Portal de Periódicos da CAPES

Ric-3 Promotes Functional Expression of the Nicotinic Acetylcholine Receptor α7 Subunit in Mammalian Cells

2004; Elsevier BV; Volume: 280; Issue: 2 Linguagem: Inglês

10.1074/jbc.m410039200

1083-351X

Mark E. Williams, Bill Burton, Arturo Urrutia, Anatoly Shcherbatko, Laura E. Chavez-Noriega, Charles J. Cohen, Jayashree Aiyar,

Ion channel regulation and function

Expression of functional, recombinant α7 nicotinic acetylcholine receptors in several mammalian cell types, including HEK293 cells, has been problematic. We have isolated the recently described human ric-3 cDNA and co-expressed it in Xenopus oocytes and HEK293 cells with the human nicotinic acetylcholine receptor α7 subunit. In addition to confirming the previously reported effect on α7 receptor expression in Xenopus oocytes we demonstrate that ric-3 promotes the formation of functional α7 receptors in mammalian cells, as determined by whole cell patch clamp recording and surface α-bungarotoxin binding. Upon application of 1 mm nicotine, currents were undetectable in HEK293 cells expressing only the α7 subunit. In contrast, co-expression of α7 and ric-3 cDNAs resulted in currents that averaged 42 pA/pF with kinetics similar to those observed in cells expressing endogenous α7 receptors. Immunoprecipitation studies demonstrate that α7 and ric-3 proteins co-associate. Additionally, cell surface labeling with biotin revealed the presence of α7 protein on the plasma membrane of cells lacking ric-3, but surface α-bungarotoxin staining was only observed in cells co-expressing ric-3. Thus, ric-3 appears to be necessary for proper folding and/or assembly of α7 receptors in HEK293 cells. Expression of functional, recombinant α7 nicotinic acetylcholine receptors in several mammalian cell types, including HEK293 cells, has been problematic. We have isolated the recently described human ric-3 cDNA and co-expressed it in Xenopus oocytes and HEK293 cells with the human nicotinic acetylcholine receptor α7 subunit. In addition to confirming the previously reported effect on α7 receptor expression in Xenopus oocytes we demonstrate that ric-3 promotes the formation of functional α7 receptors in mammalian cells, as determined by whole cell patch clamp recording and surface α-bungarotoxin binding. Upon application of 1 mm nicotine, currents were undetectable in HEK293 cells expressing only the α7 subunit. In contrast, co-expression of α7 and ric-3 cDNAs resulted in currents that averaged 42 pA/pF with kinetics similar to those observed in cells expressing endogenous α7 receptors. Immunoprecipitation studies demonstrate that α7 and ric-3 proteins co-associate. Additionally, cell surface labeling with biotin revealed the presence of α7 protein on the plasma membrane of cells lacking ric-3, but surface α-bungarotoxin staining was only observed in cells co-expressing ric-3. Thus, ric-3 appears to be necessary for proper folding and/or assembly of α7 receptors in HEK293 cells. Nicotinic acetylcholine receptors (nAChRs) 1The abbreviations used are: nAChR, nicotinic acetylcholine receptor; α-Bgt, α-bungarotoxin; hric3, human ric-3; HA, hemagglutinin; ER, endoplasmic reticulum; nt(s), nucleotide(s); PBS, phosphate-buffered saline; MAP, mitogen-activated protein; mAb, monoclonal antibody; COX IV, cytochrome c oxidase subunit IV.1The abbreviations used are: nAChR, nicotinic acetylcholine receptor; α-Bgt, α-bungarotoxin; hric3, human ric-3; HA, hemagglutinin; ER, endoplasmic reticulum; nt(s), nucleotide(s); PBS, phosphate-buffered saline; MAP, mitogen-activated protein; mAb, monoclonal antibody; COX IV, cytochrome c oxidase subunit IV. are members of the neurotransmitter-gated ion channel superfamily. They are widely expressed in the central and peripheral nervous system (1Graham A.J. Martin-Ruiz C.M. Teaktong T. Ray M.A. Court J.A. Curr. Drug Target CNS Neurol. Disord. 