Portal de Periódicos da CAPES

Upstream Stimulatory Factors (USF-1/USF-2) Regulate Human cGMP-dependent Protein Kinase I Gene Expression in Vascular Smooth Muscle Cells

2005; Elsevier BV; Volume: 280; Issue: 18 Linguagem: Inglês

10.1074/jbc.m500775200

1083-351X

Hassan Sellak, Chung-Sik Choi, Natasha C. Browner, Thomas Lincoln,

Renin-Angiotensin System Studies

Cyclic GMP-dependent protein kinase I plays a pivotal role in regulating smooth muscle cell relaxation, growth, and differentiation. Expression of the enzyme varies greatly in smooth muscle and in other tissues and cell types, yet little is known regarding the mechanisms regulating cGMP-dependent protein kinase gene expression. The present work was undertaken to characterize the mechanisms controlling kinase gene expression in vascular smooth muscle cells. A 2-kb human cGMP-dependent protein kinase I 5′-noncoding promoter sequence was characterized by serial deletion, and functional studies demonstrated that a 591-bp 5′-promoter construct possessed the highest activity compared with all other constructs generated from the larger promoter. Analysis of the sequence between -472 and -591 bp from the transcriptional start site revealed the existence of two E-like boxes known to bind upstream stimulatory factors. Electrophoretic mobility shift assays and functional studies using luciferase reporter gene assays identified upstream stimulatory factors as the transcription factors bound to the E-boxes in the 591-bp promoter. Site-directed mutagenesis of the E-boxes abolished the binding of upstream stimulatory factor proteins and decreased the activity of the cGMP-dependent protein kinase I 591-bp promoter, thus confirming the involvement of these transcription factors in mediating gene expression. Cotransfection experiments demonstrated that overexpression of upstream stimulatory factors 1 and 2 increased cGMP-dependent protein kinase I promoter activity. Collectively, these data suggest that the human proximal cGMP-dependent protein kinase I promoter is regulated by tandem E-boxes that bind upstream stimulatory factors. Cyclic GMP-dependent protein kinase I plays a pivotal role in regulating smooth muscle cell relaxation, growth, and differentiation. Expression of the enzyme varies greatly in smooth muscle and in other tissues and cell types, yet little is known regarding the mechanisms regulating cGMP-dependent protein kinase gene expression. The present work was undertaken to characterize the mechanisms controlling kinase gene expression in vascular smooth muscle cells. A 2-kb human cGMP-dependent protein kinase I 5′-noncoding promoter sequence was characterized by serial deletion, and functional studies demonstrated that a 591-bp 5′-promoter construct possessed the highest activity compared with all other constructs generated from the larger promoter. Analysis of the sequence between -472 and -591 bp from the transcriptional start site revealed the existence of two E-like boxes known to bind upstream stimulatory factors. Electrophoretic mobility shift assays and functional studies using luciferase reporter gene assays identified upstream stimulatory factors as the transcription factors bound to the E-boxes in the 591-bp promoter. Site-directed mutagenesis of the E-boxes abolished the binding of upstream stimulatory factor proteins and decreased the activity of the cGMP-dependent protein kinase I 591-bp promoter, thus confirming the involvement of these transcription factors in mediating gene expression. Cotransfection experiments demonstrated that overexpression of upstream stimulatory factors 1 and 2 increased cGMP-dependent protein kinase I promoter activity. Collectively, these data suggest that the human proximal cGMP-dependent