Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

High Intensity ERK Signal Mediates Hepatocyte Growth Factor-induced Proliferation Inhibition of the Human Hepatocellular Carcinoma Cell Line HepG2

2001; Elsevier BV; Volume: 276; Issue: 44 Linguagem: Inglês

10.1074/jbc.m010890200

ISSN

1083-351X

Autores

Yu-ichi Tsukada, Keiji Miyazawa, Naomi Kitamura,

Tópico(s)

Protein Kinase Regulation and GTPase Signaling

Resumo

Hepatocyte growth factor (HGF) induces growth stimulation of a variety of cell types, but it also induces growth inhibition of several types of tumor cell lines. The molecular mechanism of the HGF-induced growth inhibition of tumor cells remains obscure. We have investigated the intracellular signaling pathway involved in the antiproliferative effect of HGF on the human hepatocellular carcinoma cell line HepG2. HGF induced strong activation of ERK in HepG2 cells. Although the serum-dependent proliferation of HepG2 cells was inhibited by the MEK inhibitor PD98059 in a dose-dependent manner, 10 µmPD98059 reduced the HGF-induced strong activation of ERK to a weak activation; and as a result, the proliferation inhibited by HGF was completely restored. Above or below this specific concentration, the restoration was incomplete. Expression of constitutively activated Ha-Ras, which induces strong activation of ERK, led to the proliferation inhibition of HepG2 cells, as was observed in HGF-treated HepG2 cells. This inhibition was suppressed by the MEK inhibitor. Furthermore, HGF treatment and expression of constitutively activated Ha-Ras changed the hyperphosphorylated form of the retinoblastoma tumor suppressor gene product pRb to the hypophosphorylated form. This change was inhibited by the same concentration of MEK inhibitor needed to suppress the proliferation inhibition. These results suggest that ERK activity is required for both the stimulation and inhibition of proliferation of HepG2 cells; that the level of ERK activity determines the opposing proliferation responses; and that HGF-induced proliferation inhibition is caused by cell cycle arrest, which results from pRb being maintained in its active hypophosphorylated form via a high-intensity ERK signal in HepG2 cells. Hepatocyte growth factor (HGF) induces growth stimulation of a variety of cell types, but it also induces growth inhibition of several types of tumor cell lines. The molecular mechanism of the HGF-induced growth inhibition of tumor cells remains obscure. We have investigated the intracellular signaling pathway involved in the antiproliferative effect of HGF on the human hepatocellular carcinoma cell line HepG2. HGF induced strong activation of ERK in HepG2 cells. Although the serum-dependent proliferation of HepG2 cells was inhibited by the MEK inhibitor PD98059 in a dose-dependent manner, 10 µmPD98059 reduced the HGF-induced strong activation of ERK to a weak activation; and as a result, the proliferation inhibited by HGF was completely restored. Above or below this specific concentration, the restoration was incomplete. Expression of constitutively activated Ha-Ras, which induces strong activation of ERK, led to the proliferation inhibition of HepG2 cells, as was observed in HGF-treated HepG2 cells. This inhibition was suppressed by the MEK inhibitor. Furthermore, HGF treatment and expression of constitutively activated Ha-Ras changed the hyperphosphorylated form of the retinoblastoma tumor suppressor gene product pRb to the hypophosphorylated form. This change was inhibited by the same concentration of MEK inhibitor needed to suppress the proliferation inhibition. These results suggest that ERK activity is required for both the stimulation and inhibition of proliferation of HepG2 cells; that the level of ERK activity determines the opposing proliferation