2002; 1: 387-397Crossref PubMed Scopus (48) Google Scholar) where they influence numerous cellular and physiological processes. At least 17 different genes that code for nAChR subunits have been identified (2Lukas R.J. Changeux J.P. Le Novere N. Albuquerque E.X. Balfour D.J. Berg D.K. Bertrand D. Chiappinelli V.A. Clarke P.B. Collins A.C. Dani J.A. Grady S.R. Kellar K.J. Lindstrom J.M. Marks M.J. Quik M. Taylor P.W. Wonnacott S. Pharmacol. Rev. 1999; 51: 397-401PubMed Google Scholar, 3Elgoyhen A.B. Vetter D.E. Katz E. Rothlin C.V. Heinemann S.F. Boulter J. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3501-3506Crossref PubMed Scopus (557) Google Scholar), and they assemble as pentamers in different combinations to form a diverse set of nAChR subtypes (4Lindstrom J. Ion Channels. 1996; 4: 377-450Crossref PubMed Scopus (262) Google Scholar, 5Picciotto M.R. Caldarone B.J. King S.L. Zachariou V. Neuropsychopharmacology. 2000; 22: 451-465Crossref PubMed Scopus (298) Google Scholar). The simplest case is the homopentameric complex such as that formed by the nAChR α7 subunit. The α7 receptor, for which α-bungarotoxin (α-Bgt) is a specific and high affinity antagonist, is one of the most abundant receptor subtypes in the mammalian brain (6Dominguez del Toro E. Juiz J.M. Peng X. Lindstrom J. Criado M. J. Comp. Neurol. 1994; 349: 325-342Crossref PubMed Scopus (221) Google Scholar, 7Role L.W. Berg D.K. Neuron. 1996; 16: 1077-1085Abstract Full Text Full Text PDF PubMed Scopus (681) Google Scholar). The high Ca2+ permeability of the α7 receptor (8Seguela P. Wadiche J. Dineley-Miller K. Dani J.A. Patrick J.W. J. Neurosci. 1993; 13: 596-604Crossref PubMed Google Scholar) suggests an involvement in the activation of Ca2+-dependent events in neurons such as transmitter release, participation in signal transduction, and a variety of modulatory effects (9Berg D.K. Conroy W.G. J. Neurobiol. 2002; 53: 512-523Crossref PubMed Scopus (181) Google Scholar). In addition, α7 receptors have been implicated in a number of diseases such as schizophrenia, Alzheimers, and Parkinsons disease (1Graham A.J. Martin-Ruiz C.M. Teaktong T. Ray M.A. Court J.A. Curr. Drug Target CNS Neurol. Disord. 2002; 1: 387-397Crossref PubMed Scopus (48) Google Scholar, 10Martin L.F. Kem W.R. Freedman R. Psychopharmacology (Berl.). 2004; 174: 54-64Crossref PubMed Scopus (318) Google Scholar, 11Bourin M. Ripoll N. Dailly E. Curr. Med. Res. Opin. 2003; 19: 169-177Crossref PubMed Scopus (56) Google Scholar, 12Banerjee C. Nyengaard J.R. Wevers A. de Vos R.A. Jansen Steur E.N. Lindstrom J. Pilz K. Nowacki S. Bloch W. Schroder H. Neurobiol. Dis. 2000; 7: 666-672Crossref PubMed Scopus (87) Google Scholar).Heterologous expression of the α7 subunit in Xenopus oocytes results in homooligomeric, α-Bgt-sensitive receptors that activate and inactivate quickly and are highly permeable to Ca2+ (8Seguela P. Wadiche J. Dineley-Miller K. Dani J.A. Patrick J.W. J. Neurosci. 1993; 13: 596-604Crossref PubMed Google Scholar, 13Schoepfer R. Conroy W.G. Whiting P. Gore M. Lindstrom J. Neuron. 1990; 5: 35-48Abstract Full Text PDF PubMed Scopus (406) Google Scholar, 14Couturier S. Bertrand D. Matter J.M. Hernandez M.C. Bertrand S. Millar N. Valera S. Barkas T. Ballivet M. Neuron. 1990; 5: 847-856Abstract Full Text PDF PubMed Scopus (815) Google Scholar), similar to the properties of α7 nAChRs in neuronal cells. Although there have been reports of successful functional expression in some mammalian cell lines (15Puchacz E. Buisson B. Bertrand D. Lukas R.J. FEBS Lett. 1994; 354: 155-159Crossref PubMed Scopus (97) Google Scholar, 16Quik M. Choremis J. Komourian J. Lukas R.J. Puchacz E. J. Neurochem. 