protein kinase I promoter is regulated by tandem E-boxes that bind upstream stimulatory factors. The serine/threonine protein kinase, cGMP-dependent protein kinase (PKG), 1The abbreviations used are: PKG, cGMP-dependent protein kinase; PKG-I, cGMP-dependent protein kinase type I; USF, upstream stimulatory factors; SMC, smooth muscle cells; EMSA, electrophoretic mobility shift assay; SREBP, sterol regulatory element binding protein; wt, wild type. belongs to the large protein kinase family and mediates the actions of nitric oxide (NO) and natriuretic peptides in target cells (1Lohmann S.M. Vaandrager A.B. Smolenski A. Walter U. De Jonge H.R. Trends Biochem. Sci. 1997; 22: 307-312Abstract Full Text PDF PubMed Scopus (352) Google Scholar, 2Francis S.H. Corbin J.D. Annu. Rev. Physiol. 1994; 56: 237-272Crossref PubMed Scopus (411) Google Scholar, 3Hofmann F. Ammendola A. Schlossmann J. J. Cell Sci. 2000; 113: 1671-1676Crossref PubMed Google Scholar). The effects of PKG activation in target cells include smooth muscle relaxation, inhibition of platelet aggregation, calcium homeostasis, intestinal secretion, cell growth, differentiation, and gene regulation (4Lincoln T.M. Day N. Sellak H. J. Appl. Physiol. 2001; 91: 1421-1430Crossref PubMed Scopus (417) Google Scholar, 5Pilz R.B. Casteel D.E. Circ. Res. 2003; 93: 1034-1046Crossref PubMed Scopus (247) Google Scholar). Two genes encoding mammalian PKG have been identified, type I and type II (6Francis S.H. Woodford T.A. Wolf L. Corbin J.D. Second Messengers and Phosphoproteins. 1988; 12: 301-310PubMed Google Scholar, 7Tamura N. Itoh H. Ogawa Y. Nakagama O. Harada M. Chun T-H. Suga S. Yohimasa T. Nakao K. Hypertension. 1996; 27: 552-557Crossref PubMed Google Scholar, 8Jarchau T. Hausler C. Markert T. Pohler D. Vanderkerchhove J. De Jonge H.R. Lohmann S.M. Walter U. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9426-9430Crossref PubMed Scopus (137) Google Scholar). The type I PKG (PKG-I) is expressed as two isoforms created by alternative mRNA splicing of the two first coding exons, and these two isoforms are referred to as type Iα and type Iβ. Because these two isoforms differ only in the initial coding region, they contain an identical catalytic domain with identical substrate specificity. Although the two isoforms of PKG-I are rather widely expressed in mammalian tissues, three cell types, smooth muscle, cerebellum Purkinje cells, and platelets, contain the highest levels of the enzyme. The type II PKG is expressed most abundantly in intestinal epithelium, chondrocytes, and certain regions of the brain but is not expressed in smooth muscle (9Uhler M.D. J. Biol. Chem. 1993; 268: 13586-13591Abstract Full Text PDF PubMed Google Scholar, 10Lincoln T.M. Thompson M. Cornwell T.L. J. Biol. Chem. 1988; 263: 17632-17637Abstract Full Text PDF PubMed Google Scholar, 11Eigenthaler M. Nolte C. Halbrugge M. Walter U. Eur. J. Biochem. 1992; 205: 471-481Crossref PubMed Scopus (146) Google Scholar, 12Stewart D.J. Cernacek P. Mohamed F. Blais D. Cianflone K. Monge J.C. Am. J. Physiol. 1994; 266: H944-H951PubMed Google Scholar). In vascular SMC, both PKG-Iα and -Iβ isoforms are abundant, but expression is highly variable. For instance, upon subculturing vascular SMC derived from rat aorta, PKG-I expression decreases as the cells modulate to a more dedifferentiated, fibroproliferative phenotype. Furthermore, PKG-I expression is reduced in response to balloon catheter injury in rat carotid artery and porcine coronary artery (13Sinnaeve P. Chiche J.D. Gillijns H. Van Pelt N. Wirthlin D. Van De Werf F. Collen D. Bloch K.D. Janssens S. Circulation. 