Alternative Splicing of Vitamin D-24-Hydroxylase
2005; Elsevier BV; Volume: 280; Issue: 21 Linguagem: Inglês
10.1074/jbc.m414522200
ISSN1083-351X
AutoresSongyang Ren, Lisa Nguyen, Shaoxing Wu, Carlos Encinas, John S. Adams, Martin Hewison,
Tópico(s)Vitamin K Research Studies
ResumoSynthesis of the active form of vitamin D, 1,25-dihydroxyvitamin D (1,25-(OH)2D), by renal epithelial cells is tightly controlled during normal calcium homeostasis. By contrast, macrophage production of 1,25-(OH)2D is often dysregulated with potential hypercalcemic complications. We have postulated that this is due to abnormal catabolism of 1,25-(OH)2D by the feedback control enzyme, vitamin D-24-hydroxylase (CYP24). Using chick HD-11 and human THP-1 myelomonocytic cell lines, we have shown that macrophage-like cells express a splice variant of the CYP24 gene (CYP24-SV), which encodes a truncated protein. Compared with the holo-CYP24 gene product in chick and human cells (508 and 513 amino acids, respectively), the truncated CYP24-SV versions consisted of 351 and 372 amino acids. These CYP24-SV proteins retained intact substrate-binding domains but lacked mitochondrial targeting sequences and were therefore catalytically inactive. In common with CYP24, expression of the CYP24 variants was induced by 1,25-(OH)2D but without a concomitant rise in 24-hydroxylase activity. However, overexpression of CYP24-SV in HD-11 and THP-1 cells reduced synthesis of 1,25-(OH)2 D (40–50%), whereas antisense CYP24-SV expression increased 1,25-(OH)2D production by 2–7-fold. These data suggest that alternative splicing of CYP24 leads to the generation of a dominant negative-acting protein that is catalytically dysfunctional. We theorize that expression of the CYP24-SV may contribute to the extracellular accumulation of 1,25(OH)2D in human health and disease. Synthesis of the active form of vitamin D, 1,25-dihydroxyvitamin D (1,25-(OH)2D), by renal epithelial cells is tightly controlled during normal calcium homeostasis. By contrast, macrophage production of 1,25-(OH)2D is often dysregulated with potential hypercalcemic complications. We have postulated that this is due to abnormal catabolism of 1,25-(OH)2D by the feedback control enzyme, vitamin D-24-hydroxylase (CYP24). Using chick HD-11 and human THP-1 myelomonocytic cell lines, we have shown that macrophage-like cells express a splice variant of the CYP24 gene (CYP24-SV), which encodes a truncated protein. Compared with the holo-CYP24 gene product in chick and human cells (508 and 513 amino acids, respectively), the truncated CYP24-SV versions consisted of 351 and 372 amino acids. These CYP24-SV proteins retained intact substrate-binding domains but lacked mitochondrial targeting sequences and were therefore catalytically inactive. In common with CYP24, expression of the CYP24 variants was induced by 1,25-(OH)2D but without a concomitant rise in 24-hydroxylase activity. However, overexpression of CYP24-SV in HD-11 and THP-1 cells reduced synthesis of 1,25-(OH)2 D (40–50%), whereas antisense CYP24-SV expression increased 1,25-(OH)2D production by 2–7-fold. These data suggest that alternative splicing of CYP24 leads to the generation of a dominant negative-acting protein that is catalytically dysfunctional. We theorize that expression of the CYP24-SV may contribute to the extracellular accumulation of 1,25(OH)2D in human health and disease. Synthesis of the secosteroid 1,25-dihydroxyvitamin D3 (1,25-(OH)2D) 1The abbreviations used are: 1,25-(OH)2 D, 1,25-dihydroxyvitamin D; 25-OHD, 25-hydroxyvitamin D3; 1α-OHase, 25-(OH)d-1α-hydroxylase; 24-OHase, 24-hydroxylase; DMEM, Dulbecco's modified Eagle's medium; FBS, fetal bovine serum; TPA, 12-O-tetradecanoylphorbol-13-acetate; RT, reverse transcription; RACE, rapid amplification of cDNA ends; ORF, open reading frame. from its precursor 25-hydroxyvitamin D3 (25-OHD) is catalyzed by the enzyme 25-(OH)d-1α-hydroxylase (1α-OHase; encoded by the CYP27B1 gene), a mitochondrial cytochrome P450 enzyme which resides mainly in renal proximal tubule cells (1Bland R. Zehnder D. Hewison M. Curr. Opin. Nephrol. Hypertens. 