-G-G547 (38.3)166 (31.7)267 (50.4)54 (26.0)60 (35.7)a Order of SNP positions within the haplotypes is SLC22A4 C1672T, SLC22A5 G-207C, and IGR2078a_1 G/A. Risk alleles are in bold. Open table in a new tab NOTE. Unless otherwise indicated, numbers shown represent percentages in each subgroup. In view of the strong linkage disequilibrium between the SLC22A4 and SLC22A5 CD risk alleles, the relevance of these variants to specific subphenotypes or subgroups was investigated in relation to 2-allele SLC22A-TC risk haplotypes rather than the individual risk alleles. As shown in Table 3, results of univariate and multivariate regression analyses showed little correlation of the clinical and demographic features of the patient populations studied here with SLC22A-TC haplotype status per se, frequencies of the risk haplotype being comparable, for example, among non-Jewish and Jewish patients, smokers and nonsmokers, and sporadic versus familial cases. Frequency of the haplotype did, however, appear modestly increased among those with ileal versus no ileal disease (51.2% vs 42.6%; P = .11) and those having had surgical versus no surgical intervention (52.3% vs 40.5%; P = .04). To determine whether patient subgroups or subphenotypes might be definable by SLC22A-TC homozygosity versus heterozygosity, genotype-phenotype correlations were also examined in relation to individuals' SLC22A di