Portal de Periódicos da CAPES

Protein Inhibitor of Activated STAT1 Interacts with and Up-regulates Activities of the Pro-proliferative Transcription Factor Krüppel-like Factor 5

2006; Elsevier BV; Volume: 282; Issue: 7 Linguagem: Inglês

10.1074/jbc.m603413200

1083-351X

James X. Du, C. Chris Yun, Agnieszka B. Bialkowska, Vincent W. Yang,

Genetic Syndromes and Imprinting

Krüppel-like factor 5 (KLF5) is a zinc finger-containing transcription factor that regulates proliferation of various cell types, including fibroblasts, smooth muscle cells, and intestinal epithelial cells. To identify proteins that interact with KLF5, we performed a yeast two-hybrid screen of a 17-day mouse embryo cDNA library with KLF5 as bait. The screen revealed 21 preys clustered in four groups as follows: proteins mediating gene expression, metabolism, trafficking, and signaling. Among them was protein inhibitor of activated STAT1 (PIAS1), a small ubiquitin-like modifier (SUMO) ligase that regulates transcription factors through SUMOylation or physical interaction. Association between PIAS1 and KLF5 was verified by co-immunoprecipitation. Structural determination showed that the acidic domain of PIAS1 bound to both the amino- and carboxyl-terminal regions of KLF5 and that this interaction was inhibited by the amino terminus of PIAS1. Indirect immunofluorescence demonstrated that PIAS1 and KLF5 co-localized to the nucleus. Furthermore, the PIAS1-KLF5 complex was co-localized with the TATA-binding protein and was enriched in RNA polymerase II foci. Transient transfection of COS-7 cells by PIAS1 and KLF5 significantly increased the steady-state protein levels of each other. Luciferase reporter and chromatin immunoprecipitation assays showed that PIAS1 significantly activated the promoters of KLF5 and PIAS1 and synergistically increased the transcriptional activity of KLF5 in activating the cyclin D1 and Cdc2 promoters. Importantly, PIAS1 increased the ability of KLF5 to enhance cell proliferation in transfected cells. These results indicate that PIAS1 is a functional partner of KLF5 and enhances the ability of KLF5 to promote proliferation. Krüppel-like factor 5 (KLF5) is a zinc finger-containing transcription factor that regulates proliferation of various cell types, including fibroblasts, smooth muscle cells, and intestinal epithelial cells. To identify proteins that interact with KLF5, we performed a yeast two-hybrid screen of a 17-day mouse embryo cDNA library with KLF5 as bait. The screen revealed 21 preys clustered in four groups as follows: proteins mediating gene expression, metabolism, trafficking, and signaling. Among them was protein inhibitor of activated STAT1 (PIAS1), a small ubiquitin-like modifier (SUMO) ligase that regulates transcription factors through SUMOylation or physical interaction. Association between PIAS1 and KLF5 was verified by co-immunoprecipitation. Structural determination showed that the acidic domain of PIAS1 bound to both the amino- and carboxyl-terminal regions of KLF5 and that this interaction was inhibited by the amino terminus of PIAS1. Indirect immunofluorescence demonstrated that PIAS1 and KLF5 co-localized to the nucleus. Furthermore, the PIAS1-KLF5 complex was co-localized with the TATA-binding protein and was enriched in RNA polymerase II foci. Transient transfection of COS-7 cells by PIAS1 and KLF5 significantly increased the steady-state protein levels of each other. Luciferase reporter and chromatin immunoprecipitation assays showed that PIAS1 significantly activated the promoters of KLF5 and PIAS1 and synergistically increased the transcriptional activity of KLF5 in activating the cyclin D1 and Cdc2 promoters. Importantly, PIAS1 increased the ability of KLF5 to enhance cell proliferation in