2000; 9: 17-22Crossref PubMed Scopus (37) Google Scholar, 2Zehnder D. Hewison M. Mol. Cell. Endocrinol. 1999; 151: 213-220Crossref PubMed Scopus (44) Google Scholar). Both 1,25-(OH)2D and its precursor 25-OHD can also be metabolized by a related mitochondrial P450 enzyme vitamin D-24-hydroxylase (24-OHase; encoded by the CYP24 gene), which catalyzes synthesis of 1,24,25-trihydroxyvitamin D and 24,25-dihydroxyvitamin D (3Ohyama Y. Yamasaki T. Front. Biosci. 2004; 9: 3007-3018Crossref PubMed Scopus (72) Google Scholar, 4Omdahl J.L. Morris H.A. May B.K. Annu. Rev. Nutr. 2002; 22: 139-166Crossref PubMed Scopus (264) Google Scholar, 5Henry H.L. Steroids. 2001; 66: 391-398Crossref PubMed Scopus (49) Google Scholar). Consistent with its role as a negative feedback enzyme, expression of 24-OHase is sensitively induced by 1,25-(OH)2D itself through binding of liganded vitamin D receptor and its heterodimeric partner, the retinoid X receptor to vitamin D-responsive elements in the promoter region of CYP24 (6Kerry D.M. Dwivedi P.P. Hahn C.N. Morris H.A. Omdahl J.L. May B.K. J. Biol. Chem. 1996; 271: 29715-29721Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar, 7Ohyama Y. Ozono K. Uchida M. Yoshimura M. Shinki T. Suda T. Yamamoto O. J. Biol. Chem. 1996; 271: 30381-30385Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). Thus, the 24-OHase plays an important role in attenuating the potentially detrimental hypercalcemic side effects of vitamin D by catalyzing the catabolism of active 1,25-(OH)2D to less active downstream metabolites and by competing with 1α-OHase for their common substrate, 25-OHD (8Reddy G.S. Tserng K.Y. Biochemistry. 1989; 28: 1763-1769Crossref PubMed Scopus (217) Google Scholar, 9Makin G. Lohnes D. Byford V. Ray R. Jones G. Biochem. J. 1989; 262: 173-180Crossref PubMed Scopus (218) Google Scholar). Although proximal tubule epithelial cells are the major source of 1,25(OH)2D detectable in the circulation, it is now clear that 1α-OHase is expressed by many extrarenal tissues, including the skin, macrophages, placenta, colon, brain, prostate, and endothelium (10Zehnder D. Evans K.N. Kilby M.D. Bulmer J.N. Innes B.A. Stewart P.M. Hewison M. Am. J. Pathol. 2002; 161: 105-114Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 11Zehnder D. Bland R. Chana R.S. Wheeler D.C. Howie A.J. Williams M.C. Stewart P.M. Hewison M. J. Am. Soc. Nephrol. 2002; 13: 621-629Crossref PubMed Google Scholar, 12Zehnder D. Bland R. Williams M.C. McNinch R.W. Howie A.J. Stewart P.M. Hewison M. J. Clin. Endocrinol. Metab. 2001; 86: 888-894Crossref PubMed Scopus (845) Google Scholar, 13Miller W.L. Portale A.A. Trends Endocrinol. Metab. 2000; 11: 315-319Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 14Chen T.C. Wang L. Whitlatch L.W. Flanagan J.N. Holick M.F. J. Cell. Biochem. 2003; 88: 315-322Crossref PubMed Scopus (119) Google Scholar). At these sites, 1α-OHase has been postulated to act in an autocrine or paracrine fashion by increasing local concentrations of 1,25-(OH)2D in a tissue-specific manner. Whereas kidney-synthesized 1,25-(OH)2D functions to systemically regulate serum calcium and phosphorous levels for bone homeostasis (2Zehnder D. Hewison M. Mol. Cell. Endocrinol. 