1996; 67: 145-154Crossref PubMed Scopus (92) Google Scholar, 17Peng J.H. Lucero L. Fryer J. Herl J. Leonard S.S. Lukas R.J. Brain Res. 1999; 825: 172-179Crossref PubMed Scopus (49) Google Scholar, 18Zhao L. Kuo Y.P. George A.A. Peng J.H. Purandare M.S. Schroeder K.M. Lukas R.J. Wu J. J. Pharmacol. Exp. Ther. 2003; 305: 1132-1141Crossref PubMed Scopus (63) Google Scholar), measurable levels of functional receptors have been difficult to achieve in multiple cell types and this phenomenon appears to be host-cell dependent (19Cooper S.T. Millar N.S. J. Neurochem. 1997; 68: 2140-2151Crossref PubMed Scopus (130) Google Scholar). The reasons for poor heterologous surface expression in these cells are not well understood. Strategies to increase the number of functional receptors on the cell surface, including alteration of culture conditions (20Schroeder K.M. Wu J. Zhao L. Lukas R.J. J. Neurochem. 2003; 85: 581-591Crossref PubMed Scopus (16) Google Scholar), the generation of α7–5HT3 chimeras (21Eisele J.L. Bertrand S. Galzi J.L. Devillers-Thiery A. Changeux J.P. Bertrand D. Nature. 1993; 366: 479-483Crossref PubMed Scopus (359) Google Scholar), and site-directed mutagenesis (22Dineley K.T. Patrick J.W. J. Biol. Chem. 2000; 275: 13974-13985Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar) have met with some success. However, these strategies have resulted in only a modest increase in the number of functional receptors or the generation of non-native receptors, which are not ideal for drug discovery. Consequently, there is continued interest in identifying cellular factors that influence the expression of functional α7-containing nAChRs.A screen to identify genes necessary for nAChR function in Caenorhabditis elegans was recently described (23Halevi S. McKay J. Palfreyman M. Yassin L. Eshel M. Jorgensen E. Treinin M. EMBO J. 2002; 21: 1012-1020Crossref PubMed Scopus (182) Google Scholar). The search for suppressors of a dominant mutation in the nAChR subunit DEG-3 led to the identification of mutations in ric-3 (resistant to inhibitors of cholinesterase), and subsequent work demonstrated that ric-3 is required for the maturation of multiple nAChRs in oocytes (23Halevi S. McKay J. Palfreyman M. Yassin L. Eshel M. Jorgensen E. Treinin M. EMBO J. 2002; 21: 1012-1020Crossref PubMed Scopus (182) Google Scholar). Recent work indicates that ric-3 is a member of a conserved gene family (24Halevi S. Yassin L. Eshel M. Sala F. Sala S. Criado M. Treinin M. J. Biol. Chem. 2003; 278: 34411-34417Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar). The human homolog (hric3) has diverse effects on co-expressed receptors, including the enhancement of α7-mediated whole cell current amplitudes as well as the reduction of α4β2 and α3β4 currents in oocytes. In this study we further examined the effects of hric3 on α7 receptors. In addition to demonstrating increased current amplitudes when co-expressed with α7 receptors in Xenopus oocytes, we show an association between α7 and hric3 proteins and demonstrate that hric3 promotes the formation of functional α7 receptors on the surface of mammalian cells. We also present evidence that α7 protein can be detected on the surface of HEK293 cells lacking hric3 and those levels do not change significantly in the presence of hric3, thus implicating hric3 as a mediator of folding and/or assembly of nAChR α7 receptors.EXPERIMENTAL PROCEDURESIsolation of Hric3 Coding Sequence—Sequences encoding the hric3 subunit were isolated by standard PCR techniques. Briefly, total adult brain RNA (Clontech, Palo Alto, CA) was used as the template for first