2002; 105: 2911-2916Crossref PubMed Scopus (58) Google Scholar, 14Anderson P.G. Boerth N.J. Liu M. McNamara D.B. Cornwell T.L. Lincoln T.M. Arterioscler. Thromb. Vasc. Biol. 2000; 20: 2192-2197Crossref PubMed Scopus (70) Google Scholar) and in fetal pulmonary artery in response to hypoxic conditions (15Gao Y. Dhanakoti S. Trevino E.M. Wang X.F. Sander C. Portugal A.D. Raj J.U. Am. J. Physiol. 2004; 286: L786-L792Google Scholar). Recently, our laboratory has shown that inflammatory mediators such as interleukin-1β and tumor necrosis factor-α rapidly down-regulate PKG-I mRNA and protein expression in freshly isolated vascular SMC from bovine aorta (16Browner N.C. Sellak H. Lincoln T.M. Am. J. Physiol. 2004; 287: C88-C96Crossref PubMed Scopus (51) Google Scholar). These results suggest that one component of the proliferative response to injury by vascular SMC is the suppression of PKG-I expression and the disruption of NO signaling in the cells. The mechanisms underlying the suppression of PKG expression are not known, and virtually nothing is known regarding the mechanisms regulating PKG-I gene expression at the transcriptional or translational levels. The human gene for PKG-I, including the promoter sequence, was characterized in 1997 (17Orstavik S. Natarajan V. Tasken K. Jahnsen T. Sandberg M. Genomics. 1997; 42: 311-318Crossref PubMed Scopus (100) Google Scholar). The human PKG-I 5′-flanking region (600 bp) demonstrates about 80% homology with the same region in other species (i.e. rat and mouse) and has no typical TATA-box or CCAAT-box. Several previous observations indicate that genes with tissue-specific expression, but with TATA-less promoters, utilize GC-rich promoter sequences that bind Sp proteins to regulate transcription (18Sauerwald A. Hoesche C. Oschwald R. Kilimann M.W. J. Biol. Chem. 1990; 265: 14932-14937Abstract Full Text PDF PubMed Google Scholar, 19Chen A.S. Reyes A. Akeson R. Mol. Cell. Biol. 1990; 10: 3314-3324Crossref PubMed Scopus (36) Google Scholar), and our laboratory found that Sp proteins might be important for basal PKG-I expression in SMC (20Sellak H. Yang X. Cao X. Cornwell T. Soff G.A. Lincoln T. Circ. Res. 2002; 90: 405-412Crossref PubMed Scopus (62) Google Scholar). Given the importance of the NO/cGMP pathway in regulating not only SMC contractility but also growth and phenotype of the SMC (21Boerth N.J. Dey N.B. Cornwell T.L. Lincoln T.M. J. Vasc. Res. 1997; 34: 245-259Crossref PubMed Scopus (154) Google Scholar, 22Dey N.B. Boerth N.J. Murphy-Ullrich J.E. Chang P.L. Prince C.W. Lincoln T.M. Circ. Res. 1998; 82: 139-146Crossref PubMed Scopus (57) Google Scholar, 23Sinneave P. Feil R. Lohmann S.M. de Jonge H. Walter U. Hofmann F. Circ. Res. 2003; 93: 907-916Crossref PubMed Scopus (242) Google Scholar), it seemed important to characterize the mechanism(s) governing PKG-I gene expression to understand further the different physiological and pathophysiological roles of this kinase in the vasculature. Hence, the goal of the present study was to characterize and identify 5′-promoter transcriptional regulation involved in the expression of human PKG-I in vascular SMC. The current findings suggest an important role for upstream stimulatory factors (USF) that bind to tandem E-like boxes in the 5′-region of the proximal PKG-I promoter in human vascular SMC. Chemicals and Reagents—[γ-32P]ATP (3000 Ci/mmol) was purchased from PerkinElmer Life Sciences and Analytical Sciences (Billerica, MA). Restriction and modifying enzymes, reporter gene vector (pGL3-basic), dual luciferase system, transfection reagent Tfx-20, and other biological compounds were purchased from Promega (Madison, WI). USF-1 (psv-USF1, PN3) and USF-2 (psv-USF2, PN2) expression vectors were provided by Dr. M. Sawadogo (University of Texas, Houston). Empty vector pSG5 was from Stratagene (La Jolla, CA). Antibodies, anti-USF-1 (C-20), anti-USF-2 (N-19), and anti-IgG, were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Synthetic oligonucleotides and constructs sequencing were provided from MWG Biotec (High Point, NC). Smooth Muscle Cell Culture—Bovine aortic SMC in passage 2-8 were cultured as described previously (24Soff G.A. Cornwell T.L. Cundiff D.L. Gately S. Lincoln T.M. J. Clin. Investig. 