1999; 151: 213-220Crossref PubMed Scopus (44) Google Scholar), extrarenal production of 1,25-(OH)2D appears to play an important role in cell differentiation, proliferation (16Lou Y.R. Laaksi I. Syvala H. Blauer M. Tammela T.L. Ylikomi T. Tuohimaa P. FASEB J. 2004; 18: 332-334Crossref PubMed Scopus (83) Google Scholar), and immune responsiveness (17Panda D.K. Miao D. Tremblay M.L. Sirois J. Farookhi R. Hendy G.N. Goltzman D. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 7498-7503Crossref PubMed Scopus (545) Google Scholar). Synthesis of 1,25-(OH)2D in peripheral tissues is catalyzed by the same 1α-OHase gene product that is present in the kidney (18Fu G.K. Lin D. Zhang M.Y. Bikle D.D. Shackleton C.H. Miller W.L. Portale A.A. Mol. Endocrinol. 1997; 11: 1961-1970Crossref PubMed Google Scholar, 19Smith S.J. Rucka A.K. Berry J.L. Davies M. Mylchreest S. Paterson C.R. Heath D.A. Tassabehji M. Read A.P. Mee A.P. Mawer E.B. J. Bone Miner. Res. 1999; 14: 730-739Crossref PubMed Scopus (76) Google Scholar), but the manner by which expression and activity of the enzyme are regulated is distinct. From an endocrine standpoint, 1,25-(OH)2D tightly controls its own synthesis by 1) inhibition of parathyroid hormone gene expression, 2) induction of 24-OHase catabolic function (6Kerry D.M. Dwivedi P.P. Hahn C.N. Morris H.A. Omdahl J.L. May B.K. J. Biol. Chem. 1996; 271: 29715-29721Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar, 7Ohyama Y. Ozono K. Uchida M. Yoshimura M. Shinki T. Suda T. Yamamoto O. J. Biol. Chem. 1996; 271: 30381-30385Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 8Reddy G.S. Tserng K.Y. Biochemistry. 1989; 28: 1763-1769Crossref PubMed Scopus (217) Google Scholar, 9Makin G. Lohnes D. Byford V. Ray R. Jones G. Biochem. J. 1989; 262: 173-180Crossref PubMed Scopus (218) Google Scholar), and 3) direct, negative regulation of CYP27B1 transcription (20Kong X.F. Zhu X.H. Pei Y.L. Jackson D.M. Holick M.F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6988-9693Crossref PubMed Scopus (110) Google Scholar). By contrast, the abundant extrarenal production of 1,25-(OH)2D by cells such as activated macrophages is characterized by 1) unresponsiveness to stimulation by parathyroid hormone (21Adams J.S. Ren S.Y. Arbelle J.E. Horiuchi N. Gray R.W. Clemens T.L. Shany S. Endocrinology. 1994; 134: 2567-2573Crossref PubMed Scopus (22) Google Scholar); 2) lack of feedback inhibition of 1α-OHase by 1,25-(OH)2D itself (22Adams J.S. Gacad M.A. J. Exp. Med. 1985; 161: 755-765Crossref PubMed Scopus (271) Google Scholar, 23Reichel H. Koeffler H.P. Barbers R. Norman A.W. J. Clin. Endocrinol. Metab. 1987; 65: 1201-1209Crossref PubMed Scopus (167) Google Scholar); 3) relatively low levels of 1,25-(OH)2d-directed catabolic 24-hydroxylase activity (22Adams J.S. Gacad M.A. J. Exp. Med. 1985; 161: 755-765Crossref PubMed Scopus (271) Google Scholar, 24Dusso A.S. Kamimura S. Gallieni M. Zhong M. Negrea L. Shapiro S. Slatopolsky E. J. Clin. Endocrinol. Metab. 1997; 82: 2222-2232Crossref PubMed Scopus (120) Google Scholar). The latter mechanism appears to be particularly important in macrophages, because CYP24 gene expression is readily stimulated by 1,25-(OH)2Din these cells without any apparent induction of catabolic 24-OHase enzyme activity (25Monkawa T. Yoshida T. Hayashi M. Saruta T. Kidney Int. 2000; 58: 559-568Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). To clarify this, we have characterized a novel mechanism for the regulation of 1,25-(OH)2D production in macrophages, which involves alternative splicing of the CYP24 gene and expression of a catalytically inactive, amino-terminally truncated 24-OHase protein. As such, regulated expression of the CYP24 splice variant (CYP24-SV) can rheostatitically control the production of 1,25-(OH)2D in macrophages. Cell Culture—HD-11 cells were generously provided by Dr. T. Graf (EMBO, Heidleberg, Germany) and grown in monolayers