strand cDNA synthesis using random hexamers and a Retroscript kit (Ambion, Austin, TX). An initial set of oligonucleotide primers was designed based on the hric3 sequences contained in the GenBank™ data base (GenBank™ accession number NM_024557). A sense strand 23-mer, TGCGACCACCGTGAGCAGTCATG (corresponds to hric3 nt –20 to 3), and an antisense 24-mer, CTGAGGAGAGAGAGGTCACC-TTGG (corresponds to hric3 nt 1142 to 1165), were used in amplification reactions with human adult brain cDNA and KOD Hotstart DNA polymerase (Novagen, Madison, WI). Reactions were performed at 94 °C for 5 min followed by 30 cycles of 94 °C for 20 s, 55 °C for 20 s, and 72 °C for 1.5 min and an additional cycle of 72 °C for 7 min. A second sense strand 37-mer, CTGAATTCGCCACCATGGCGTACTCCACAGT-GCAGAG (contains hric3 nt 1 to 23 preceded by a ribosome binding site and an EcoRI restriction site), and a second antisense strand 34-mer, CTCTCGAGGAGTAATGGATACTTCAGACTGGCTG (contains hric3 nt 1111 to 1136 followed by an XhoI site), were used in a nested amplification reaction with the original PCR product. Following subcloning the reamplified PCR product was sequenced to confirm its identity.PCR—Total RNA was isolated from cell lines using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions and first strand cDNA was synthesized as described above. Three primer pairs based on the cloned human sequence and two primer pairs based on partial rat sequences in GenBank (see Table I) were used in amplification reactions performed at 94 °C for 5 min followed by 30 cycles of 94 °C for 20 s, 58 °C for 20 s, and 72 °C for 60 s. For human templates, primers to glyceraldehyde-3-phosphate dehydrogenase were used in amplification reactions to show the presence of cDNA.Table IPCR primers used in distribution studiesPCR productForward primerReverse primerProduct sizentscNucleotides.HumanaPrimer sequences based on GenBank accession number AY326435. PCR1FP1: TTCTGGGCTTGTCCTGGCTCTGTCGRP1: TTCCATGGCTGCTTCTGTCTCCTTC451 PCR2FP2: TACATCAGCTCCGAGAAATCACCAGRP2: CGAGGTAACAGAATTATCTTCCTGG323 PCR3FP3: AAGGTTACCCTGAAGAGACTTACCRP3: CCTCAGCATGCTGCCTGTATATGC416RatbPrimer sequences based on GenBank accession number XM_219241. PCR4FP4: AAGCCCCGTACATGGAGGACTGGRP4: GTTGATCCCAGCTCAAGTGCTCTG198 PCR5FP4: AAGCCCCGTACATGGAGGACTGGRP5: GTTCAGCTGTTTCTTCAGCAGAGG147a Primer sequences based on GenBank accession number AY326435.b Primer sequences based on GenBank accession number XM_219241.c Nucleotides. Open table in a new tab DNA Constructs and Expression—For initial expression studies the full-length hric3 cDNA was subcloned into the EcoRI-XhoI sites of pcDNA3.1(+). For biochemical studies a hric3 cDNA construct containing the hemagglutinin (HA) tag sequence, YPYDVPDYAL, at its COOH terminus was generated by standard PCR techniques. A full-length human α7 sequence was reported previously (25Elliott K.J. Ellis S.B. Berckhan K.J. Urrutia A. Chavez-Noriega L.E. Johnson E.C. Velicelebi G. Harpold M.M. J. Mol. Neurosci. 1996; 7: 217-228Crossref PubMed Scopus (89) Google Scholar). The insert was subcloned into the EcoRI-XhoI sites of pcDNA3.1(+) for transient expression studies and the BamHI-XhoI sites of pcDNA5/FRT for the development of a stable cell line using the flp-in system (Invitrogen, Carlsbad, CA). A cell line stably expressing the nAChRα7 subunit, designated A7-3, was developed in HEK293 cells according to the manufacturer's instructions. For some biochemical studies an α7 cDNA construct containing the HA epitope tag at a unique HindIII site (nt 82) near the amino terminus of the α7 coding sequence was generated. For transient expression studies in the A7-3 stable cell line cells plated in 10-cm dishes were transfected with a total of 24 μg of a