1997; 100: 2580-2587Crossref PubMed Scopus (99) Google Scholar). Embryonic rat aortic A7r5 cells were purchased from American Type Culture Collection (ATCC, Manassas, VA). Cells were maintained in Dulbecco's minimal essential medium containing 10% fetal bovine serum and 50 μg/ml gentamicin. The routine subculturing procedure was performed to split the cells 1:4. Cloning of the PKG-I Promoter and Construction of Different Plasmids—The 5′-flanking region in the PKG-I 2-kb promoter was generated by PCR using human genomic DNA from the lung (Promega, Madison, WI) as a template and primers designed from the published PKG sequence, GenBank™ accession number Z92867 (sense, 5′-gactgagcacccagcatgtcttttcta-3′; antisense, 5′-gctgaagctttttcactgagcccctccgcg-3′). The cloned genomic fragment was ligated into the SacI/HindIII-digested pGL3basic vector containing luciferase as a reporter gene. The cloned PKG-I 2-kb promoter served as a template to generate serial deletions in the PKG-I 2-kb promoter. All PCR products (-472, -591, -800, -1000, -1200, -1500, and -1700 bp) were purified and subcloned in the pGL3-basic vectors. Plasmids p50, p70, and p120, corresponding to positions -472 to -521 bp, -522 to -591 bp, and -472 to -591 bp of the human PKG-I untranscribed region, respectively, were generated by PCR using the PKG-I 591-bp promoter fragment as the template and the primers reported in Table I. The PCR fragments were subcloned in pGL3basic vector. In some experiments, the 70- and 50-bp oligonucleotides were inserted upstream of the human PKG-I 472-bp promoter. The integrity and fidelity of all constructs were verified by DNA sequencing.Table ISense and antisense primers used in cloning human PKG-I 2-kb promoter and in generating different constructsConstructs (kb)Sense (5′ → 3′)PKG (2)gactgagcacccagcatgtcttttctaPKG (0.472)gctcggtaccatatagcgtggaagagPKG (0.591)gctcgagctcggatccagttacaagcgPKG (0.8)gctcgagctcaggcttttacgctgPKG (1)gctcgagctcgtggatgcacaggtaagPKG (1.2)gctcgagctcggaagatctcctggtatcPKG (1.5)gctcgagctcgacagaagcaacagaatagcPKG (1.8)gctcgagctcgaggtgcatgcgtgaaatcAntisensegctgaagctttttcactgagccctccgcgConstructs (bp)Sense (5′ → 3′) and antisense (5′ → 3′)P50cctcgagctcggatccagttacaagcggcgcaagcttcttgaaatagcaacP70gctagagctcggatcaagtggcataaaatataagcttccaagggaagggggP120gctagagctcggatcaagtggcataaagcgcaagcttcttgaaatagcaac Open table in a new tab Transient Transfection and Reporter Gene Assays—Bovine aortic SMC or rat aortic A7r5 cells were seeded in 24-well plates at 60-70% of confluence and were grown overnight. After 16-20 h, cells were transfected for 1 h, in the absence of serum, with 250 ng of different PKG-I promoter constructs using 1 μl of transfecting reagent Tfx-20. Forty eight hours later, cells were washed with PBS and lysed, and luciferase assays were performed. The activity of the cotransfected control reporter gene (pRL-null vector, 50 ng, Promega) provided an internal control. The experimental reporter genes were normalized to the activity of the internal control to minimize the variability caused by differences in cell death and transfection efficiency. Dual luciferase (Dual-Luciferase Reporter Assay System, Promega) was quantified using a luminometer (TD 20/20 Luminometer Turner Design). The data are expressed as relative luciferase, where firefly luciferase activity was normalized to Renilla luciferase activity generated by cotransfecting with pRL-null vector. In cotransfection experiments, USF-1 or USF-2 expression vectors were used at different concentrations as indicated in the figures. The total amount of DNA was kept constant by adding the empty vector (pGL3 basic or pSG5). Nuclear Extract Preparation and Electrophoretic Mobility Shift Assays (EMSA)—Nuclear extracts from bovine aortic SMC were prepared using NE-PER nuclear and cytosolic extraction reagents following protocols provided by the manufacturer (Pierce). 