in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 15% fetal bovine serum (FBS; Omega, Tarzana, CA), 4 mm l-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin (Invitrogen) at 37 °C in a humidified atmosphere of 5% CO2 and 95% air. Human monocytic THP-1 cells (catalog no. TIB-202; American Type Culture Collection, Manassas, VA) were grown in suspension in RPMI 1640 medium with 2 mm l-glutamine, 10 mm HEPES, 1 mm sodium pyruvate, 4.5 g/liter glucose, and 1.5 g/liter bicarbonate, supplemented with 10% fetal bovine serum (v/v) and 0.05 mm 2-mercaptoethanol. Differentiated THP-1 cells (dTHP-1) with macrophage characteristics were produced by treating THP-1 cells with 160 nm 12-O-tetradecanoylphorbol-13-acetate (TPA; Sigma) in regular culture medium for 24 h. After 24-h treatment, the cells were 80–90% adherent, and the medium containing TPA was replaced with normal culture medium for cell maintenance until experimental reagents were added. In addition to the HD-11 and THP-1 cells, other human cells were used for RT-PCR analysis of CYP24 expression. These included HKC-8 proximal tubules cells (26Bland R. Walker E.A. Hughes S.V. Stewart P.M. Hewison M. Endocrinology. 1999; 140: 2027-2034Crossref PubMed Scopus (128) Google Scholar) and peripheral blood-derived macrophages (27Hewison M. Freeman L. Hughes S.V. Evans K.N. Bland R. Eliopoulos A.G. Kilby M.D. Moss P.A. Chakraverty R. J. Immunol. 2003; 170: 5382-5390Crossref PubMed Scopus (394) Google Scholar). Human skin epidermal keratinocytes (catalog no. C-001-5C; Cascade Biologics, Inc., Portland, OR) were grown in Medium 154 (catalog no. M-154-500; Cascade Biologics) supplemented with human keratinocyte growth supplement (catalog no. M-154-500; Cascade Biologics). Human Tissue—Placenta was obtained from a third trimester term pregnancy with patient consent and ethical approval (South Birmingham Ethics Committee, Birmingham, UK). Total RNA from human heart and brain were purchased from Clontech (Palo Alto, CA). RT-PCR Analysis of CYP24 Transcripts in Chick HD-11 Macrophages—Total RNA was extracted from cultured HD-11 cells, preincubated with 200 nm 1,25-(OH)2D (BIOMOL, Plymouth Meeting, PA), for 24 h using the TRIzol Reagent (Total RNA Isolation Reagent; Invitrogen). Reverse transcription of mRNA was performed by PowerScript Reverse Transcriptase (Clontech) and tailed primer oligo(dT) (16Lou Y.R. Laaksi I. Syvala H. Blauer M. Tammela T.L. Ylikomi T. Tuohimaa P. FASEB J. 2004; 18: 332-334Crossref PubMed Scopus (83) Google Scholar) to produce cDNA for PCR templates. Multiple sets of PCR primers were synthesized according to the published chick kidney 24-OHase cDNA sequence (CYP24; GenBank™ accession number AF019142), among which the following series of nested PCR primer pairs yielded a predominant PCR product of ∼1.4 kb: 1) forward primer 5′-GCCCTACCTAAAAGCATGTCTGAAGG (1104–1129) and reverse primer 5′-TCTGTCATGCACAGTCCTTCTGCTGC (1819–1794); 2) forward primer 5′-GGAAGGAAAGGACTGGCAGAGG (432–453) and reverse primer 5′-CTCTGCTAAGCGACGGCCAATGC (1389–1367). PCR was carried out using the Advantage cDNA PCR kit (Clontech) applying the following parameters: 94 °C for 3 min followed by 30 cycles of denaturation at 94 °C for 12 s and annealing/extension at 68 °C for 3 min with a final extension of 3 min at 68 °C. The PCR products were separated by electrophoresis on a 1.2% agarose (Invitrogen) gel with a 1-kb Plus DNA Ladder (Invitrogen) as a size marker and visualized by ethidium bromide staining. The predicted size-matched bands on the gel were purified by a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and cloned into the PCR4-TOPO plasmid vector and TOP10 competent Escherichia coli cells using the TOPO TA Cloning Kit (Invitrogen). The selected, subcloned E. coli cells