transfected cells. These results indicate that PIAS1 is a functional partner of KLF5 and enhances the ability of KLF5 to promote proliferation. Understanding the molecular basis of cellular proliferation and signaling is an important goal in studying various disease conditions. Regulation of gene transcription plays an essential role in these processes. A number of Krüppel-like transcription factors play important roles in regulating cell proliferation and differentiation or in the pathogenesis of many diseases. Among them is Krüppel-like factor (KLF) 2The abbreviations used are: KLF, Krüppel-like factor; ANKRD17, ankyrin-repeat domain 17; ARFGAP3, ADP-ribosylation factor GTPase-activating protein 3; BrdUrd, bromodeoxyuridine; BSA, bovine serum albumin; ChIP, chromatin immunoprecipitation; DCK, deoxycytidine kinase; FITC, fluorescein isothiocyanate; FXNa, putative amino peptidase FXNa; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HA, hemagglutinin; HNRPF, heterogeneous ribonucleoprotein F; ICGC, interchromatin granule cluster; MAPK, mitogen-activated protein kinase; NEM, N-ethylmaleimide; PCCA, propionyl coenzyme A carboxylase,α; PIAS1, protein inhibitor of activated STAT1; PI 3-kinase, phosphatidylinositol 3-kinase; PMM2, phosphomannomutase 2; pol II, RNA polymerase II; RRX, Rhodamine Red-X; SAF-A, scaffold attachment factor A; SAF-B, scaffold attachment factor B; SFRS15, splicing factor, arginine/serine-rich 15; SNAP23, synaptosomal associated protein 23; SNX3, sorting nexin 3; STAT1, signal transducer and activator of transcription 1; SUMO, small ubiquitin-like modifier; TBP, TATA-binding protein; TGF-β, transforming growth factor-β; X-gal, 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside. 5, which belongs to the Sp/KLF family of transcription factors (1.Bieker J.J. J. Biol. Chem. 2001; 276: 34355-34358Abstract Full Text Full Text PDF PubMed Scopus (540) Google Scholar, 2.Black A.R. Black J.D. Azizkhan-Clifford J. J. Cell. Physiol. 2001; 188: 143-160Crossref PubMed Scopus (898) Google Scholar, 3.Dang D.T. Pevsner J. Yang V.W. Int. J. Biochem. Cell Biol. 2000; 32: 1103-1121Crossref PubMed Scopus (369) Google Scholar, 4.Kaczynski J. Cook T. Urrutia R. Genome Biol. 2003; 4: 206.1-206.8Crossref Scopus (746) Google Scholar). KLF5 (also known as intestine-enriched Krüppel-like factor or IKLF) (5.Conkright M.D. Wani M.A. Anderson K.P. Lingrel J.B. Nucleic Acids Res. 1999; 27: 1263-1270Crossref PubMed Scopus (143) Google Scholar, 6.Shi H. Zhang Z. Wang X. Liu S. Teng C.T. Nucleic Acids Res. 1999; 27: 4807-4815Crossref PubMed Scopus (62) Google Scholar) is an important regulator of cell proliferation (7.Ghaleb A.M. Nandan M.O. Chanchevalap S. Dalton W.B. Hisamuddin I.M. Yang V.W. Cell Res. 2005; 15: 92-96Crossref PubMed Scopus (255) Google Scholar). Expression of KLF5 is enriched in the proliferating crypt cells of the intestinal epithelium (5.Conkright M.D. Wani M.A. Anderson K.P. Lingrel J.B. Nucleic Acids Res. 1999; 27: 1263-1270Crossref PubMed Scopus (143) Google Scholar, 8.Ohnishi S. Laub F. Matsumoto N. Asaka M. Ramirez F. Yoshida T. Terada M. Dev. Dyn. 2000; 217: 421-429Crossref PubMed Scopus (76) Google Scholar). In nontransformed intestinal epithelial cells and fibroblasts, overexpression of KLF5 promotes proliferation (9.Bateman N.W. Tan D. Pestell R.G. Black J.D. Black A.R. J. Biol. Chem. 2004; 279: 12093-12101Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 10.Chanchevalap S. Nandan M.O. Merlin D. Yang V.W. FEBS Lett. 2004; 578: 99-105Crossref PubMed Scopus (72) Google Scholar, 11.Nandan M.O. Chanchevalap S. Dalton W.B. Yang V.W. FEBS Lett. 2005; 579: 4757-4762Crossref PubMed Scopus (71) Google Scholar, 12.Nandan M.O. Yoon H.S. Zhao W. Ouko L.A. Chanchevalap S. Yang V.W. Oncogene. 