Regulation of Immature Dendritic Cell Migration by RhoA Guanine Nucleotide Exchange Factor Arhgef5
2009; Elsevier BV; Volume: 284; Issue: 42 Linguagem: Inglês
10.1074/jbc.m109.047282
ISSN1083-351X
AutoresZhenglong Wang, Yosuke Kumamoto, Ping Wang, Xiaoqing Gan, David M. Lehmann, Alan V. Smrcka, Lauren Cohn, Akiko Iwasaki, Lin Li, Dianqing Wu,
Tópico(s)Cytokine Signaling Pathways and Interactions
ResumoThere are a large number of Rho guanine nucleotide exchange factors, most of which have no known functions. Here, we carried out a short hairpin RNA-based functional screen of Rho-GEFs for their roles in leukocyte chemotaxis and identified Arhgef5 as an important factor in chemotaxis of a macrophage phage-like RAW264.7 cell line. Arhgef5 can strongly activate RhoA and RhoB and weakly RhoC and RhoG, but not Rac1, RhoQ, RhoD, or RhoV, in transfected human embryonic kidney 293 cells. In addition, Gβγ interacts with Arhgef5 and can stimulate Arhgef5-mediated activation of RhoA in an in vitro assay. In vivo roles of Arhgef5 were investigated using an Arhgef-5-null mouse line. Arhgef5 deficiency did not affect chemotaxis of mouse macrophages, T and B lymphocytes, and bone marrow-derived mature dendritic cells (DC), but it abrogated MIP1α-induced chemotaxis of immature DCs and impaired migration of DCs from the skin to lymph node. In addition, Arhgef5 deficiency attenuated allergic airway inflammation. Therefore, this study provides new insights into signaling mechanisms for DC migration regulation. There are a large number of Rho guanine nucleotide exchange factors, most of which have no known functions. Here, we carried out a short hairpin RNA-based functional screen of Rho-GEFs for their roles in leukocyte chemotaxis and identified Arhgef5 as an important factor in chemotaxis of a macrophage phage-like RAW264.7 cell line. Arhgef5 can strongly activate RhoA and RhoB and weakly RhoC and RhoG, but not Rac1, RhoQ, RhoD, or RhoV, in transfected human embryonic kidney 293 cells. In addition, Gβγ interacts with Arhgef5 and can stimulate Arhgef5-mediated activation of RhoA in an in vitro assay. In vivo roles of Arhgef5 were investigated using an Arhgef-5-null mouse line. Arhgef5 deficiency did not affect chemotaxis of mouse macrophages, T and B lymphocytes, and bone marrow-derived mature dendritic cells (DC), but it abrogated MIP1α-induced chemotaxis of immature DCs and impaired migration of DCs from the skin to lymph node. In addition, Arhgef5 deficiency attenuated allergic airway inflammation. Therefore, this study provides new insights into signaling mechanisms for DC migration regulation. Leukocyte chemotaxis underlies leukocyte migration, infiltration, trafficking, and homing that are not only important for normal leukocyte functions, but also have a important role in inflammation-related diseases. Leukocyte chemotaxis is regulated by leukocyte chemoattractants that include bacterial by-products such as formylmethionylleucylphenylalanine, complement proteolytic fragments such as C5a, and the superfamily of chemotactic cytokines, chemokines. These chemoattractants bind to their specific cell G protein-coupled receptors and are primarily coupled to the Gi family of G proteins to regulate leukocyte chemotaxis. Previous studies have established that the Rho family of small GTPases regulates leukocyte migration (1Ridley A.J. J. Cell Sci. 2001; 114: 2713-2722Crossref PubMed Google Scholar, 2Etienne-Manneville S. Hall A. Nature. 