responses; and that HGF-induced proliferation inhibition is caused by cell cycle arrest, which results from pRb being maintained in its active hypophosphorylated form via a high-intensity ERK signal in HepG2 cells. hepatocyte growth factor phosphoinositide 3-kinase extracellular signal-regulated kinase mitogen-activated protein kinase/extracellular signal-regulated kinase kinase secreted alkaline phosphatase Ras-responsive element serum response element Dulbecco's modified Eagle's medium fetal bovine serum 5-bromo-2′-deoxyuridine polyacrylamide gel electrophoresis isopropyl-β-d-thiogalactopyranoside mitogen-activated protein kinase cyclin-dependent kinase Hepatocyte growth factor (HGF)1 is a mesenchymal cell-derived protein that is mitogenic for primary hepatocytes as well as other cell types (1Nakamura T. Nawa K. Ichihara A. Kaise N. Nishino T. FEBS Lett. 1987; 224: 311-316Crossref PubMed Scopus (552) Google Scholar, 2Gohda E. Tsubouchi H. Nakayama H. Hirono S. Sakiyama O. Takahashi K. Miyazaki H. Hashimoto S. Daikuhara Y. J. Clin. Invest. 1988; 81: 414-419Crossref PubMed Scopus (666) Google Scholar, 3Zarnegar R. Michalopoulos G. Cancer Res. 1989; 49: 3314-3320PubMed Google Scholar, 4Rubin J.S. Chan A.M.-L. Bottaro D.P. Burgess W.H. Taylor W.G. Cech A.C. Hirschfield D.W. Wong J. Miki T. Finch P.W. Aaronson S.A. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 415-419Crossref PubMed Scopus (507) Google Scholar). HGF consists of a 62-kDa heavy chain and a 32–34-kDa light chain linked together by a disulfide bond (5Miyazawa K. Tsubouchi H. Naka D. Takahashi K. Okigaki M. Arakaki N. Nakayama H. Hirono S. Sakiyama O. Takahashi K. Gohda E. Daikuhara Y. Kitamura N. Biochem. Biophys. Res. Commun. 1989; 163: 967-973Crossref PubMed Scopus (637) Google Scholar, 6Nakamura T. Nishizawa T. Hagiya M. Seki T. Shimonishi M. Sugimura A. Tashiro K. Shimizu S. Nature. 1989; 342: 440-443Crossref PubMed Scopus (2047) Google Scholar). HGF is identical to scatter factor, which dissociates epithelial cell colonies into individual cells and induces a scattered fibroblastic morphology (7Stoker M. Perryman M. J. Cell Sci. 1985; 77: 209-223Crossref PubMed Google Scholar, 8Stoker M. Gherardi E. Perryman M. Gray J. Nature. 1987; 327: 239-242Crossref PubMed Scopus (1177) Google Scholar, 9Gherardi E. Gray J. Stoker M. Perryman M. Furlong R. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5844-5848Crossref PubMed Scopus (391) Google Scholar, 10Weidner K.M. Arakaki N. Hartmann G. Vandekerckhove J. Weingart S. Rieder H. Fonatsch C. Tsubouchi H. Hishida T. Daikuhara Y. Birchmeiner W. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 7001-7005Crossref PubMed Scopus (656) Google Scholar). HGF also stimulates the migration of epithelial cells (11Stoker M. J. Cell. Physiol. 1989; 139: 565-569Crossref PubMed Scopus (100) Google Scholar) as well as the invasion of carcinoma cells (12Weidner K.M. Behrens J. Vandekerckhove J. Birchmeier W. J. Cell Biol. 1990; 111: 2097-2108Crossref PubMed Scopus (620) Google Scholar) and causes epithelial cells grown on three-dimensional collagen gels to form branching tubules (13Montesano R. Matsumoto K. Nakamura T. Orci L. Cell. 1991; 67: 901-908Abstract Full Text PDF PubMed Scopus (1119) Google Scholar). In addition, HGF protects liver progenitor cells from apoptosis (14Bardelli A. Longati P. Albero D. Goruppi S. Schneider C. Ponzetto C. Comoglio P.M. EMBO J. 1996; 15: 6205-6212Crossref PubMed Scopus (301) Google Scholar). Thus, HGF is widely recognized as a multifunctional cytokine. In vivo, HGF is a potent angiogenic factor (15Bussolino F. Di Renzo M.F. Ziche M. Bocchietto E. Olivero M. Naldini L. Gaudino G. Tamagnone L. Coffer A. Comoglio P.M. J. Cell Biol. 1992; 119: 629-641Crossref PubMed Scopus (1220) Google Scholar, 16Grant D.S. Kleinman H.K. Goldberg I.D. Bhargava M.M. Nickoloff B.J. Kinsella J.L. Polverini P. Rose E.