2004; 23: 3404-3413Crossref PubMed Scopus (119) Google Scholar, 13.Sun R. Chen X. Yang V.W. J. Biol. Chem. 2001; 276: 6897-6900Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). A mechanism by which KLF5 accomplishes its proproliferative effect is to transcriptionally activate several cell cycle-promoting genes, including cyclin D1, cyclin B1, and Cdc2 (9.Bateman N.W. Tan D. Pestell R.G. Black J.D. Black A.R. J. Biol. Chem. 2004; 279: 12093-12101Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 11.Nandan M.O. Chanchevalap S. Dalton W.B. Yang V.W. FEBS Lett. 2005; 579: 4757-4762Crossref PubMed Scopus (71) Google Scholar, 12.Nandan M.O. Yoon H.S. Zhao W. Ouko L.A. Chanchevalap S. Yang V.W. Oncogene. 2004; 23: 3404-3413Crossref PubMed Scopus (119) Google Scholar). As such, KLF5 has been shown to be an important mediator for the transforming effect of oncogenic H-Ras (11.Nandan M.O. Chanchevalap S. Dalton W.B. Yang V.W. FEBS Lett. 2005; 579: 4757-4762Crossref PubMed Scopus (71) Google Scholar, 12.Nandan M.O. Yoon H.S. Zhao W. Ouko L.A. Chanchevalap S. Yang V.W. Oncogene. 2004; 23: 3404-3413Crossref PubMed Scopus (119) Google Scholar). Upon overexpression, KLF5 itself leads to cellular transformation (13.Sun R. Chen X. Yang V.W. J. Biol. Chem. 2001; 276: 6897-6900Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). These studies illustrate an important function of KLF5 in regulating cellular proliferation. To further elucidate the biochemical mechanisms of action of KLF5 in regulating physiologically relevant processes such as growth and proliferation, we conducted a yeast two-hybrid screen to identify its interacting partners. Among the preys identified was protein inhibitor of activated STAT1 (PIAS1). The interaction between KLF5 and PIAS1 was further characterized. PIAS1 is a member of the PIAS family of proteins consisting of PIAS1, PIAS3, PIASx, and PIASy (14.Shuai K. Liu B. Nat. Rev. Immunol. 2005; 5: 593-605Crossref PubMed Scopus (348) Google Scholar). Mammalian PIAS proteins were initially identified as negative regulators of STAT signaling (15.Chung C.D. Liao J. Liu B. Rao X. Jay P. Berta P. Shuai K. Science. 1997; 278: 1803-1805Crossref PubMed Scopus (805) Google Scholar, 16.Liu B. Liao J. Rao X. Kushner S.A. Chung C.D. Chang D.D. Shuai K. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10626-10631Crossref PubMed Scopus (633) Google Scholar). PIAS proteins contain a RING domain and exhibit small ubiquitin-related modifier (SUMO) E3 ligase activity (17.Jackson P.K. Genes Dev. 2001; 15: 3053-3058Crossref PubMed Scopus (201) Google Scholar, 18.Schmidt D. Muller S. Cell. Mol. Life Sci. 2003; 60: 2561-2574Crossref PubMed Scopus (223) Google Scholar). SUMO is a small protein with 32% identity to ubiquitin and is covalently attached to substrate proteins (19.Dohmen R.J. Biochim. Biophys. Acta. 2004; 1695: 113-131Crossref PubMed Scopus (205) Google Scholar, 20.Gill G. Curr. Opin. Genet. Dev. 2003; 13: 108-113Crossref PubMed Scopus (193) Google Scholar, 21.Gill G. Genes Dev. 2004; 18: 2046-2059Crossref PubMed Scopus (622) Google Scholar, 22.Girdwood D.W. Tatham M.H. Hay R.T. Semin. Cell Dev. Biol. 2004; 15: 201-210Crossref PubMed Scopus (152) Google Scholar, 23.Hay R.T. Mol. Cell. 2005; 18: 1-12Abstract Full Text Full Text PDF PubMed Scopus (1327) Google Scholar, 24.Johnson E.S. Annu. Rev. Biochem. 2004; 73: 355-382Crossref PubMed Scopus (1385) Google Scholar). SUMOylation typically occurs at the lysine residue of a consensus motif, ΨKXE (where Ψ is hydrophobic and X is any amino acid) (19.Dohmen R.J. Biochim. Biophys. Acta. 2004; 1695: 113-131Crossref PubMed Scopus (205) Google Scholar, 20.Gill G. Curr. Opin. Genet. Dev. 2003; 13: 108-113Crossref PubMed Scopus (193) Google Scholar, 21.Gill G. Genes Dev. 2004; 18: 2046-2059Crossref PubMed Scopus (622) Google Scholar, 22.Girdwood D.W. Tatham M.H. Hay R.T. Semin. Cell Dev. Biol. 2004; 15: 201-210Crossref PubMed Scopus (152) Google Scholar, 24.Johnson E.S. Annu. Rev. Biochem. 