were cultured and subjected to the plasmid extraction by the PlasmidPURE DNA Mini-Prep kit (Sigma). From purified plasmids, the PCR products of interest were then sequenced by an automatic sequencing machine (ABI PRISM 377 DNA Sequencer, Applied Biosystems, Foster City, CA). Isolation of Full-length cDNAs for the CYP24 Variants—To obtain a full-length cDNA for the CYP24 splice variants isolated from HD-11 cells, 5′- and 3′-RACE procedures were performed using the GeneRacer kit (Invitrogen). Poly(A) RNA was extracted from cultured HD-11 cells preincubated with 200 nm 1,25-(OH)2D for 24 h using the Oligotex Direct mRNA Purification Kit (Qiagen). Random and oligo(dT) (16Lou Y.R. Laaksi I. Syvala H. Blauer M. Tammela T.L. Ylikomi T. Tuohimaa P. FASEB J. 2004; 18: 332-334Crossref PubMed Scopus (83) Google Scholar) primers were used for reverse transcription to produce cDNA templates for 5′- and 3′-RACE, respectively. Two pairs of the nested PCR primers were synthesized for 5′- and 3′-RACE separately, according to the cDNA sequences available from RT-PCR results above: reverse primer A 5′-CTCTGCTAAGCGACGGCCAATGC (CYP24 cDNA 1389–1367) and reverse primer B 5′-CCAGTTTCACCACCTCCTTGGGTTTCATCAG (508–478) for 5′-RACE; forward primer A 5′-GAGAAACTGCAACGCGCGTCACTCA (1611–1635) and forward primer B 5′-CCCCTGGTTGGAATTCCCTTATTGG (1672–1696) for 3′-RACE. Because of the GC-rich region at the 5′-end of the template, Me2SO (5%; Sigma) was added in the PCR mixture for 5′-RACE reactions. The RACE products were sequenced as described above. PCR and GenomeWalker Analysis of CYP24 Genomic DNA Sequences—To acquire further sequence information for the chick CYP24 gene, genomic DNA was extracted from cultured HD-11 cells by QIAmp Blood Kit (Qiagen). PCR primers were derived from the cDNA sequences determined from RT-PCR and RACE results described above: forward primer, 5′-AGATGCCTCCCTGCACGTGTCGTA (CYP24-SV cDNA 125–148); reverse primer, 5′-CCACAGGTGTCACCATCATCATTCC (CYP24-SV cDNA 516–492). PCR was carried out using the Advantage-GC Genomic PCR Kit (Clontech) with a 1 m GC-Melt concentration and the same cycle parameters described for the RT-PCRs. The 5′-flanking genomic DNA sequence of the chick CYP24 gene was obtained from HD-11 cell genomic DNA using the Universal GenomeWalker Kit (Clontech) and the Advantage-GC Genomic PCR Kit (Clontech) according to the manufacturer's protocols. The nested antisense primers arising from the 5′-end of CYP24-SV cDNA were reverse primer "A" 5′-CCAGTTTCACCACCTCCTTGGGTTTCATCAG (CYP24-SV cDNA 270–240) and reverse primer "B" 5′-CTCTGCCAGTCCTTTCCTTCCCTAGGCGTAA (214–184). The products of PCR and GenomeWalker were cloned and sequenced as described above. Cloning and Sequencing of a Human Form of CYP24-SV—Total RNA was extracted from TPA-differentiated THP-1 cells (dTHP-1) in the presence or absence of 200 nm 1,25-(OH)2D (BIOMOL, Plymouth Meeting, PA) for 24 h using the TRIzol Reagent (Total RNA Isolation Reagent; Invitrogen). Reverse transcription of mRNA was performed by PowerScript Reverse Transcriptase (Clontech) and tailed primer oligo(dT) (16Lou Y.R. Laaksi I. Syvala H. Blauer M. Tammela T.L. Ylikomi T. Tuohimaa P. FASEB J. 2004; 18: 332-334Crossref PubMed Scopus (83) Google Scholar) to produce cDNA for PCR templates. Multiple sets of PCR primers were synthesized according to the published human 24-OHase cDNA (GenBank™ number L13268) and genomic DNA (GenBank™ number AL138805), among which the following series of bridged PCR primer pairs yielded a predominant PCR product of ∼1.4 kb: 1) forward primer (5′-GCTC TAAATGTATTCCTGCTTCTCTCAC) (AL138805 73837–73864, in intron II) and reverse primer (5′-GCTCTAAATGTATTCCTGCTTCTCTCAC) (L13268 1231–1256, in exons IV and IIV) for the first PCR reaction; 2) forward