hric3-containing expression plasmid or the bacterial expression plasmid pGEM7z. For experiments in which both α7 and hric3 were transiently expressed, HEK293 cells were transfected with α7 and hric3 DNAs in a 1:1 ratio. All transfections were performed with Lipofectamine 2000 (Invitrogen) and transfection efficiency, estimated to be 70–90%, monitored by expression of a green fluorescent protein construct. Cells were examined for protein expression 24–48 h after transfection.Western Blots—Proteins were separated on 8 or 4–20% gradient acrylamide gels and transferred to nitrocellulose filters (Amersham Biosciences). Blots were blocked overnight at 4 °C in PBS-T (PBS containing 0.1% Tween 20) with 5% dried milk followed by incubation with primary antibodies in PBS-T for 3 h at room temperature. The following primary antibodies were used: α7 antibody (C-20, Santa Cruz Biotechnologies, Santa Cruz, CA) at a 1:200 dilution, a HA epitope antibody (clone HA-7, Sigma) at a 1:10000 dilution, a p42 MAP kinase antibody (Cell Signaling, Beverly, MA) at a 1:700 dilution, and a COX IV antibody (Molecular Probes, Eugene, OR) at a final concentration of 0.2 μg/ml. The blots were washed with PBS-T (3 to 5 changes) followed by incubation for 1 h with a 1:150,000 dilution of horseradish peroxidase-linked sheep anti-goat Ig (Sigma) for α7 detection, a 1:3000 dilution of horseradish peroxidase-linked goat anti-rabbit Ig (Amersham Biosciences) for p42 MAP kinase detection, or with a 1:2000 dilution of horseradish peroxidase-linked sheep anti-mouse Ig (Amersham Biosciences) for HA epitope and COX IV detection. Filters were subsequently washed with PBS-T (8 changes) and developed with the Lumi-Glo chemiluminescence substrate reagent (KPL, Gaithersburg, MD).Immunoprecipitations—Total cell membranes were prepared as described elsewhere (26Hans M. Luvisetto S. Williams M.E. Spagnolo M. Urrutia A. Tottene A. Brust P.F. Johnson E.C. Harpold M.M. Stauderman K.A. Pietrobon D. J. Neurosci. 1999; 19: 1610-1619Crossref PubMed Google Scholar). Membrane preparation, solubilization, and all subsequent steps were performed at 4 °C. Membranes were solubilized in PBS containing 1.0% Triton X-100 and Complete protease inhibitors (Roche Molecular Biochemicals) by rocking at 4 °C for 1 h. The lysate was centrifuged at 20,000 × g for 20 min and the supernatant removed to a new tube. To immunoprecipitate the α7 subunit, 5 μgof α7-specific antibody (C-20, Santa Cruz Biotechnology) and 50 μl of protein G-Sepharose beads (Amersham Biosciences) were added and incubated overnight. To immunoprecipitate the HA-tagged hric3 subunit 50 μl of HA affinity gel (Sigma) was added and incubated overnight. Samples were washed 4 times with 1 ml of chilled PBS containing protease inhibitors, resuspended in SDS-PAGE sample buffer, and analyzed by Western blot as described above.Cell Surface Biotinylation—Cells on tissue culture dishes were washed 3 times with chilled PBS and incubated in the same buffer containing 0.5 mg/ml sulfo-NHS-LC-biotin (Pierce) for 20 min at 4 °C. The reaction was quenched by washing 3 times with chilled PBS containing 100 mm glycine. Cells were lysed and proteins were solubilized in PBS, 1% Triton X-100. Approximately 1 mg of solubilized protein was incubated with 70 μl of neutravidin-agarose (Pierce) overnight at 4 °C. Beads were washed 4 times and bound protein was eluted by heating in SDS-PAGE buffer. Samples were electrophoresed and analyzed by Western blot with antibodies to α7, HA epitope tag, p42 MAP kinase, and COX IV.Immunofluorescence Staining—Mammalian cells expressing nAChR α7 alone, hric3 alone, or nAChR α7 + hric3 were plated on poly-d-lysine-coated glass coverslips (BD Biosciences, Bedford, MA) in a 