2002; 420: 629-635Crossref PubMed Scopus (3875) Google Scholar). Rac, Cdc42, and RhoA are the three best studied Rho small GTPases. In myeloid cells, Cdc42 regulates directionality by directing where F-actin and lamellipodia are formed, and Rac regulates F-actin formation in the lamellipodia, which provides a driving force for cell motility (3Allen W.E. Zicha D. Ridley A.J. Jones G.E. J. Cell Biol. 1998; 141: 1147-1157Crossref PubMed Scopus (445) Google Scholar, 4Srinivasan S. Wang F. Glavas S. Ott A. Hofmann F. Aktories K. Kalman D. Bourne H.R. J. Cell Biol. 2003; 160: 375-385Crossref PubMed Scopus (364) Google Scholar, 5Meili R. Firtel R.A. Cell. 2003; 114: 153-156Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 6Gu Y. Filippi M.D. Cancelas J.A. Siefring J.E. Williams E.P. Jasti A.C. Harris C.E. Lee A.W. Prabhakar R. Atkinson S.J. Kwiatkowski D.J. Williams D.A. Science. 2003; 302: 445-449Crossref PubMed Scopus (408) Google Scholar). On the other hand, RhoA regulates the formation and contractility of the actomyosin structure at the back that provides a pushing force (5Meili R. Firtel R.A. Cell. 2003; 114: 153-156Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 7Xu J. Wang F. Van Keymeulen A. Herzmark P. Straight A. Kelly K. Takuwa Y. Sugimoto N. Mitchison T. Bourne H.R. Cell. 2003; 114: 201-214Abstract Full Text Full Text PDF PubMed Scopus (561) Google Scholar). Rho guanine nucleotide exchange factors (GEF) 3The abbreviations used are: GEFguanine nucleotide exchange factorssiRNAsmall interfering RNAshRNAshort hairpin RNADCdendritic cellRBDRho-binding domainPAKp21-binding domainGSTglutathione S-transferaseBALbronchoalveolar lavageHSVherpes simplex virus type 2MFImean fluorescence intensityPHpleckstrin homologyHAhemagglutininGFPgreen fluorescent proteinELISAenzyme-linked immunosorbent assayILinterleukinFITCfluorescein isothiocyanateHEKhuman embryonic kidneyRTreverse transcriptaseOVAovalbuminIFNinterferonMantN-methylanthraniloylDHDbl homologyMIP-1αmacrophage inflammatory protein-1αSDF-1stromal-derived factor-1. are key regulators for the activity of these small GTPases. GEFs activate small GTPases by promoting the loading of GTP to the small GTPases, a rate-limiting step in GTPase regulation (8Ridley A.J. Trends Cell Biol. 2001; 11: 471-477Abstract Full Text Full Text PDF PubMed Scopus (644) Google Scholar, 9Burridge K. Wennerberg K. Cell. 2004; 116: 167-179Abstract Full Text Full Text PDF PubMed Scopus (1519) Google Scholar, 10Wennerberg K. Der C.J. J. Cell Sci. 2004; 117: 1301-1312Crossref PubMed Scopus (478) Google Scholar, 11Schwartz M. J. Cell Sci. 2004; 117: 5457-5458Crossref PubMed Scopus (159) Google Scholar). Previous biochemical and genetic studies have revealed how Cdc42 and Rac may be regulated by chemokine receptors in leukocytes. Chemokine receptors can regulate Cdc42 via a Rho-GEF PIXα, which is regulated by Gβγ from the Gi proteins via the interactions between Gβγ and Pak1 and between Pak1 and PIXα in myeloid cells 12Li Z. Hannigan M. Mo Z. Liu B. Lu W. Wu Y. Smrcka A.V. Wu G. Li L. Liu M. Huang C.K. Wu D. Cell. 2003; 114: 215-227Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar. On the other hand, in neutrophils chemokine receptors regulate Rac2 via another Rho-GEF P-Rex1, which is directly regulated by Gβγ (13Welch H.C. Coadwell W.J. Ellson C.D. Ferguson G.J. Andrews S.R. Erdjument-Bromage H. Tempst P. Hawkins P.T. Stephens L.R. Cell. 2002; 108: 809-821Abstract Full Text Full Text PDF PubMed Scopus (435) Google Scholar, 14Welch H.C. Condliffe A.M. Milne L.J. Ferguson G.J. Hill K. Webb L.M. Okkenhaug K. Coadwell W.J. Andrews S.R. Thelen M. Jones G.E. Hawkins P.T. Stephens L.R. Curr. Biol. 2005; 15: 