70- and 50-bp DNA fragments were prepared by PCR using the PKG-I 591-bp promoter as a template with the primers described in Table I. E1-E2 oligonucleotides (see Table II) and E2-box binding sites in the PKG-I promoter were synthesized by MWG Biotec. The oligonucleotides were annealed, end-labeled with [γ-32P]ATP and T4 polynucleotide kinase, and purified using microSpin G-25 columns (Amersham Biosciences). Nuclear extract proteins (10 μg) from control bovine cells were incubated with the 32P-labeled probes (50,000 cpm) in a buffer containing 10 μg/ml bovine serum albumin, 10 mmol/liter Tris-HCl (pH 7.5), 50 mmol/liter NaCl, 1 mmol/liter dithiothreitol, 1 mmol/liter EDTA, and 5% glycerol (total volume 20 μl). To minimize nonspecific binding, 2 μg of poly(dI-dC) was added to the reaction. The binding reaction was carried out on ice for 30 min. The DNA-protein complexes were resolved by 5% nondenaturing PAGE at 12 V/cm in low ionic strength buffer (0.25× Tris/borate/EDTA) at room temperature. For mobility supershift assays, antibodies toward USF-1, USF-2, or control IgG were added to the binding reactions and incubated at 4 °C for 10 min before the addition of the radioactive probe. In experiments involving competitive EMSA, the unlabeled oligonucleotides (A-E, E-box1, E-box2, mE1-box, mE2-box, 50 and 70 bp, USF-1, GATA, SREBP-1, Oct-1, Sp1, E1-E2, mE1-E2, E1-mE2, or mE1-mE2) at 50-fold excess (Table II) were preincubated with nuclear extracts for 10 min on ice before the addition of the radioactive probe and then further incubated for an additional 20 min. Gels were then dried and exposed to autoradiographic film.Table IISequences and positions of oligonucleotides used in EMSA and mutagenesisOligonucleotidesSequence (5′ → 3′)PositionAacactctttaggatccagttacaagcgctg−561/−591Bcgctgcgtcatccgccagatcacatggtaa−535/−565Catggtaattgttgctatttcaaggatcaagtggc−509/−541Dgtggcataaatctccccccccccacccc−492/−514Eccccaccccacccccttccct−472/−494E1-boxccgccagatcacatggtaattgt−535/−558E2-boxcaaggatcaagtggcataa−505/−524mE1-boxCcgccagatcttttggtaattgt−535/−558mE2-boxcaaggatcttttggcataa−506/−524USFcacccggtcacgtggcctacaccGATAgatcatccttgcaagatgatatctctctSREBP1ccgggactgaggtgatatcacOct1tgtcgaatccaaatcactagaSp1attcgatcggggcggggcgagcE1-E2ccagatcacatggtaattgttgctatttcaaggatcaagtggcataaatc−503/−552mE1-E2ccagatcttttggtaattgttgctatttcaaggatcaagtggcataaatc−503/−552E1-mE2ccagatcacatggtaattgttgctatttcaaggatcttttggcataaatc−503/−552mE1-mE2ccagatcttttggtaattgttgctatttcaaggatcttttggcataaatc−503/−552 Open table in a new tab Site-directed Mutagenesis—The human PKG-I 591-bp fragment cloned into pGL3basic served as the template for site-directed mutagenesis, which was employed to change the minimal consensus sequences for the putative USF-1/USF-2-binding sites. Mutagenesis was performed using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). The E1-box was mutated (underlined) to cttttg (wt, cacatg); the E2-box was mutated to cttttg (wt, caagtg), and the double mutated USF-binding sites consisted of mutated E1-box and E2-box sequences (mE1-box/mE2-box). All mutations were confirmed by sequencing the constructs. EMSAs were performed to make sure that the mutated oligonucleotides failed to bind to nuclear extracts from cells. These mutated