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1937-1941Crossref PubMed Scopus (654) Google Scholar) and is involved in organ regeneration (17Matsumoto K. Nakamura T. Goldberg I.D. Rosen E.M. Hepatocyte Growth Factor-Scatter Factor (HGF-SF) and the c-Met Receptor. Birkhaeuser Verlag, Basel, Switzerland1993: 225-249Google Scholar) and tumorigenesis (18Rong S. Bodescot M. Blair D. Dunn J. Nakamura T. Mizuno K. Park M. Chan A. Aaronson S. Vande Woude G.F. Mol. Cell. Biol. 1992; 12: 5152-5158Crossref PubMed Scopus (295) Google Scholar). Analysis of mice lacking HGF revealed that HGF is essential for organogenesis during normal embryonic development (19Schmidt C. Bladt F. Goedecke S. Brinkmann V. Zschiesche W. Sharpe M. Gherardi E. Birchmeier C. Nature. 1995; 373: 699-702Crossref PubMed Scopus (1241) Google Scholar, 20Uehara Y. Minowa O. Mori C. Shiota K. Kuno J. Noda T. Kitamura N. Nature. 1995; 373: 702-705Crossref PubMed Scopus (931) Google Scholar, 21Bladt F. Riethmacher D. Isenmann S. Aguzzi A. Birchmeier C. Nature. 1995; 376: 768-771Crossref PubMed Scopus (1105) Google Scholar). HGF is also identical to the fibroblast-derived tumor cytotoxic factor (22Higashio K. Shima N. Goto M. Itagaki Y. Nagao M. Yasuda H. Morinaga T. Biochem. Biophys. Res. Commun. 1990; 170: 397-404Crossref PubMed Scopus (203) Google Scholar); and although HGF stimulates the growth of some tumor cell lines (23Shima N. Itagaki Y. Nagao M. Yasuda H. Morinaga T. Higashio K. Cell Biol. Int. Rep. 1991; 15: 397-408Crossref PubMed Scopus (56) Google Scholar, 24Shima N. Nagao M. Ogaki F. Tsuda E. Murakami A. Higashio K. Biochem. Biophys. Res. Commun. 1991; 180: 1151-1158Crossref PubMed Scopus (146) Google Scholar, 25Kan M. Zhang G. Zarnegar R. Michalopoulos G. Myoken Y. McKeehan W.L. Stevens J.I. Biochem. Biophys. Res. Commun. 1991; 174: 331-337Crossref PubMed Scopus (237) Google Scholar, 26Miyazaki M. Gohda E. Tsuboi S. Tsubouchi H. Daikuhara Y. Namba M. Yamamoto I. Cell Biol. Int. Rep. 1992; 16: 145-154Crossref PubMed Scopus (40) Google Scholar, 27Tajima H. Matsumoto K. Nakamura T. FEBS Lett. 1991; 291: 229-232Crossref PubMed Scopus (212) Google Scholar, 28Halaban R. Rubin J.S. Funasaka Y. Cobb M. Boulton T. Faletto D. Rosen E. Chan A. Yoko K. White W. Cook C. Moellmann G. Oncogene. 1992; 7: 2195-2206PubMed Google Scholar, 29Diagnass A.U. Lynch-Devaney K. Podolsky D.K. Biochem. Biophys. Res. Commun. 1994; 202: 701-709Crossref PubMed Scopus (142) Google Scholar), the growth of a number of other tumor cell lines is inhibited (22Higashio K. Shima N. Goto M. Itagaki Y. Nagao M. Yasuda H. Morinaga T. Biochem. Biophys. Res. Commun. 1990; 170: 397-404Crossref PubMed Scopus (203) Google Scholar, 23Shima N. Itagaki Y. Nagao M. Yasuda H. Morinaga T. Higashio K. Cell Biol. Int. Rep. 1991; 15: 397-408Crossref PubMed Scopus (56) Google Scholar, 24Shima N. Nagao M. Ogaki F. Tsuda E. Murakami A. Higashio K. Biochem. Biophys. Res. Commun. 1991; 180: 1151-1158Crossref PubMed Scopus (146) Google Scholar, 26Miyazaki M. Gohda E. Tsuboi S. Tsubouchi H. Daikuhara Y. Namba M. Yamamoto I. Cell Biol. Int. Rep. 1992; 16: 145-154Crossref PubMed Scopus (40) Google Scholar, 27Tajima H. Matsumoto K. Nakamura T. FEBS Lett. 1991; 291: 229-232Crossref PubMed Scopus (212) Google Scholar, 28Halaban R. Rubin J.S. Funasaka Y. Cobb M. Boulton T. Faletto D. Rosen E. Chan A. Yoko K. White W. Cook C. Moellmann G. Oncogene. 1992; 7: 2195-2206PubMed Google Scholar, 29Diagnass A.U. Lynch-Devaney K. Podolsky D.K. Biochem. Biophys. Res. Commun. 1994; 202: 701-709Crossref PubMed Scopus (142) Google Scholar, 30Tajima H. Matsumoto K. Nakamura T. Exp. Cell Res. 1992; 202: 423-431Crossref PubMed Scopus (174) Google Scholar, 31Shiota G. Rhoads D.B. Wang T.C. Nakamura T. Schmidt E.V. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 373-377Crossref PubMed Scopus (256) Google Scholar). This growth inhibitory effect of HGF was also observed in vivo. When HGF transfectants of Fao hepatoma cells were transplanted into nude mice, the tumor formation of the transfectants was suppressed compared with the parental cells (31Shiota G. Rhoads D.B. Wang T.C. Nakamura T. Schmidt E.V. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 373-377Crossref PubMed Scopus (256) Google Scholar). Exogenous administration of HGF decreases the DNA synthesis of diethylnitrosamine-induced rat liver tumors (32Liu M.-L. Mars W.M. Michalopoulos G.K. Carcinogenesis. 1995; 16: 841-843Crossref PubMed Scopus (67) Google Scholar). Furthermore, c-myc-induced hepatocarcinogenesis is inhibited by HGF in a transgenic mouse model coexpressing c-myc and HGF (33Santoni-Rugiu E. Preisegger K.H. Kiss A. Audolfsson T. Shiota G. Schmidt E.V. Thorgeirsson S.S. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9577-9582Crossref PubMed Scopus (113) Google Scholar). The diverse biological effects of HGF are transduced through the activation of its high-affinity receptor, the c-metproto-oncogene product (the c-Met receptor) (34Bottaro D.P. Rubin J.S. Faletto D.L. Chan A.M.-L. Kmiecik T.E. Vande Woude G.F. Aaronson S.A. Science. 1991; 251: 802-804Crossref PubMed Scopus (2144) Google Scholar, 35Naldini L. Weidner K.M. Vigna E. Gaudino G. Bardelli A. Ponzetto C. Narsimhan R.P. Hartmann G. Zarnegar R. Michalopoulos G.K. Birchmeier W. Comoglio P.M. EMBO J. 1991; 10: 2867-2878Crossref PubMed Scopus (608) Google Scholar, 36Weidner K.M. Sachs M. Birchmeier W. J. Cell Biol. 1993; 121: 145-154Crossref PubMed Scopus (380) Google Scholar, 37Komada M. Kitamura N. Oncogene. 1993; 8: 2381-2390PubMed Google Scholar). The mature form of the c-Met receptor is a heterodimeric protein consisting of a 50-kDa extracellular α-subunit and a transmembrane 145-kDa β-subunit containing a tyrosine kinase domain in the cytoplasmic region (38Park M. Dean M. Kaul K. Braun M.J. Gonda M. Vande Woude G. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 6379-6383Crossref PubMed Scopus (526) Google Scholar, 39Giordano S. Ponzetto C. Di Renzo M.F. Cooper C.S. Comoglio P.M. Nature. 1989; 339: 155-156Crossref PubMed Scopus (456) Google Scholar). Binding of HGF to the c-Met receptor induces activation of the tyrosine kinase. The tyrosine kinase domain is highly phosphorylated at two tyrosine residues (Tyr1234 and Tyr1235) that are essential for the catalytic activity of the enzyme (40Komada M. Kitamura N. J. Biol. Chem. 1994; 269: 16131-16136Abstract Full Text PDF PubMed Google Scholar, 41Longati P. Bardelli A. Ponzetto C. Naldini L. Comoglio P.M. Oncogene. 1994; 9: 49-57PubMed Google Scholar). In addition, two tyrosine residues located in the carboxyl-terminal region of the β-subunit (Tyr1349 and Tyr1356) are phosphorylated (42Ponzetto C. Bardelli A. Zhen Z. Maina F. Zonca P.D. Giordano S. Graziani A. Panayotou G. Comoglio P.M. Cell. 1994; 77: 261-271Abstract Full Text PDF PubMed Scopus (912) Google Scholar). These phosphorylated tyrosine residues provide binding sites for the Src homology 2 domain of the p85 regulatory subunit of phosphoinositide 3-kinase (PI3K), pp60c-src, phospholipase Cγ, and Shc (42Ponzetto C. Bardelli A. Zhen Z. Maina F. Zonca P.D. Giordano S. Graziani A. Panayotou G. Comoglio P.M. Cell. 1994; 77: 261-271Abstract Full Text PDF PubMed Scopus (912) Google Scholar). The Src homology 2 domain of Grb2 binds to Tyr1356 (43Zhu H. Naujokas M.A. Fixman E.D. Torossian K. Park M. J. Biol. Chem. 1994; 269: 29943-29948Abstract Full Text PDF PubMed Google Scholar). As a result of these interactions, HGF stimulates the activation of PI3K, pp60c-src, phospholipase