primer (5′-GGACACCTCAAAATCCCTGAACCCAA) (AL138805: 74092–74117, in intron II) and reverse primer (5′-GCTCTAAATGTATTCCTGCTTCTCTCAC) (L13268: 1231–1256, in exons IV and IIV) for the second PCR; and 3) forward primer (5′-GCTCTAAATGTATTCCTGCTTCTCTCAC) (AL138805 73837–73864, in intron II) and reverse primer (5′-ACTCAGTCCGCTTCCCTGAGTTGGA) (L13268 1994–1970, in exon XII) for the third PCR. PCR conditions and subsequent procedures for PCR products such as purification, cloning, subcloning, and sequencing were the same as those described for cloning of the chick CYP24-SV. RT-PCR Analysis of CYP24-SV mRNA Expression—Expression of mRNA for the alternatively spliced CYP24 gene was evaluated by RT-PCR and Northern blot analyses. Reverse transcription was performed by random primer and PowerScript reverse transcriptase (Clontech). Three pairs of PCR primers were designed according to the unique cDNA sequence of 1) chick CYP24-SV (forward primer, 5′-AGATGCCTCCCTGCACGTGTCGTA (cDNA 125–148); reverse primer, 5′-TGCTGCAGGAGACCAAACCTCTTTC (430–406), spanning 306 bp or with reverse primer 5′-CCTTCAGACATGCTTTTAGGTAGGGCA (891–866), spanning 766 bp); 2) chick kidney CYP24 (forward primer, 5′-ATGGGAGGCTGCAGCATCCTTCTC (cDNA 13–36); reverse primer, 5′-TGCTGCAGGAGACCAAACCTCTTTC (668–644), spanning 655 bp); and 3) chick β-actin (forward primer, 5′-ACCACAGCCGAGAGAGAAAT (cDNA 672–691); reverse primer, 5′-GACAGGGAGGCCAGGATAGA (1117–1098), spanning 445 bp). PCR was performed by Advantage-GC cDNA PCR Kit (Clontech) with a final GC-Melt concentration of 1 m and the same PCR parameters as above, with the β-actin primers as a control for each PCR. The PCR products were separated by electrophoresis on a 1.2% agarose gel with a 1-kb Plus DNA Ladder. PCR primers for the human CYP24-SV were designed according to the unique cDNA sequence of 1) hCYP24 (forward primer, 5′-GAGACTGGTGACATCTACGGCGTACA (L13268 468–493, in exon I) and reverse primer 5′-CCATAAAATCGGCCAAGACCTCATTG (L13268 952–927, in exons III and IV), spanning 484 bp); 2) hCYP24-SV (forward primer, 5′-GGACACCTCAAAATCCCTGAACCCAA (AL138805 74092–74117, in intron II); reverse primer, 5′-CCATAAAATCGGCCAAGACCTCATTG (L13268 952–927, in exon III and IV), spanning 396 bp); and 3) human β-actin (forward primer, 5′-AGAGAGGCATCCTCACCCTG (GenBank™ number NM_001101 221–238); reverse primer, 5′-TCACCGGAGTCCATCACGAT (NM_001101 543–524), spanning 288 bp). PCR conditions and electrophoresis procedures were the same as those described for chick CYP24-SV. Northern Blot Analysis—Total RNA was extracted from HD-11 cells using the same conditions and methods as described above under "RT-PCR Analysis of mRNA." Aliquots (50 μg) of total RNA were loaded in each lane and separated by electrophoresis using a 1% agarose (Invitrogen), 2.2 m formaldehyde (J. T. Baker, Phillipsburg, NJ) gels containing ethidium bromide. The resolved RNA was transferred onto nylon membranes (Millipore Corp., Bedford, MA) in 10× SSC buffer (0.3 m NaCl, 0.03 M sodium citrate, pH 7) for 16 h. The transferred filters were prehybridized with QuikHyb Hybridization Solution (Stratagene, La Jolla, CA) at 68 °C for 1 h and then hybridized in the same solution at 68 °C for 12 h to a random primed 32P-labeled 715-bp probe (wild type CYP24 cDNA 1104–1819) sharing the same cDNA sequences between the chick CYP24 and its splice variant. The filters were then washed in 0.1× SSC, 0.1% SDS at 55 °C for 30 min and exposed to x-ray film at –70 °C overnight. Preparation of Polyclonal Antiserum against Chick CYP24 and CYP24-SV—A custom chick CYP24-SV peptide N′-GKRFGLLQQDVEEES (CYP24-SV amino acids 55–69) sharing the same sequence with that of CYP24 and the custom rabbit polyclonal antiserum against this peptide were prepared and tested with high pressure