2004; 73: 355-382Crossref PubMed Scopus (1385) Google Scholar, 25.Ferrier V. Nat. Cell Biol. 2002; 4: E57Crossref PubMed Scopus (2) Google Scholar). Although PIAS proteins SUMOylate transcription factors such as p53, SMAD4, and STAT1 (26.Kahyo T. Nishida T. Yasuda H. Mol. Cell. 2001; 8: 713-718Abstract Full Text Full Text PDF PubMed Scopus (391) Google Scholar, 27.Liang M. Melchior F. Feng X.H. Lin X. J. Biol. Chem. 2004; 279: 22857-22865Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 28.Megidish T. Xu J.H. Xu C.W. J. Biol. Chem. 2002; 277: 8255-8259Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 29.Schmidt D. Muller S. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 2872-2877Crossref PubMed Scopus (371) Google Scholar), they can also regulate activities of their targets by protein-protein interaction without SUMOylation (14.Shuai K. Liu B. Nat. Rev. Immunol. 2005; 5: 593-605Crossref PubMed Scopus (348) Google Scholar). Recent studies indicate that PIAS1 directly binds to A/T-rich DNA segments through its SAP (SAF-A/B, Acinus, and PIAS) domain (30.Okubo S. Hara F. Tsuchida Y. Shimotakahara S. Suzuki S. Hatanaka H. Yokoyama S. Tanaka H. Yasuda H. Shindo H. J. Biol. Chem. 2004; 279: 31455-31461Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). PIAS1 also interacts with TATA-binding protein (TBP), a rate-limiting factor for initiation of transcription (31.Prigge J.R. Schmidt E.E. J. Biol. Chem. 2006; 281: 12260-12269Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar). TBP is a subunit of TFIID, which is the first protein to bind to DNA during the formation of the preinitiation complex of RNA polymerase II (pol II). TFIID binding initiates the recruitment of other factors required for pol II to begin transcription (32.Timmers H.T. Meyers R.E. Sharp P.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 8140-8144Crossref PubMed Scopus (58) Google Scholar). pol II is mainly localized to nuclear speckles termed pol II foci (33.Iborra F.J. Pombo A. Jackson D.A. Cook P.R. J. Cell Sci. 1996; 109: 1427-1436Crossref PubMed Google Scholar, 34.Jackson D.A. Hassan A.B. Errington R.J. Cook P.R. EMBO J. 1993; 12: 1059-1065Crossref PubMed Scopus (524) Google Scholar), which overlie three spatially connected nuclear compartments, perichromatin fibrils, interchromatin granule clusters (ICGCs), and Cajal bodies (35.Dundr M. Misteli T. Biochem. J. 2001; 356: 297-310Crossref PubMed Scopus (330) Google Scholar). Cajal bodies are initial assembly sites for pol II transcription machineries (35.Dundr M. Misteli T. Biochem. J. 2001; 356: 297-310Crossref PubMed Scopus (330) Google Scholar), which are delivered to ICGCs for storage and subsequently transported to active transcription sites located at the periphery of perichromatin fibrils, which represent nascent transcripts (35.Dundr M. Misteli T. Biochem. J. 2001; 356: 297-310Crossref PubMed Scopus (330) Google Scholar, 36.Mintz P.J. Spector D.L. J. Struct. Biol. 2000; 129: 241-251Crossref PubMed Scopus (64) Google Scholar). Rapid shuttle of proteins between these compartments constantly occurs (35.Dundr M. Misteli T. Biochem. J. 2001; 356: 297-310Crossref PubMed Scopus (330) Google Scholar). Remarkably, many of the TBP-interacting proteins isolated in yeast two-hybrid screens encoded either PIAS1 or PIAS3 (31.Prigge J.R. Schmidt E.E. J. Biol. Chem. 2006; 281: 12260-12269Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar). Both PIAS1 and TBP bind to the minor groove of the A/T-rich DNA (30.Okubo S. Hara F. Tsuchida Y. Shimotakahara S. Suzuki S. Hatanaka H. Yokoyama S. Tanaka H. Yasuda H. Shindo H. J. Biol. Chem. 2004; 279: 31455-31461Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 37.Kim J.L. Nikolov D.B. Burley S.K. Nature. 