24-well plate at a density of ∼1 to 2 × 105 cells/12-mm coverslip. Live, intact cells were stained with Alexa Fluor 488-labeled α-Bgt (Molecular Probes) at a 1:500 dilution and a rabbit polyclonal anti-HA antibody (Sigma) at a 1:50 dilution. The secondary antibody was an Alexa Fluor 594-labeled goat anti-rabbit Ig (Molecular Probes) used at a 1:400 dilution. The primary antibody and α-Bgt were added directly to the growth media or diluted in PBS/bovine serum albumin and allowed to react with the cells for 1 h. Cells were rinsed 3 times and incubated with the second antibody for 30 min. Cells were rinsed 4 times with 1× PBS and fixed in 4% paraformaldehyde/PBS for 15 min at room temperature. After a final wash with 1× PBS, coverslips were dried and mounted on glass slides for visualization with a Zeiss LSM510 confocal microscope. In other experiments cells were fixed and permeabilized prior to Ab incubations.HEK293 Electrophysiology—Transient transfections for electrophysiological characterization included pCMVCD4, a human CD4+ expression plasmid, to permit the identification of transfected cells. Prior to recording, cells were washed with mammalian Ringer's solution, incubated for ∼10 min in a solution containing a 1/1000 dilution of M-450 CD4+ Dynabeads (Dynal Inc., Lake Success, NY) and rewashed with mammalian Ringer's solution to remove excess beads. Expression of functional α7 receptors in transfected cells was evaluated 24–48 h following transfection using the whole cell patch clamp technique. All recordings were performed on single cells at room temperature (19–24 °C). Whole cell currents were recorded using an EPC-9 (HEKA elektronik, Lambrecht, Germany) patch clamp amplifier, low-pass filtered at 1 kHz (–3 dB, 8-pole Bessel filter), and digitized at a rate of 10 kHz, unless otherwise stated. Pipettes were manufactured from borosilicate glass (TW150, WPI, Sarasota, FL) and had a resistance of 1.1–2.0 MΩ when filled with internal solution. Series resistances were 2–4 MΩ prior to compensation. The cell capacitance range was 5.7 to 13.6 pF. The pipette solution contained (in mm): 110 Tris phosphate dibasic, 28 Tris, 11 EGTA, 0.1 CaCl2, 4 ATP, 2 MgCl2 (pH 7.3, adjusted with Tris). The external solution contained (in mm): 120 NaCl, 3 KCl, 2 MgCl2, 2 CaCl2, 25 glucose, 10 HEPES (pH 7.3, adjusted with Tris). The membrane potential of individual HEK293 cells was held at –90 mV.Nicotine was obtained from Sigma. Stock solutions were prepared in water and stored at –20 °C. Nicotine was dissolved in the external solution and applied for 300 ms using a fast application system consisting of a triple-barrel glass pipette attached to an electromechanical switching device (piezo-electric drive, Winston Electronics, Millbrae, CA). The speed of solution exchange between control and nicotine-containing solution, measured as the open-tip response, displayed a time constant of 0.7 ms, with a steady state reached in less than 1.5 ms.Xenopus Oocyte Electrophysiology—Sections of ovary were surgically isolated from anesthetized Xenopus frogs (Nasco, Fort Atkinson, WI). Mature females were anesthetized by immersion in a 0.1% tricaine methanesulfonate solution and oocytes were surgically removed. The follicular cell layer was enzymatically removed by gentle shaking with collagenase (Worthington, Type II, 1.7 mg/ml for 90 min, then Sigma, Type II, 1.7 mg/ml for 30 min) in Ca2+-free Barth's solution. Oocyte injection and incubation methods used in this work were as previously reported (27Chavez-Noriega L.E. Crona J.H. Washburn M.S. Urrutia A. Elliott K.J. Johnson E.C. J. Pharmacol. Exp. Ther. 1997; 280: 346-356PubMed Google Scholar), with minor changes as indicated below. Oocytes were injected