constructs, as well as the wild type, were used for transfection of bovine aortic SMC and A7r5 cells, as described above. Western Blot Analysis—Western blots were performed to verify the overexpression of USF-1 or USF-2 proteins in control or transfected cells. Total protein extract (40 μg) was separated on 10% SDS-PAGE and transferred to nitrocellulose membranes. The blots were probed with anti-USF-1 or anti-USF-2 antibodies. The signal was detected by enhanced chemiluminescence (Pierce). Serial Deletions of the Human PKG-I 2-kb Promoter Reveal a 591-bp Active PKG-I Promoter—Previously, our laboratory demonstrated that Sp1/Sp3-binding sites located within 100 bp upstream of the ATG translation initiation codon were important for basal human PKG-I promoter activity in vascular SMC (20Sellak H. Yang X. Cao X. Cornwell T. Soff G.A. Lincoln T. Circ. Res. 2002; 90: 405-412Crossref PubMed Scopus (62) Google Scholar). This small region of the 5′-untranslated PKG-I gene was about 60% conserved when comparing human versus rodents (rat and mouse) by using ClustalW (1.82) multiple sequence alignment (www.ebi.uk). 600-bp upstream of this region, however, there is more conservation of sequences (about 80% when comparing human PKG-I gene versus rat and mouse). In the current study, we have expanded these initial findings to identify additional mechanisms that may regulate human proximal PKG-I promoter activity in SMC. Therefore, the PKG-I 5′-flanking region (2 kb) was cloned by PCR using human genomic DNA as a template. Serial deletions were generated using the cloned PKG-I 2-kb promoter as a template by using the primers shown in Table II. Fig. 1 demonstrates that the highest PKG-I promoter activity was contained within a 591-bp region of the 2-kb promoter when studied using luciferase reporter gene assays. As shown in Fig. 2A, the DNA sequence of the 591-bp region reveals the existence of a number of putative transcription factor binding sites, including two E-boxes capable of binding USF-1/2 transcription factors, to be discussed later. In fact, the activity of PKG-I 591-bp was ∼2.5-5-fold more active in driving luciferase expression compared with the 472-bp promoter studied previously by our laboratory in aortic SMC (20Sellak H. Yang X. Cao X. Cornwell T. Soff G.A. Lincoln T. Circ. Res. 2002; 90: 405-412Crossref PubMed Scopus (62) Google Scholar).Fig. 2Sequence of the human PKG-I 591-bp promoter. A, the human PKG-I gene promoter region composed of -1 to -591 relative to the translation start site was cloned upstream of the firefly luciferase cDNA in the pGL3 basic plasmid. The sequences of the E1-box and E2-box are represented in boldface. The mutated E1-box (mE1) and E2-box (mE2) are shown below the wild type sequence. GC-rich regions susceptible to binding Sp1 and/or Sp3 proteins are underlined. B, nucleotide sequences of promoter region showing the location of the conserved E-boxes in the human, rat, and mouse PKG-I gene. Indicated numbers are relative to the translation start site. The GenBank™ accession numbers are NT-039687.3 (mouse), NW-047565.1 (rat), and Z92867.1 (human). Sequences were aligned using ClustalW (1.8) multiple sequence alignment (www.ebi.ac.uk).View Large Image Figure ViewerDownload Hi-res image Download (PPT) Identification of Transcription Factor(s) Mediating Human PKG-I 591-bp Promoter Activity—In order to identify the potential transcription factors that might bind to the human PKG-I 591-bp promoter compared with the 472-bp promoter region, 70- and 50-bp oligonucleotides were generated corresponding in the region -472 to -591 bp. These oligonucleotides were radiolabeled, and EMSAs were performed using nuclear extracts from bovine aortic SMC. As shown in Fig. 3A, one