liquid chromatography and enzyme-linked immunosorbent assay by Sigma-Genosys (Woodlands, TX). The antiserum titer determined by enzyme-linked immunosorbent assay for the peptide-specific antibody was >1:500,000. Western Blot Analysis—HD-11 cells were preincubated with vehicle or 1,25-(OH)2D (200 nm) for 24 h before extracting whole cell or mitochondrial protein. The mitochondrial extraction procedure was the same as previously described (28Shany S. Ren S. Arbelle J.E. Clemens T.L. Adams J.S. J. Bone Miner. Res. 1993; 82: 69-76Google Scholar). The extracted mitochondrial pellets and the whole cultured cells were washed with PBS at room temperature, and the protein extracts were then prepared by lysis of mitochondria and cells on ice with radioimmune precipitation buffer (PBS, 0.5% sodium deosycholate, 0.2% Triton X-100, 0.1% SDS, 1 mm phenylmethylsulfonyl fluoride), passing through the 21-gauge needle to shear DNA and other cellular components, and centrifugation at 10,000 × g for 10 min at 4 °C. A Micro-BCA protein assay reagent kit (Pierce) was used to determine protein concentration. 30 μg of protein from each group was loaded for each lane on the 10% Tris-HCl Precast Gel and separated by the SDS-PAGE system following the protocol recommended by the supplier (Bio-Rad). Proteins were electrophoretically transferred onto a polyvinylidene difluoride membrane (Amersham Biosciences), probed with the rabbit polyclonal antiserum for the chick CYP24-SV (1:500 diluted), and visualized by Western Light detection system (Tropix, Bedford, MA) according to the manufacturer's instructions. For protein loading and mitochondrial expression positive control, the goat polyclonal IgG against GRP75 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) (1:500 diluted) was also used to probe the Western blot following the same procedure described above. The blots with the same protein loading but probed by the anti-cCYP24-SV and anti-GRP75 were compared. Transfection of CYP24 and CYP24-SV Expression Constructs—Three cDNA expression constructs were prepared for transfection studies by RT-PCR using the primer pairs synthesized according to the sequences of chick CYP24 and its splice variant (CYP24-SV), each containing restriction enzyme excision sites. The sequences for these primer pairs were as follows (the underlines indicate the restriction enzyme excision sites): 1) antisense CYP24-SV construct (located at the 5′-end of CYP24-SV cDNA) (forward primer, 5′-TTTCTCTAGAGATGCTGCGGACT (CYP24-SV cDNA 42–52); reverse primer, 5′-AGGTCTCGAGGCGTAAATAAAAGCAG (189–174); 2) sense CYP24-SV construct (containing full-length open reading frame (ORF) of CYP24-SV) (forward primer, 5′-AGCTCGAGATGAAACCCAAGGAGGTGGTGACAAGGAGGTGGTGA (CYP24-SV cDNA 243–264); reverse primer, 5′-CCCTCTAGAGGCCGTCATTAGTCAAGCTGCA (1306–1285)); 3) antisense CYP24 construct (located at the 5′-end of CYP24 cDNA) (forward primer, 5′-GGTCTAGATATGGGAGGCTGCAGCATCCTTC (CYP24 cDNA 12–34); reverse primer, 5′-GTCTCGAGAGTCCCGATAGGCTTTCCA (400–382)). The resulting PCR products were digested with XbaI and XhoI restriction enzyme sites, run on agarose gels, appropriate bands were excised, and the resulting cDNAs were subcloned into a eukaryotic expression vector, pcDNA3.1 (Invitrogen). After cloning and sequence analysis, expression constructs containing the sense and antisense cDNAs for CYP24 and CYP24-SV were transiently transfected into HD-11 cells by lipofection (LipoTAXI; Stratagene, La Jolla, CA) following the manufacturer's protocol. Briefly, HD-11 cells were seeded in wells on 12-well plates 24 h prior to transfection and grown to 80% confluence. 0.5 μg of plasmid DNA and 15 μl of LipoTAXI reagent were added in culture wells with DMEM alone. 