with 50 nl containing 25 ng of α7 in vitro synthesized mRNA. In vitro transcribed hric3 RNA was injected in a 1:1 ratio when co-injected with rat or human α7. Following injection, oocytes were incubated at 16–19 °C for 4–7 days in Oocyte Ringer-3 medium containing 50% L-15 medium, 100 μg/ml gentamicin, 25 μg/ml tetracycline, 4 mm glutamine, and 30 mm Na-HEPES (all from Invitrogen), with pH adjusted to 7.6 with NaOH. The extracellular recording solution (standard Ringer's) contained (in mm): NaCl (115), KCl (2.5), BaCl2 (1.8), HEPES (10Martin L.F. Kem W.R. Freedman R. Psychopharmacology (Berl.). 2004; 174: 54-64Crossref PubMed Scopus (318) Google Scholar), atropine (0.001), pH 7.3. Functional expression was examined using the two-electrode voltage clamp technique; membrane potential was held at –70 mV.Concentration-response curves were obtained by normalizing the current responses to varying concentrations of ACh to the maximal response observed to saturating concentrations of ACh in each oocyte. Curves were fitted by nonlinear regression to the Hill equation (27Chavez-Noriega L.E. Crona J.H. Washburn M.S. Urrutia A. Elliott K.J. Johnson E.C. J. Pharmacol. Exp. Ther. 1997; 280: 346-356PubMed Google Scholar). Statistical significance between groups was assessed with a Student's t test (SigmaStat, SPSS Inc.).RESULTSHric3 mRNA Is Present in Neuronal Cells and Absent in HEK293 Cells—We amplified and subcloned the hric3 coding sequence from human adult brain RNA using primers based on sequence in the GenBank data base. Sequence analysis indicates that the coding sequence isolated here is identical to GenBank™ accession number AY326435 except for the absence of a single serine residue (Ser-173 in AY326435). This polymorphism was described previously (24Halevi S. Yassin L. Eshel M. Sala F. Sala S. Criado M. Treinin M. J. Biol. Chem. 2003; 278: 34411-34417Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar).We used PCR to examine hric3 mRNA expression in several cell lines. Primers directed to portions of the hric3 coding sequence (Table I, Fig. 1A) were used to detect transcripts using standard PCR assays. As shown in Fig. 1B, we detected hric3 transcripts in brain tissue and the SH-SY5Y cell line, a human neuronal cell line known to express endogenous α7 receptors (28Peng X. Katz M. Gerzanich V. Anand R. Lindstrom J. Mol. Pharmacol. 1994; 45: 546-554PubMed Google Scholar). In contrast, hric3 transcripts were not detected in HEK293 cells with primer pairs covering the majority of the hric3 coding sequence. A primer pair covering the extreme 3′ end of the coding sequence generated low, but detectable, levels of a fragment of the expected size from HEK293 cells, indicating that low levels of at least a portion of the hric3 transcript may be present in these cells.We extended our analyses to determine whether ric-3 is expressed in additional cell lines known to express functional α7 receptors. Primers homologous to the rat ric-3 subunit (Table I, Fig. 1C) were again used in standard PCR assays using cDNA generated from rat brain, PC12, and GH4C1 cells. In all cases PCR products of the expected size were detected (Fig. 1D), indicating the presence of ric-3 transcripts in these cell lines.