1867-1873Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar, 15Dong X. Mo Z. Bokoch G. Guo C. Li Z. Wu D. Curr. Biol. 2005; 15: 1874-1879Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). Two Rho-GEFs have been implicated in regulation of RhoA in neutrophils. GEF115 was found in the leading edges of polarized mouse neutrophils, whereas PDZ Rho-GEF was found in the uropods of differentiated HL-60 cells. Both Rho-GEFs were believed to mediate pertussis toxin-resistant activation of RhoA in these cells. However, a significant portion of RhoA activity in leukocytes are pertussis toxin-sensitive, which is presumably regulated by the α and/or βγ subunits from the Gi proteins. The signaling mechanism for this pertussis toxin-sensitive RhoA regulation by chemokine receptors remains largely elusive. guanine nucleotide exchange factors small interfering RNA short hairpin RNA dendritic cell Rho-binding domain p21-binding domain glutathione S-transferase bronchoalveolar lavage herpes simplex virus type 2 mean fluorescence intensity pleckstrin homology hemagglutinin green fluorescent protein enzyme-linked immunosorbent assay interleukin fluorescein isothiocyanate human embryonic kidney reverse transcriptase ovalbumin interferon N-methylanthraniloyl Dbl homology macrophage inflammatory protein-1α stromal-derived factor-1. Molecular cloning and genomic sequencing have identified more than 70 Rho-GEFs in mammals (16Schmidt A. Hall A. Genes Dev. 2002; 16: 1587-1609Crossref PubMed Scopus (987) Google Scholar, 17García-Mata R. Burridge K. Trends Cell Biol. 2007; 17: 36-43Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar, 18Rossman K.L. Der C.J. Sondek J. Nat. Rev. Mol. Cell Biol. 2005; 6: 167-180Crossref PubMed Scopus (1327) Google Scholar, 19Buchsbaum R.J. J. Cell Sci. 2007; 120: 1149-1152Crossref PubMed Scopus (97) Google Scholar, 20Erickson J.W. Cerione R.A. Biochemistry. 2004; 43: 837-842Crossref PubMed Scopus (115) Google Scholar). Many of these Rho-GEFs have been shown to activate RhoA in in vitro and overexpression assays (16Schmidt A. Hall A. Genes Dev. 2002; 16: 1587-1609Crossref PubMed Scopus (987) Google Scholar, 17García-Mata R. Burridge K. Trends Cell Biol. 2007; 17: 36-43Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar, 18Rossman K.L. Der C.J. Sondek J. Nat. Rev. Mol. Cell Biol. 2005; 6: 167-180Crossref PubMed Scopus (1327) Google Scholar, 19Buchsbaum R.J. J. Cell Sci. 2007; 120: 1149-1152Crossref PubMed Scopus (97) Google Scholar, 20Erickson J.W. Cerione R.A. Biochemistry. 2004; 43: 837-842Crossref PubMed Scopus (115) Google Scholar). However, it is not known if any of them regulate RhoA in vivo, we have found that PIXα is a specific GEF for Cdcd42 in neutrophils (12Li Z. Hannigan M. Mo Z. Liu B. Lu W. Wu Y. Smrcka A.V. Wu G. Li L. Liu M. Huang C.K. Wu D. Cell. 2003; 114: 215-227Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar) despite its potent activity on Rac in in vitro and overexpression assays (21Obermeier A. Ahmed S. Manser E. Yen S.C. Hall C. Lim L. EMBO J. 1998; 17: 4328-4339Crossref PubMed Scopus (174) Google Scholar, 22Bagrodia S. Bailey D. Lenard Z. Hart M. Guan J.L. Premont R.T. Taylor S.J. Cerione R.A. J. Biol. Chem. 1999; 274: 22393-22400Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). Therefore, we used a siRNA-based loss of function screen in an attempt to identify the GEFs that regulate myeloid cell migration and RhoA activity. One of the candidates, Arhgef5, was found to be directly activated by Gβγ to regulate RhoA and has an important role in immature DC migration. In addition, Arhgef5 