1993; 365: 520-527Crossref PubMed Scopus (971) Google Scholar). Thus, PIAS1 may be important in regulating TBP. TBP is presumably localized to chromatin where transcription is initiated. However, it can also be localized to the storage/assembly sites for pol II transcription machineries such as Cajal bodies (38.Handwerger K.E. Murphy C. Gall J.G. J. Cell Biol. 2003; 160: 495-504Crossref PubMed Scopus (68) Google Scholar). Previously, the role of PIAS1 as a SUMO E3 ligase was extensively studied. However, how PIAS1 acts as a transcriptional co-regulator was less well established, in part because the effects of PIAS1 in regulating transcription are highly context- and target-dependent. This study reports the identification of 21 preys that interact with KLF5 in a yeast two-hybrid screen. They include proteins involved in gene expression, metabolism, trafficking, and signaling. A specific interaction is demonstrated between KLF5 and PIAS1. A consequence of this interaction is enhanced steady-state levels of both proteins. This leads to a synergistic increase in the ability of KLF5 to transcriptionally activate a number of target genes that are important for cell cycle progression and to stimulate cell proliferation. Consistent with the up-regulation of KLF5 transcriptional activity by PIAS1, KLF5 and PIAS1 co-localize with TBP to pol II nuclear foci. These results indicate that PIAS1 is a positive regulator that enhances the transcriptional ability of KLF5 to promote proliferation. Plasmid Constructs−The bait plasmid, pGBKT7-KLF5, was constructed by fusing the coding region of mouse KLF5 (5.Conkright M.D. Wani M.A. Anderson K.P. Lingrel J.B. Nucleic Acids Res. 1999; 27: 1263-1270Crossref PubMed Scopus (143) Google Scholar) to the GAL4 DNA-binding domain present in the pGBKT7 plasmid (Clontech). Several constructs were generated that contained partial deletions in the KLF5 sequence using appropriate restriction endonucleases. The pGADT7-Rec-PIAS1 plasmid was recovered from the yeast two-hybrid screen as a prey that specifically interacted with KLF5. Several deletion constructs were generated from this plasmid to produce truncated PIAS1 sequences. The pGL3-mPIAS1 luciferase reporter plasmid was generated by cloning 2 kb of the mouse PIAS1 promoter from genomic DNA using PCR. To generate the KLF5 luciferase reporter plasmid, pGL3-mKLF5, a 1.6-kb mouse KLF5 promoter was amplified from a bacterial artificial chromosome clone, RPCI-23 302C3 (ResGen, Invitrogen), and inserted into pGL3-Basic (Promega). Expression constructs containing 3xFLAG-PIAS1, 3xFLAG-PIAS3, and the PDGF-A luciferase reporter plasmids were generous gifts of Drs. K. Morohashi and D. Kaetzel (39.Komatsu T. Mizusaki H. Mukai T. Ogawa H. Baba D. Shirakawa M. Hatakeyama S. Nakayama K.I. Yamamoto H. Kikuchi A. Morohashi K. Mol. Endocrinol. 2004; 18: 2451-2462Crossref PubMed Scopus (97) Google Scholar, 40.Sapetschnig A. Rischitor G. Braun H. Doll A. Schergaut M. Melchior F. Suske G. EMBO J. 2002; 21: 5206-5215Crossref PubMed Scopus (226) Google Scholar, 41.Zhang Q. Pedigo N. Shenoy S. Khalili K. Kaetzel D.M. Gene (Amst.). 2005; 348: 25-32Crossref PubMed Scopus (16) Google Scholar). PMT3-KLF5, pMT3-KLF5-HA, and the cyclin D1 and Cdc2 luciferase reporter plasmids were described previously (11.Nandan M.O. Chanchevalap S. Dalton W.B. Yang V.W. FEBS Lett. 2005; 579: 4757-4762Crossref PubMed Scopus (71) Google Scholar, 12.Nandan M.O. Yoon H.S. Zhao W. Ouko L.A. Chanchevalap S. Yang V.W. Oncogene. 