major band was retarded on the gel with the 70-bp probe (lane 2). In order to identify the potential binding elements within the 120-bp fragment between -472 and -591 bp that may be responsible for the increase in the binding activity, this fragment was further dissected into five regions (A-E). These regions were selected based on the potential transcription factors that might bind to this 120-bp fragment (Fig. 1 and Table II). The results in Fig. 3A show that the binding of the retarded band was decreased significantly with excess unlabeled oligonucleotide B (lane 4, **) and partially decreased with excess unlabeled oligonucleotide C (lane 5, *). In contrast, oligonucleotides A, D, and E did not reduce the intensity of binding to the retarded band (Fig. 3A, lanes 3, 6, and 7). As shown in Fig. 3B, three or possibly four bands were retarded when the 50-bp DNA fragment was used as a probe. In unlabeled probe competition assays, excess of oligonucleotides A-C eliminated the binding of band 1 and decreased the binding of band 4 (Fig. 3B, lanes 4-6), whereas excess of oligonucleotides D and E eliminated the radioactive binding in bands 2 and 3 (lanes 7 and 8). Computer analysis of the sequences of the 70- and 50-bp region of the human PKG-I promoter region revealed that oligonucleotides B and C might compete with GATA-1/3-, USF-1/2-, Oct-1-, or SREBP-1-binding sites. Therefore, consensus sequences for each of these binding sites were generated (see Table II), and EMSA competition assays were performed to identify which oligonucleotide would diminish the binding of 70- and 50-bp probes. The results in Fig. 4A show that an excess of USF-1/2 consensus binding oligonucleotide abolished the binding of the retarded band when the 70-bp DNA fragment was used as a probe (lane 4, *), whereas other unlabeled consensus oligonucleotides decreased only slightly the binding or failed to abolish it altogether. When the 50-bp DNA fragment was used as a probe (Fig. 4B), only consensus USF-binding oligonucleotides decreased bands 1 and 4 (lane 4), whereas the SREBP-binding oligonucleotide reduced the intensity of band 1 and abolished band 4. Oct-1- and GATA-1/3-binding oligonucleotides decreased only slightly the intensity of the band 4 (Fig. 4B, lanes 6 and 7). Finally, an excess of unlabeled Sp1 consensus oligonucleotide abolished the binding of bands 2 and 3 (Fig. 4B, lane 8), indicating that Sp proteins bound to the 50-bp DNA fragment. These data demonstrate that USF-1/2 is the predominant transcription factor binding to 70-bp probe, whereas both USF and Sp proteins bind to 50-bp probe. USF-1 and USF-2 Transcription Factors Bind to E-box Motifs in the Human PKG-I 591-bp Promoter—To confirm the binding of USF proteins to the 70-bp DNA promoter fragment, additional EMSAs were performed using competition with unlabeled oligonucleotides and specific antibodies directed against USF-1 and USF-2 transcription factors. The results shown in Fig. 5A demonstrate that only one band is retarded on the gel (lane 2) when the 70-bp DNA fragment was incubated with aortic SMC nuclear extract protein. A 50-fold excess of unlabeled E1-box or E2-box oligonucleotide abolished the binding at 70 bp (Fig. 5A, lanes 3 and 4), whereas an excess of unlabeled mutated E1-box (mE1-box, ccgccagatcttttggtaattgtt) or mutated E2-box (mE2-box, caaggatcttttggcataa) oligonucleotides reduced only slightly the binding of the probe (lanes 5 and 6). Preincubation of aortic SMC nuclear extract with anti-USF-1 antibody caused a supershift of two bands (Fig. 5B, lanes 2 and 3). An anti-USF-2 antibody resulted in a marked reduction of the intensity of the retarded band (Fig. 5B, lanes 4 and 5) but did not result in a supershift of the band. As a control, the