Cγ, and Ras-ERK signaling pathways. The molecular mechanism of the HGF-induced growth inhibition of tumor cells remains obscure. In this study, we analyzed the HGF signaling pathways downstream of the c-Met receptor in the human hepatocellular carcinoma cell line HepG2, the proliferation of which is markedly inhibited by HGF. We found that both serum-dependent proliferation and HGF-induced proliferation inhibition of HepG2 cells were inhibited by blocking the MEK-ERK pathway, that HGF induced a strong activation of ERK, and that reduction of this activation to a weak activation restored the proliferation of HepG2 cells. We also found that HGF induced the hypophosphorylated form of pRb and that inhibition of ERK activation suppressed this induction. These findings suggest that stimulation and inhibition of proliferation of HepG2 cells are determined by the level of ERK activity and that the proliferation inhibition of HepG2 cells triggered by HGF results from cell cycle arrest caused by pRb being maintained in an active hypophosphorylated form through high-intensity ERK signaling. Reagents were obtained as follows: anti-Ha-Ras antibody from Santa Cruz Biotechnology; anti-ERK2 antibody from Upstate Biotechnology, Inc.; anti-pRb antibody from Pharmingen; horseradish peroxidase-conjugated anti-mouse and anti-rabbit immunoglobulins fromAmersham Pharmacia Biotech; recombinant human HGF from the Research Center of Mitsubishi Chemical Corp.; PD98059 and LY294002 from Calbiochem; and U0126 from Promega. Plasmid constructs pOPRSVI-Ha-Ras(G12V) and p3′ss were provided by Dr. Y. Kaziro (Tokyo Institute of Technology. The plasmid pTK-SEAP, which contains the secreted alkaline phosphatase (SEAP) gene under the control of the thymidine kinase basal promoter of the herpes simplex virus, was obtained fromCLONTECH. pRRE (collagenase-1)-SEAP and pSRE(c-fos)-SEAP were constructed by inserting the Ras-responsive element (RRE) in the collagenase-1 promoter or the serum response element (SRE) in the c-fos promoter, respectively, into pTK-SEAP. pRRE(collagenase-1)-SEAP contains the SEAP reporter gene under the control of RREs, (AGAGGATGTTATAAAGCATGAGTCAG)4, with essential Ets-binding sites. pSRE(c-fos)-SEAP contains the SEAP reporter gene under the control of SREs, (CCCTTACACAGGATGTCCATATTAGGACATCTGCGTCAGC)4, with Ets-binding sites to which the Ets subfamily ternary complex factors bind. Parenchymal hepatocytes were isolated from an adult mouse by the modified in situperfusion method as described (44Morita M. Watanabe Y. Akaike T. Hepatology. 1994; 19: 426-431Crossref PubMed Scopus (88) Google Scholar). HepG2 cells, MKN74 cells, and hepatocytes were cultured in DMEM, RPMI 1640 medium, and William's medium E, respectively, containing 10% fetal bovine serum (FBS), 100 units/ml penicillin, and 100 µg/ml streptomycin in a humidified atmosphere of 5% CO2 at 37 °C. The plasmid (2.2 µg) was transfected into the cells using the FuGENE-6 reagent (Roche Molecular Biochemicals), and the transfected cells were cultured for 2 days. The cells were then cultured in selective medium containing hygromycin B (400 µg/ml) or G418 (1 mg/ml). Cells were seeded at a proper density of cells/well in 12-well plates and cultured with DMEM or RPMI 1640 medium containing 10% FBS for 1 day. Cells were subsequently treated with reagents and cultured further. The cells were harvested after trypsinization, and the number of cells were counted using a hemocytometer. DNA synthesis was analyzed by measuring the incorporation of the pyrimidine analog 5-bromo-2′-deoxyuridine (BrdUrd) during DNA synthesis. Cells were seeded at a proper density of cells/well in 96-well plates and cultured in DMEM (HepG2 cells), RPMI 1640 medium (MKN74 cells), or William's medium E (hepatocytes) containing 10% FBS. After the