α7 Protein Is Detected on the Surface of HEK293 Cells Lacking Hric3—We developed a HEK-based stable cell line constitutively expressing the α7 subunit (A7-3 cells) using the flp-in system. As demonstrated in Fig. 2A, A7-3 cells express α7 protein with a pattern similar to that observed in HEK293 cells transiently transfected with the human α7 subunit. The presence of the doublet at ∼60 kDa observed in HEK293 cells was similar to the pattern observed with human recombinant α7 expressed in GH4C1 cells 2M. E. Williams, B. O. Claeps, A. Rush, and L. E. Chavez-Noriega, unpublished observations. and may reflect differential posttranslational processing of the α7 protein. Despite the presence of α7 protein, patch clamp studies failed to identify detectable currents through α7 channels (Fig. 7).Fig. 2Immunoblot analysis of α7 expression in HEK293 cells.A, total α7 expression in HEK293 cells. Total membrane proteins (10 μg/lane) from transiently transfected HEK293 cells and an HEK293-based stable cell line were separated on an 8% gel and immunostained with polyclonal antisera specific for the α7 subunit. B, cell surface expression of the α7 subunit. Biotinylated surface proteins from whole cells were isolated with neutravidin-linked beads and separated on a 4–20% gradient gel. After protein transfer to nitrocellulose the filter was cut horizontally at the 50-kDa marker and below the 36-kDa marker to allow identification of multiple proteins in the same lane. The upper filter was immunostained with α7 antisera, the middle filter was immunostained with p42 MAP kinase antisera, and the lower filter was immunostained with a COX IV mAb. The subunits are denoted with arrows.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 7Whole cell currents in A7-3 cells co-expressing α7 and hric3. Representative traces of current responses to 1 mm ACh applied during the time indicated by the horizontal bar in two different cells mock transfected (black trace) or transfected with hric3 (gray trace). Traces are typical currents observed at a holding potential of –90 mV.View Large Image Figure ViewerDownload Hi-res image Download (PPT)We next examined if the lack of functional expression was because of lack of surface expression of α7 receptors. We biotinylated cell-surface proteins and isolated them by binding to streptavidin-linked agarose beads. The presence of α7 protein was subsequently detected by Western blot analysis. Fig. 2B shows that in the A7-3 cell line a detectable, albeit a proportionally low, level of α7 protein was biotinylated and pulled down with streptavidin beads, indicating its presence on the cell surface. To exclude the possibility of intracellular protein contamination, we also looked for the presence of COX IV, an integral mitochondrial membrane protein, and p42 MAP kinase, a cytosolic protein, in the biotinylation experiment. As demonstrated in Fig. 2B, neither COX IV nor p42 MAP kinase were detected, consistent with the biotinylation of only cell-surface proteins.α7 and Hric3 Proteins Co-associate—To determine whether hric3 can form a stable complex with the human α7 subunit we performed coimmunoprecipitations using untransfected A7-3 cells, A7-3 cells transiently expressing the hric3-HA fusion protein, or HEK293 cells transiently expressing the hric3-HA protein. Proteins were immunoprecipitated with subunit-specific antibodies from detergent extracts of total membrane fractions. The antibody to the HA epitope tag immunoprecipitated both the α7 subunit and the hric3-HA fusion protein from hric3-transfected A7-3 cells (Fig. 3, samples 1 and 5). There was no signal when using the HA epitope antibody with untransfected A7-3 cell extracts (samples 2 and 6). Conversely, the α7-specific antibody immunoprecipitated both the α7 and hric3 subunits from hric3-transfected A7-3 cells (samples 3 and 7). There was no signal from hric3-transfected HEK293 cells (samples 4 and 8). These results demonstrate that α7 and hric3 are able to form a stable complex in HEK293 cells.Fig. 3Physical association of α7 and hric3 subunits. Anti-α7 or anti-HA epitope antibodies were used to immunoprecipitate proteins from Triton-solubilized cell membrane fractions. For hric3 the immunoprecipitatio