deficiency attenuated allergic airway inflammation in a mouse model. The full-length Arhgef5 cDNA and its truncated mutants were amplified and subcloned into a mammalian expression vector carrying a FLAG tag. The exchange activity-deficient Arhgef5 mutant Arhgef5DH was generated by substituting Ala residues for Leu245 and Leu246. For the in vitro binding assay, Arhgef5 cDNA was subcloned into the pET21-His vector. His-tagged Arhgef5 was expressed in BL21(DE3)-competent cells and subsequently purified with nickel-nitrilotriacetic acid (Qiagen). Recombinant RhoA, Rhoteckin-RBD, and PAK-PBD, and Elmo were prepared from bacteria as GST fusion proteins. The Gβ1γ2 protein was prepared as previously described (12Li Z. Hannigan M. Mo Z. Liu B. Lu W. Wu Y. Smrcka A.V. Wu G. Li L. Liu M. Huang C.K. Wu D. Cell. 2003; 114: 215-227Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar). The cDNAs of RhoB, RhoC, RhoD, RhoG, and RhoQ as well as the dominant negative forms of RhoC, RhoD, and RhoF were acquired from the Missouri S&T cDNA Resources Center carrying an HA tag at their N termini. DNA sequences of all expression constructs were verified by sequencing. Antibodies specific to HA, His, and FLAG were acquired from Covance. HEK293T cells and Raw264.7 cells were maintained in Dulbecco's modified Eagle's medium (Cellgro) supplemented with penicillin/streptomycin and 10% fetal bovine serum (Hyclone). The B lymphoid cells were cultured in RPMI 1640 medium (Cellgro) supplemented with penicillin/streptomycin and 10% heat-inactivated fetal bovine serum (Hyclone). Transfection was carried out using Lipofectamine Plus (Invitrogen) following the manufacturer's instructions. The method to culture immature and mature dendritic cells from mouse bone marrow was described in detail (44Lutz M.B. Kukutsch N. Ogilvie A.L. Rössner S. Koch F. Romani N. Schuler G. J. Immunol. Methods. 1999; 223: 77-92Crossref PubMed Scopus (2526) Google Scholar). Briefly, mouse bone marrow cells were collected by flushing the femurs. After lysis of the red blood cells, the cells were cultured in the Dulbecco's modified Eagle's medium supplemented with 20 ng/ml mouse recombinant granulocyte macrophage colony-stimulating factor (PeproTech). After 5 days, cultured cells were collected and used for immature DC migration assays. Alternatively, the immature DCs were treated with 1 μg/ml lipopolysaccharide (Sigma) for 24 h and used for mature DC migration assays. The shRNA vector, which was named pAS, was modified based on pSuper (23Brummelkamp T.R. Bernards R. Agami R. Science. 2002; 296: 550-553Crossref PubMed Scopus (3971) Google Scholar) by incorporating a GFP-luciferase fusion protein expression unit. The sequences for these shRNAs are shown in supplemental Table S1. For screening, the shRNAs and control vector were transfected into Raw264.7 cells using Lipofectamine Plus. The cells were collected 48 h later by trypsinization and resuspended in Dulbecco's modified Eagle's medium containing 1% fetal bovine serum. They were then loaded into the upper chambers of 24-well transwell plates (Costar, 5 μm pore size). The lower chambers were filled with the same medium, but supplemented with 10 nm C5a (Sigma). The plates were incubated at 37 °C for 4 h. Migrated cells were detached from the lower surface of the transwell inserts by trypsin and EDTA and lysed for luciferase assays. The chemotactic indices were calculated by dividing the luciferase activity of migrated cells in the presence of C5a by that of its absence. For DC migration assays, BM-derived immature DCs or mature DCs were