proper time, the medium was replaced with fresh medium, and cells were cultured in the presence or absence of HGF. BrdUrd was added to the cells 24 h before measuring DNA synthesis. After 24 h, the BrdUrd incorporation during DNA synthesis was measured using a cell proliferation enzyme-linked immunosorbent assay system (Amersham Pharmacia Biotech). Cells were washed with cold phosphate-buffered saline containing 0.01% EDTA and 0.2 mmNa3VO4 before being lysed with cold lysis buffer (50 mm Tris-HCl, pH 7.4, 150 mm NaCl, 1% Triton X-100, 1 mm Na3VO4, 50 mm NaF, and 30 mm tetrasodium pyrophosphate) containing 5 µg/ml leupeptin, 1 µg/ml pepstatin A, and 1 mm phenylmethylsulfonyl fluoride. The lysates were cleared by centrifugation, and the protein concentration in the lysates was determined using the BCA protein assay reagent (Pierce). Laemmli sample buffer (125 mm Tris-HCl, pH 6.8, 4% SDS, 20% glycerol, 0.002% bromphenol blue, and 10% 2-mercaptoethanol) or sample buffer (50 mm Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.1% bromphenol blue, and 2% 2-mercaptoethanol) was added to each sample before it was boiled. The samples were then separated by SDS-PAGE and transferred to nitrocellulose membranes or polyvinylidene difluoride membranes. The membranes were incubated with the first antibody for 1 h and then with horseradish peroxidase-conjugated secondary antibody for 1 h. Immunoreactive proteins were visualized with an enhanced chemiluminescence Western blotting detection system (ECL,Amersham Pharmacia Biotech). 80 µg of protein from the cell lysates were separated on SDS-12.5% polyacrylamide gel containing myelin basic protein (0.5 mg/ml; Sigma) as an ERK substrate. Gels were washed with 20% (v/v) 2-propanol and 50 mm Tris-HCl, pH 8.0, to remove SDS and then with 50 mm Tris-HCl, pH 8.0, containing 5 mm 2-mercaptoethanol. Proteins were further denatured by washing the gels with 6 m guanidine HCl and 5 mm 2-mercaptoethanol in 50 mm Tris-HCl, pH 8.0, and then renatured with 50 mm Tris-HCl, pH 8.0, containing 0.04% (v/v) Tween 40 and 5 mm 2-mercaptoethanol at 4 °C overnight. The gels were equilibrated at room temperature for 30 min in 40 mm HEPES, pH 7.4, 2 mm dithiothreitol, 15 mm MgCl2, 1 mm MnCl2, 300 µm Na3VO4, and 100 µm EGTA. The in-gel kinase assay was performed in 40 mm HEPES, pH 7.4, 2 mm dithiothreitol, 15 mm MgCl2, 1 mm MnCl2, 300 µm Na3VO4, 100 µm EGTA, 25 µm ATP, and 8 µCi/ml [γ-32P]ATP (Amersham Pharmacia Biotech) at room temperature for 1 h. After extensive washing with 5% (w/v) trichloroacetic acid and 1% (w/v) tetrasodium pyrophosphate, the gels were dried, and phosphorylation of myelin basic protein was detected by autoradiography. Cells were seeded at a density of 1.25 × 105 cells/well in six-well plates containing DMEM. After 24 h, the medium was replaced with fresh medium, and plasmid pTK-SEAP, pRRE(collagenase-1)-SEAP, or pSRE(c-fos)-SEAP (2.2 µg) was transfected into the cells using the FuGENE-6 reagent. At 24 h after transfection, the cells were pretreated with PD98059 (0–50 µm) for 1 h. The cells were subsequently treated with HGF (50 ng/ml) or isopropyl-β-d-thiogalactopyranoside (IPTG; 5 mm) for 2 days. The culture medium was then harvested, and detached cells were removed by centrifugation. The SEAP assay was performed using the SEAP reporter assay kit (Toyobo), and chemiluminescence was quantitated on a Wallac 1420 ARVOsx multi-label counter. It has been shown that the proliferation of the human hepatocellular carcinoma cell line HepG2 is markedly inhibited by HGF (26Miyazaki M. Gohda E. Tsuboi S. Tsubouchi H. Daikuhara Y. Namba M. Yamamoto I. Cell Biol. Int. Rep. 1992; 16: 145-154Crossref PubMed Scopus (40) Google Scholar, 27Tajima H. Matsumoto K. Nakamura T. FEBS Lett. 1991; 291: 229-232Crossref PubMed Scopus (212) Google Scholar, 31Shiota G. Rhoads D.B. Wang T.C. Nakamura T. Schmidt E.V. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 373-377Crossref PubMed Scopus (256) Google Scholar). Thus, we used this cell line in this study to examine the mechanism of growth inhibition of tumor cells by HGF. For comparison, we also used the human gastric carcinoma cell line MKN74, the proliferation of which is enhanced by HGF (45Shibamoto S. Hayakawa M. Hori T. Oku N. Miyazawa K. Kitamura N. Ito F. Cell Struct. Funct. 1992; 17: 185-190Crossref PubMed Scopus (42) Google Scholar), because nontransformed primary cultured hepatocytes are not suitable for counting cell numbers, which is thought to be a proper method for evaluating cell proliferation. To confirm the opposing proliferation responses of HepG2 and MKN74 cells to HGF, these cells were cultured in medium containing 10% FBS in the presence or absence of HGF, and the cell numbers were counted. Fig. 1A shows a time course of the effect of HGF (50 ng/ml) on the proliferation of HepG2 and MKN74 cells. The proliferation of HepG2 cells was inhibited by HGF. The inhibitory effect first appeared at 3 days and became marked at 4 days. The number of cells was ∼0.45-fold less compared with HGF-untreated control cells at 4 days. On the other hand, the proliferation of MKN74 cells was stimulated by HGF. The stimulatory effect first appeared at 2 days and became marked at 3 and 4 days. The number of cells was ∼2-fold greater compared with HGF-untreated control cells at 4 days. These results confirmed the opposing proliferation responses of HepG2 and MKN74 cells to HGF. In addition to affecting proliferation, HGF induced scattering of cell colonies in HepG2 and MKN74 cells and hepatocytes (data not shown). Next, we examined the effect of HGF on DNA synthesis of HepG2 and MKN74 cells by measuring BrdUrd incorporation during DNA synthesis. The DNA synthesis of HepG2 cells was inhibited by HGF (Fig. 1B). On the other hand, similar to primary cultured hepatocytes, the DNA synthesis of MKN74 cells was stimulated by HGF (Fig. 1B). These results indicate that the effect of HGF on the proliferation (counting cell numbers) of HepG2 and MKN74 cells correlates well with the effect on DNA synthesis (measuring BrdUrd incorporation). Thus, HepG2 and MKN74 cells were used to investigate the intracellular signaling pathway involved in the opposing effects of HGF on cell proliferation. Since the MEK-ERK pathway plays a central role in signaling cell growth (46Seger R. Krebs E.G. FASEB J. 1995; 9: 726-735Crossref PubMed Scopus (3252) Google Scholar, 47Dhanasekaran N. Premkumar Reddy E. Oncogene. 1998; 17: 1447-1455Crossref PubMed Scopus (262) Google Scholar), it may be involved in the proliferation inhibition of HepG2 cells triggered by HGF. To examine whether the MEK protein is involved in the HGF-induced proliferation inhibition of HepG2 cells, the effects of specific inhibitors (PD98059 and U0126) (48Dudley D.T. Pang L. Decker S.J. Bridges A.J. Saltiel A.R. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7686-7689Crossref PubMed Scopus (2603) Google Scholar, 49Alessi D.R. Cuenda A. Cohen P. Dudley D.T. Saltiel A.R. J. Biol. Chem. 1995; 270: 27489-27494Abstract Full Text Full Text PDF PubMed Scopus (3126) Google Scholar, 50Favata M.F. Horiuchi K.Y. Manos E.J. Daulerio A.J. Stradley D.A. Feeser W.S. Van Dyk D.E. Pitts W.J. Earl R.A. Hobbs F. Copeland R.A. Magolda R.L. Scherle P.A. Trzaskos J.M. J. Biol. Chem. 1998; 273: 18623-18632Abstract Full Text Full Text PDF PubMed Scopus (2768) Google Scholar) of MEK, an upstream kinase of ERK, were tested. Cells were pretreated with the MEK-specific inhibitors and then cultured in medium containing 10% FBS in the presence or absence of HGF. The proliferation of MKN74 cells observed in both the presence