2004; 23: 3404-3413Crossref PubMed Scopus (119) Google Scholar). Yeast Two-hybrid Screening−To perform yeast two-hybrid screening, pGBKT7-KLF5 was used as the bait. This plasmid was transformed into the yeast strain AH109. The resulting strain was mated with the yeast strain Y187 pre-transformed with a MATCHMAKER 17-day mouse embryo cDNA library (Clontech) and selected on synthetic dropout (SD) plates lacking adenine, histidine, leucine, and tryptophan (SD/-ade/-his/-leu/-trp). Colonies obtained from the screen were confirmed by re-streaking on SD/-ade/-his/-leu/-trp containing X-gal. Plasmids from the positive clones were isolated, rescued in Escherichia coli, and sequenced to identify their cDNA inserts. The bait and prey were then co-transformed into AH109, and the specificity of the interactions was confirmed by growth on SD/-ade/-his/-leu/-trp plates. For deletion analysis, the various KLF5 bait and PIAS1 prey plasmids were co-transformed into AH109, and interactions were confirmed by growth on SD/-ade/-his/-leu/-trp in the absence or presence of X-gal. Transfection, Co-immunoprecipitation, and Western Blotting− COS-7 cells were transfected using Lipofectamine 2000 (Invitrogen) with pMT3 vector alone, pMT3-KLF5-HA, 3xFLAG-PIAS1, or pMT3-KLF5-HA and 3xFLAG-PIAS1. Twenty four hours following transfection, the cells were lysed by boiling in SDS sample buffer (0.625 m Tris-HCl, pH 6.8, 2% SDS, 8.75% glycerol containing 20 mm N-ethylmaleimide (NEM), 5% of 2-mercaptoethanol, 0.5 mm phenylmethylsulfonyl fluoride (PMSF), and 5 μg/ml aprotinin) for 10 min. Then acid-washed glass beads (Sigma) were added, and the mixture was vigorously vortexed for 1 min to shear the DNA and reduce viscosity. The lysates were centrifuged at 10,000 × g for 1 min, and the supernatant was saved for further analysis. For co-immunoprecipitation, COS-7 cells were transfected with the indicated plasmids. Vector alone was also transfected whenever necessary to compensate for the total amount of plasmids transfected. One or 2 days after transfection, the cells were lysed in 20 mm Tris-HCl, pH 7.4, 1% Nonidet P-40, 135 mm NaCl, and 20 mm NEM containing a protease inhibitor mixture (Roche Applied Science). The lysate was incubated with a polyclonal anti-HA or monoclonal anti-FLAG antibody (Sigma) at 4 °C for 1 h. Pre-washed EZview Red protein G affinity gel (Sigma) was then added, and the mixture was rocked for an additional hour. The immune complexes were washed four times, and the precipitated proteins were detected by Western blotting with a monoclonal anti-HA (Covance), anti-FLAG (Sigma), or rabbit polyclonal anti-KLF5 antibody (raised against residues 95–111 of mouse KLF5). For immunoprecipitation of endogenous KLF5 and PIAS1, nuclear extracts from COS-7 cells were prepared, and immunoprecipitation was performed with a nuclear extract/co-immunoprecipitation kit (Active Motif). The extract was divided equally in half. Half of the extract was immunoprecipitated with a mouse monoclonal anti-PIAS1 antibody (Invitrogen), and the other half was immunoprecipitated with a mouse anti-HA antibody (Covance) as the control. This was followed by incubation with protein A-agarose beads (Upstate) in the presence of 5 mm NEM according to the manufacturer’s instructions. The precipitated proteins were detected by Western blotting with the rabbit anti-KLF5 and mouse anti-PIAS1. Immunofluorescence−COS-7 cells were transfected with vector alone, 3xFLAG-PIAS1, pMT3-KLF5-HA, or 3xFLAG-PIAS1 and pMT3-KLF5-HA. Twenty four hours following transfection, the cells were fixed with methanol and stained with mouse anti-FLAG and rabbit anti-HA antibodies (Sigma) followed by fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse and rhodamine red-X (RRX)-conjugated goat anti-rabbit secondary antibodies (Jackson ImmunoResearch). The cells were then stained