collected and resuspended in Dulbecco's modified Eagle's medium containing 1% fetal bovine serum and loaded onto the upper chambers of transwell plates. Immature DCs were stimulated with 300 ng/ml MIP-1α (PeproTech), whereas mature DCs were stimulated with 60 ng/ml CCL-19 (PeproTech) for 4 h at 37 °C. Migrated cells were then counted and stained with CD11c for flow cytometric analysis. The chemotaxis indices were calculated by dividing the number of migrated immature (CD11cmid) or mature (CD11chigh) DCs in the presence of a chemotactic ligand by that in its absence. To evaluate the role of Arhgef5 and -15 in mature DC chemotaxis, bone marrow-derived immature DCs were collected and transfected with synthetic siRNA duplex oligos of Arhgef5 and Arhgef15 using the Amaxa Nucleofector system (Amaxa Inc.). Twenty-four hours after transfection, lipopolysaccharide was added into the culture to induce DC maturation. Mature DCs were collected for the transwell migration assay as described above 24 h after the induction. The target sequences for the Arhgef5 and Arhgef15 siRNAs were CAGGAGGAATTTAATAATACA and AAGTATTAAATTAATCTAATA, respectively. For evaluating lymphocyte migration, splenocytes were used in the transwell assay in response to 10 nm SDF-1. After 3 h incubation at 37 °C, migrated cells were counted and stained with anti-CD3-FITC and anti-B220-R-phycoerythrin. The numbers of migrated T and B cells were determined based on the cell number and their relative percentages, and chemotactic indices were computed as described above. For macrophage chemotaxis assay, macrophages were obtained from the mouse peritonea elicited by thioglycolate. Similar transwell assays were carried out with 10 nm C5a (Sigma) as the stimulus. The pulldown assays for determining the activity of small GTPases were carried essentially as previously described. In brief, HEK293T cells were cotransfected with Arhgef5 or its inactive mutant Arhgef5DH with one of the HA-tagged small GTPases. After 24 h transfection, cells were lysed with the lysis buffer (50 mm Tris-HCl (pH 7.3), 10 mm MgCl2 and 0.2 m NaCl, 2% Nonidet P-40, 10% glycerol, 2 mm orthovanadate) containing recombinant GST-Rhoteckin-RBD for RhoA, RhoB, and RhoC pulldown, GST-PAK-CRIB for Rac, RhoD, and RhoQ pulldown, or GST-Elmo for RhoG pulldown. Bound GTPases were detected by Western analysis with an anti-HA antibody. Cells were stimulated with or without 30 ng/ml SDF-1 for 15 s before they were fixed with 4% paraformaldehyde. The cells were then washed and permeabilized by 0.1% Triton X-100 at room temperature for 5 min. After washing, cells were blocked by 1% bovine serum albumin and incubated with purified GST-RBD at room temperature for 1 h followed by Alexa 633-conjugated anti-GST antibody (Molecular Probes, Inc.). After washing, cells were analyzed by a flow cytometer, and the mean fluorescence intensity (MFI) of GFP-positive populations that represent cells carrying the pAS vector was determined. The exchange activity of Arhgef5 was determine for its ability to promote the loading of N-methylanthraniloyl-GTP (Mant-GTP, from JENA Bioscience) to recombinant RhoA as previously described (45Rojas R.J. Kimple R.J. Rossman K.L. Siderovski D.P. Sondek J. Comb. Chem. High Throughput Screen. 