5 h later, an equal volume of DMEM containing 20% FBS was added to each well, and another 16 h later the medium above was replaced by normal culture medium. After a 24-h incubation in the normal culture medium, the transfected cells were ready for vitamin D metabolism assessment (see below). For stable tranfection, 5 μg of plasmid DNA and 70 μl of LipoTAXI reagent were added to HD-11 cells in each 60-mm tissue culture dish following the same transfection procedure above. After a 24-h incubation with normal culture medium, tranfected cells were cultured and maintained in DMEM containing 600 μg/ml G418 (Omega, Tarzana, CA). The medium was changed every 3 days. Four weeks after, G418-resistant clones were picked and grown for further experiments. Similar experiments were also carried out using sense and antisense expression constructs for hCYP24-SV. These constructs were produced using the following sets of primers: 1) antisense hCYP24-SV construct (located at the 5′-end of the CYP24-SV cDNA) (forward primer, 5′-AACCTCTAGAGACTAGGAGGAAAGG (hCYP24-SV 61–75, in intron II of hCYP24); reverse primer, 5′-CAAACTCGAGGTGAGAGAAGCAGGA (hCYP24-SV 281–267, in intron II of hCYP24); 2) sense hCYP24-SV construct (containing full-length ORF of hCYP24-SV) (forward primer, 5′-CCCCTCGAGCTCTAAATGTATTCCTGC (hCYP24-SV 255–272); reverse primer, 5′-CCCTCTAGAGCGTATTATCGCTGG (hCYP24-SV 1384–1368). Purification and subcloning procedures were as outlined for chick CYP24-SV. However, for hCYP24-SV, the transfection protocol for THP-1 cells was as follows; THP-1 cells in suspension were centrifuged and briefly washed with DMEM (Gibco), seeded in wells on 12-well plates (5 × 106 cells/well) prior to transfection. Aliquots (2 μg) of plasmid DNA and 10 μl of LipoTAXI reagent were added in culture wells with DMEM alone. 6 h later, an equal volume of completed RPMI 1640 medium containing 20% FBS was added to each well, and another 18 h later, a double volume of completed RPMI 1640 medium containing 10% FBS and 240 nm TPA was added, reaching the final concentration of 10% FBS and 160 nm TPA. After a 24-h exposure of TPA, the transiently transfected THP-1 cells were differentiated into macrophage-like dTHP-1 cells recognized because 90% of the cells were found to be adhesive, and were ready for vitamin D metabolism assessment (see below). Measurement of 1,25-Dihydroxyvitamin D (1,25-(OH)2D) Production—Cultures of HD-11 or dTHP-1 cells were grown in 12-well plates. After washing with FBS-free medium three times, cells were incubated with 200 nm 25-OHD (Sigma), solubilized in absolute ethanol (0.1% final concentration) in 1% FBS culture medium (1 ml/well) for 3 h. Incubation of whole cell preparations with substrate was terminated by the addition of 1 volume of acetonitrile (J. T. Baker Inc.). The conditioned medium and cell monolayers were harvested, vortexed, and centrifuged. Supernatant was transferred into a half-volume of 400 mm KH2PO4 (pH 10.5) for chromatography and 1,25-(OH)2D assay by the 1,25-(OH)2D 125I RIA kit (DiaSorin, Stillwater, MN), following the manufacturer's protocol. Cells were also collected without acetonitrile from a separate well for cell counting. Data were then reported as fmol of 1,25-(OH)2D produced/h/106 cells. Cloning and Sequence Analysis of a Splice Variant of the Vitamin D-24-hydroxylase (CYP24-SV) in the Chick Macrophage Cell Line HD-11—Using a series of primers based on the chicken 24-hydroxylase cDNA sequence, we cloned a novel 2.5-kb cDNA variant of CYP24 from chick macrophage HD-11 cells (GenBank™/EBI accession number AF428109). The variant cDNA was 200 bp shorter than the published sequence for chick CYP24; the last 2324 bp showed almost 100% sequence identity to the chick CYP24, whereas the first 193 bp showed less than 40% ident
Referência(s)