and absence of HGF was inhibited by PD98059 in a dose-dependent manner (Fig.2B). The proliferation of HepG2 cells cultured in the absence of HGF was inhibited by PD98059, similar to MKN74 cells, whereas the proliferation of HepG2 cells inhibited by HGF was restored by PD98059 (Fig. 2A). It should be noted that PD98059 completely restored the proliferation inhibited by HGF at a concentration of 10 µm, whereas above or below 10 µm, the restoration was incomplete. The growth curve for cells cultured in the presence of PD98059 (10 µm) and HGF was similar to that for untreated cells (data not shown). A similar restoration of HepG2 cell proliferation was observed with U0126, and a concentration of 2 µmcompletely restored the proliferation inhibited by HGF (Fig.2C). These results suggest that MEK activity is essential for the serum-induced proliferation stimulation of HepG2 cells and the serum- and HGF-induced proliferation stimulation of MKN74 cells and, in addition, that it is also required for the HGF-induced proliferation inhibition of HepG2 cells. It has been shown that the PI3K pathway is involved in cell proliferation (51Rahimi N. Tremblay E. Elliott B. J. Biol. Chem. 1996; 271: 24850-24855Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar, 52Gille H. Downward J. J. Biol. Chem. 1999; 274: 22033-22040Abstract Full Text Full Text PDF PubMed Scopus (375) Google Scholar). Thus, to examine whether the PI3K pathway participates in the HGF-induced proliferation inhibition of HepG2 cells, the effect of a PI3K-specific inhibitor (LY294002) was tested. The proliferation of HepG2 cells cultured in both the presence and absence of HGF was inhibited by LY294002 in a dose-dependent manner. The proliferation inhibition induced by HGF was not affected by LY294002 (Fig. 2D). These results suggest that PI3K is not necessary for the HGF-induced proliferation inhibition of HepG2 cells, although it is required for the serum-induced proliferation stimulation. In addition, we also examined whether the stress MAPK pathway is involved in the HGF-induced proliferation inhibition, using a p38-specific inhibitor (SB203580) (53Cuenda A. Rouse J. Doza Y.N. Meier R. Cohen P. Gallagher T.F. Young P.R. Lee J.C. FEBS Lett. 1995; 364: 229-233Crossref PubMed Scopus (1994) Google Scholar). The proliferation inhibition induced by HGF was not affected by SB203580 (data not shown). ERK is the main downstream target of MEK (46Seger R. Krebs E.G. FASEB J. 1995; 9: 726-735Crossref PubMed Scopus (3252) Google Scholar, 47Dhanasekaran N. Premkumar Reddy E. Oncogene. 1998; 17: 1447-1455Crossref PubMed Scopus (262) Google Scholar), which phosphorylates and activates ERK. Thus, to determine whether ERK participates in the HGF-induced proliferation inhibition of HepG2 cells, we examined the phosphorylation and activity of ERK2 in HepG2 and MKN74 cells treated with HGF by immunoblot analysis and in-gel kinase assay, respectively. ERK2 was phosphorylated by treatment with HGF, and this phosphorylation lasted for 12 h (Fig.3, panels a,−PD98059) and reached almost the basal level after 48 h (data not shown) in both HepG2 and MKN74 cells. ERK2 activity was more strongly stimulated in HepG2 cells treated with HGF than in MKN74 cells (Fig. 3, panels b, −PD98059). PD98059 at a concentration of 10 µm, which completely restored the proliferation of HepG2 cells inhibited by HGF, also reduced the phosphorylation and activity of ERK2 in HepG2 cells stimulated with HGF, but low levels of ERK2 phosphorylation and activity were still detected (Fig. 3). In addition, 10 µm PD98059 reduced the phosphorylation and activity of ERK2 in MKN74 cells treated with HGF, although the reduction in activity was not as prominent (Fig. 3). The phosphorylation and activity of ERK2 were reduced by PD98059 in

Referência(s)