2003; 6: 409-418Crossref PubMed Scopus (35) Google Scholar). In brief, purified RhoA (0.12 μm) was incubated in an assay buffer containing 20 mm Tris (pH 7.5), 150 mm NaCl, 5 mm MgCl2, and 1 mm dithiothreitol with 10 μm MANT-GTP and recombinant proteins of 0.85 μm Arhgef5 and/or 1 μm Gβγ. Immediately after mixing, fluorescence intensity was determined by a fluorometer (Wallac Vector, 1420 multilabel counter) with excitation wavelength of 360 nm and emission wavelength of 440 nm. HEK293T cells were seeded in 24-well culture plates and transfected with the luciferase reporter construct SRE-luc, normalization plasmid GFP, and other plasmids shown in the figures by using Lipofectamine Plus. After transfection, cells were cultured in serum-free medium for 24 h before the GFP intensity was measured by a fluorometer. The cells were then lysed, and their luciferase activities were determined by a luminometer. Data are presented after the luciferase activity was normalized against the GFP intensity. HEK293T cells were cotransfected with Gβ1γ2 and FLAG-tagged Arhgef5 or its mutants for 24 h. The cells were lysed with a lysis buffer (1% Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS, 0.15 m NaCl, 0.01 m sodium phosphate, 50 mm sodium fluoride, 2 mm EDTA, pH 7.2). Immunoprecipitation was then carried out with an anti-FLAG antibody and Protein A/G beads at 4 °C for 1 h. The immunocomplexes were subjected to Western analysis with anti-Gβ1 antibody. Total RNAs were extracted from bone marrow-derived immature and mature DCs using the TRIzol reagent (Invitrogen) according to the manufacturer's instructions. RNA was reverse-transcribed using the iScript cDNA synthesis kit (Bio-Rad). RT-PCR was performed. The sense oligo for Ephexin is GAACTGATCGCACAGTTGGA, and the antisense oligo is ATCTTCCGGACACCCTCATT. The sense oligo for Arhgef15 is ATCACTCAGCCCA-AGAGTGG, and the antisense oligo is AGATGGTGTCTGGGGAACAG. The sense oligo for Arhgef5 is TATGTCACCAACCAGACC, and the antisense oligo is ACCTGACTGATGAAGTTCCT. The migration of DCs from the skin to lymph node was determined by FITC skin painting as previously described (46Macatonia S.E. Knight S.C. Edwards A.J. Griffiths S. Fryer P. J. Exp. Med. 1987; 166: 1654-1667Crossref PubMed Scopus (522) Google Scholar). In brief, FITC (Sigma) was dissolved in a 50:50 (v/v) acetone/dibutylphthalate mixture at a concentration of 5 mg/ml. Mice were anesthetized and their abdominal fur shaved. The FITC solution (0.25 ml/animal) was applied to the shaved skin. Twenty-four hours later, inguinal lymph nodes were harvested and treated with collagenase D (1 mg/ml, Roche) for 20 min at 37 °C. The lymph nodes were then smashed onto 70 μm cell strainers to produce cell suspensions. The cells were collected and stained with PE-CD11c and analyzed by a flow cytometer. A BAC clone that contains the Arhgef5 gene was acquired from the BACPAC Resources Center at the Children's Hospital Oakland Research Institute, Oakland, CA. Exons 5–9, which encode residues Ala1153–Lys1355 in the DH domain of Arhgef5, were floxed with the LoxP sequences in the gene-targeting construct. The Arhgef5 mutant mouse line was generated at the Gene Targeting and Transgenic Facility of the University of Connecticut Health Center using the ES cell line 129S6 derived from 129SvEvTac/C57BL/6J F1 blastocysts. The chimeric mice were crossed with 129S1-Hprt1-Cre from JAX to produce germline excision of the sequences between the two LoxP sites. Finally, mice heterozygous for the disrupted Arhgef5 gene were interbred to produce homozygous mice. Animals from F1 to F3 were used in this study. Mice were sensitized by intraperitoneal injection with 200 μl of OVA-alum suspension (0.5 mg/ml ovalbumin (OVA, Sigma) in phosphate-buffered saline mixed with an equal volume of 20 mg/ml aluminum hydroxide). Eight days after immunization, mice were challenged with an aerosol of 