anti-IgG itself did not affect the intensity (binding) of the retarded band. These results suggest that USF-1, and most likely USF-2, were the major transcription factors binding to the 70-bp DNA fragment of the human PKG-I 591-bp promoter. The lack of supershift using anti-USF-2 may be due to a lower affinity of the antibody compared with anti-USF-1 or, alternatively, to the ability of the polyclonal antibody to interact with the DNA binding domain of USF-2. Similarly, we performed EMSA competitions and immunoshifts to identify which, if any, transcription factors bind to the 50-bp DNA promoter fragment. As shown in Fig. 5C, several bands were retarded (lane 2). An excess of unlabeled 50-bp oligonucleotide abolished the binding (Fig. 5C, lane 3). Competition with unlabeled E1-box or E2-box oligonucleotides almost abolished band 1 and reduced significantly band 4 (Fig. 5C, lanes 4 and 5) as did USF consensus oligonucleotides. However, mutated E1-box or mutated E2-box unlabeled oligonucleotides had no effect on the binding to band 1 (lanes 6 and 7). When nuclear extracts from aortic SMC was preincubated with anti-USF-1 or anti-USF-2 antibodies, there was a reduction in the intensity of the retarded bands (Fig. 5D, lanes 5 and 8). Because the sequence of the putative E2-box (CAAGTG) has not been reported to be a USF-binding sequence, additional EMSA experiments were performed to determine the nature of the binding activity to the E2-box of the 50-bp probe. As shown in Fig. 6A, several bands were retarded when the E2-box sequence shown in Table II was used as a probe. In competition assays, an excess of unlabeled E1-box or E2-box oligonucleotide abolished binding to the retarded bands 1 and 2 (Fig. 6A, lanes 3 and 4). However, competition with a mutated E1-box or a mutated E2-box oligonucleotide did not affect the binding (Fig. 6A, lanes 5 and 6). Similarly, excess of unlabeled SREBP-1, GATA-1/3, or Oct-1 consensus oligonucleotides did not reduce binding (Fig. 6A, lanes 7-9). On the other hand, anti-USF-1 antibody reduced the intensity of the retarded bands and induced a supershift of band 2 (Fig. 6B, lanes 2-4). Preincubation of nuclear extracts with anti-USF-2 antibody produced the reduction in intensity of binding to band 2 (Fig. 6B, lanes 6 and 7) but did not supershift the band, as observed earlier. These data suggest that USF-1, and likely USF-2, transcription factors are binding to the 50-bp DNA fragment from the human PKG-I 591-bp promoter. Functional Analysis of the 70- and 50-bp DNA Sequences for Human PKG-I 591-bp Promoter Activity—From the binding data shown in Fig. 4, we anticipated that sequences contained within the 50- and 70-bp DNA fragments might be necessary for maximal promoter activity. To determine the role of these sequences of the human PKG-I 591-bp promoter to impart activity to the promoter, constructs were generated where both the 50 and the 70 bp were separately inserted upstream of human PKG-I 472-bp promoter, ligated in pGL3 vectors, and luciferase activities were determined following transfection of the constructs in the bovine aortic or A7r5 SMC. As shown in Fig. 7, luciferase activities produced in the cells following transfection of p50-472 or p70-472 were lower or similar to the activity of p472 alone. On the other hand, the activity of the p120 construct alone was similar to that of the p472 promoter but lower than the p591 PKG-I construct that contains not only the sequences of the 120-bp region upstream of the 472-bp region, but also contain the Sp-binding sites identified previously (20Sellak H. Yang X. Cao X. Cornwell T. Soff G.A. Lincoln T. Circ. Res. 2002; 90: 405-412Crossref PubMed Scopus (62) Google Scholar). Thus, these data suggest that both reg