with Hoechst 33258 dye to visualize the nuclei. For bromodeoxyuridine (BrdUrd) incorporation, the transfected cells were pulse-labeled with 100 μm BrdUrd for 30 min. After fixation in methanol, the cells were treated with 2 n HCl at room temperature for 30 min to denature the DNA, neutralized with 0.1 m sodium borate, pH 8.5, washed with phosphate-buffered saline, and blocked with 2% bovine serum albumin in phosphate-buffered saline for 1 h. The cells were stained sequentially with the following combination of antibodies: mouse anti-BrdUrd followed by a Cy5-conjugated goat anti-mouse secondary antibody (Jackson ImmunoResearch), rabbit anti-HA (Sigma) followed by the RRX-conjugated goat anti-rabbit secondary antibody, and FITC-conjugated chicken anti-FLAG (Immunology Consultants Laboratory). The cells were then stained with Hoechst dye to reveal the nuclei. Images were captured with an Axioskop 2 plus microscope (Zeiss). To demonstrate co-localization of KLF5 and PIAS1 with TBP, the HA-KLF5 and/or FLAG-PIAS1-transfected cells were stained with mouse anti-FLAG, chicken anti-HA (Chemicon), and rabbit anti-TBP (Santa Cruz Biotechnology), followed by FITC-conjugated donkey anti-mouse, Rhodamine Red-X (RRX)-conjugated donkey anti-chicken, and aminomethylcoumarin-conjugated donkey anti-rabbit secondary antibodies (Jackson ImmunoResearch). As a control, the vector alone-transfected cells were stained with the same primary and secondary antibodies except anti-TBP. To demonstrate co-localization of KLF5 and PIAS1 with pol II, the HA-KLF5- and/or FLAG-PIAS1-transfected cells were stained with mouse anti-FLAG, chicken anti-HA (Chemicon), and a rabbit antibody raised against the large subunit of RNA polymerase II (Santa Cruz Biotechnology), followed by FITC-conjugated donkey anti-mouse, Rhodamine Red-X (RRX)-conjugated donkey anti-chicken, and Cy5-conjugated donkey anti-rabbit secondary antibodies (Jackson ImmunoResearch). The vector alone-transfected cells were stained with the same primary and secondary antibodies except anti-pol II. The cells were also stained with Hoechst dye to reveal the nuclei. Luciferase Assays−COS-7 cells were transfected with equal amounts of vector alone, pMT3-KLF5, 3xFLAG-PIAS1, or pMT3-KLF5 and 3xFLAG-PIAS1, together with the KLF5, PIAS1, PDGF-A, cyclin D1, or Cdc2-luciferase reporter. A Renilla luciferase control vector was co-transfected to normalize the transfection efficiency. Cell lysis and reporter assay were performed 2 days after the transfection with dual-luciferase reporter assay system (Promega) according to the manufacturer’s instructions. Chromatin Immunoprecipitation (ChIP) Assays−To examine the binding of KLF5 and PIAS1 to target promoters, COS-7 cells were transfected as described in the luciferase assays, except that pMT3-KLF5 was replaced with pMT3-KLF5-HA whenever necessary to efficiently pull down KLF5. The HA tag does not affect KLF5 activity. ChIP assays were performed with DNA purified from the corresponding cells, using chromatin immunoprecipitation assay kit (Upstate) according to the manufacturer’s instructions. Immunoprecipitation was conducted using mouse anti-FLAG or rabbit anti-HA, KLF5, or FLAG antibody (Sigma), whereas mouse anti-His (Santa Cruz Biotechnology) or normal rabbit serum (IgG) was used as the negative control. Nested PCR was performed after each immunoprecipitation. For the KLF5 promoter, the first-round PCR primers were GGAGAGATCTCCCTCCGCGTC and AGCGATCGCGATCCCACCTCGC. The second-round (nested) primers were GGAGAGATCTCCCTCCGCGTC and CGTCACCGCCGAGGTCCTC. For the PIAS1 promoter, the first-round primers were CGAGGGGGTAGTAACTGTCAAAC and TTGCGTCTGTCAGCGCAAGCG. The nested primers were CCGCTTGGCGCCATTAT and GTCCGCAAGCTTGCGTCTGTCAGCGCAAGCGC. For the PDGF-A promoter, the first-round primers were GGGGCTTTGATGGATTTAGCTGC and AGAGGGTTATAGCGCCGCC. The nested primers were ATTTAGCTGCTTGCGCG and AGAGGGTTATAGCGCCGCC. For the cyclin D1 promoter, the first-round primers were AGGAAATGCTGGCCACCATCTTG and GGTTTTCATAGAAATGCAAATCGC. The nested primers were CTGCTGGAATTTTCGGG and CGGCAGGCCACACGC. For the Cdc2 promoter, the first-round primers were TGAGGTAGAAACAAAGCACAGCG and AGAGCCAGCTTTGAAGCCAAGTG. The nested primers were ACATTTTTGAGGCGGTC and AGCCAAGTGCGAGCAG. A small fraction of each lysate prior to the immunoprecipitation was also amplified with nested PCR or with a GAPDH PCR mixture kit (Active Motif) as the positive and negative controls for input. Identification of Proteins That Interact with KLF5−To identify proteins interacting with KLF5, we screened a mouse 17-day embryonic cDNA library under high stringency with a KLF5-GAL4 DNA-binding domain fusion construct as the bait. We chose the embryonic library because KLF5 is highly expressed during this stage of development (8.Ohnishi S. Laub F. Matsumoto N. Asaka M. Ramirez F. Yoshida T. Terada M. Dev. Dyn. 2000; 217: 421-429Crossref PubMed Scopus (76) Google Scholar). After screening 106 independent clones with the bait, 30 positive clones that represented 21 genes were identified (Table 1). These preys can be divided into four groups. The largest group of the preys is involved or is predicted to be involved in the regulation of gene expression and contains ANKRD17, DnaJ homolog subfamily C member 4, HNRPF, PIAS1, PRIM2, RPS2, REC14, and SFRS15. The second group contains three known and one predicted metabolic enzymes, DCK, FXNa, PCCA, and PMM2, which catalyze nucleic acid, amino acid, lipid, and carbohydrate metabolism. The third group contains PI3KR1/p85α, the major regulatory subunit of phosphatidylinositol 3-kinase (PI 3-kinase). Strikingly, four proteins directly involved in intracellular trafficking, ARFGAP3, α-taxilin, SNAP23, and SNX3, were also isolated from the screen, and they make up the fourth group. Many of the preys are known nuclear proteins (Table 1).TABLE 1Proteins identified in the yeast two-hybrid screen that interacted with KLF5 The symbols used are as follows: ++, the prey is primarily localized to the nucleus; +, the prey has been reported to be localized to the nucleus although the nucleus is not the primary location; (–), the prey is localized in the cytoplasm but in a perinuclear location.Gene NameGene ontologyNuclearPIAS1Transcriptional co-regulator and SUMO E3 ligase++HNRPFPre-mRNA splicing factor that interacts with TBP and RNA polymerase II++PRIM2 (DNA primase 2)Primase essential to DNA replication++REC14 (recombination protein REC14)aPreys that were represented by more than one clonesTranscriptional regulation++SFRS15aPreys that were represented by more than one clonesPre-mRNA splicing factor that interacts with RNA polymerase II carboxyl-terminal domain++RPS2 (ribosomal protein S2)Ribosomal subunit+DNAJC4 (DnaJ homolog subfamily C member 4)Putative chaperone activityNDbND indicates not determinedANKRD17Marker for liver developmentNDDCKNucleic acid metabolism+FXNaaPreys that were represented by more than one clonesPutative amino peptidaseNDPCCAAmino acid and fatty acid metabolism+PMM2GDP-mannose and dolichol-phosphate-mannose synthesis(–)PI3KR1/p85α (phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1)PI 3-kinase signal pathways+α-TaxilinIntracellular vesicle transport+ARFGAP3Vesicle budding(–)SNAP23aPreys that were represented by more than one clonesMembrane fusion; vesicle targeting+SNX3Intracellular trafficking(–)KIAA1033UnknownNDLOC 380885UnknownNDRIKEN cDNA F830013N24UnknownNDRP23-418O21aPreys that were represented by more than one clonesUnknownNDa Preys that were represented by more than one clo