1% FITC-OVA in phosphate-buffered saline, delivered by an ultrasonic nebulizer (OMRON, Compair) for 20 min. FITC-OVA was prepared by mixing 2 mg/ml of FITC solution in carbonate buffer (220 mm, pH 9.6) with OVA at 10 mg/ml. The mixture was gently rotated overnight at 4 °C in the dark. Unbound FITC was removed by ultrafiltration using a 10-kDa molecular mass cut-off membrane in a 15-ml filtration cell (Amicon). One day after challenge, the mice were anesthetized. Their trachea were cannulated, and their lungs lavaged five times with 1 ml of pre-chilled phosphate-buffered saline. The bronchial lymph nodes were then collected. Cells in the bronchoalveolar lavage (BAL) fluid were collected by centrifugation at 4000 × g for 5 min. Cytospin preparations of cells were stained with Diff-Quik (Dade Behring) and differentials were performed on 200 cells based on morphology and staining characteristics. The supernatant of BAL fluids were analyzed for IL-4 levels using a mouse IL-4 ELISA kit (Endogen). Lymph nodes were passed through a cell strainer (BD Falcon), and cells were counted and stained with R-phycoerythrin-CD11c (BD Pharmingen) and analyzed by a flow cytometry (Caliber, BD Biosciences). The thymidine kinase mutant HSV-2 viruses were prepared and inoculated intravaginally into Arhgef5-null and wild type littermates (1 × 106 plaque-forming units of HSV-2) as previously described (47Sato A. Iwasaki A. Proc. Natl. Acad. Sci. U.S.A. 2004; 101: 16274-16279Crossref PubMed Scopus (100) Google Scholar). Vaginal washes were collected daily, and the levels of IFN-γ and IL-12 were determined by ELISA. On day 6, mice were euthanized, and CD4+ or CD8+ T cells were isolated from iliac and inguinal lymph nodes. The T cells were co-cultured with naïve wild type splenocytes and heat-inactivated HSV-2 of varying plaque-forming units (for CD4+ T cells) or 1 μg/ml gB peptide (for CD8+ T cells) for 3 days. The levels of IFN-γ in the conditioned media were determined by ELISA. Statistical comparisons between different groups or treatments were performed by unpaired two-tailed Student's t test and p < 0.05 was considered statistically significant. To investigate the roles of Rho-GEFs in leukocyte chemotaxis, we carried out a siRNA-based functional screen for Rho-GEFs that may play a role in migration of macrophage-like Raw264.7 cells. We generated a mini vector-based shRNA library targeting 38 Rho-GEFs, whose expression could be detected by RT-PCR in RAW264.7 cells (data not shown). The shRNA vector was modified based on pSuper (23Brummelkamp T.R. Bernards R. Agami R. Science. 2002; 296: 550-553Crossref PubMed Scopus (3971) Google Scholar) by incorporating a GFP-luciferase fusion protein expression unit; thus, cells producing shRNA can be monitored by the expression of GFP and/or luciferase. This vector was named pAS. All of the GEF shRNAs were validated based their ability to knock down endogenous GEF expression detected by quantitative RT-PCR and/or coexpressed cDNAs if available (data not shown). To test the effects of these shRNAs on RAW264.7 cell migration, cells were transfected with one of the shRNAs, and the empty pAS was used as a negative control. Two days after transfection, transwell migration assays were carried out, and the migratory ability of the cells expressing a GEF shRNA was compared with that of the control cells. Of 38 GEF shRNAs we screened, 6 shRNAs showed more than 50% inhibition (Fig. 1A and supplemental Table S1). Because siRNAs are known to have off-target effects, we tried to validate the effects by constructing a second shRNA expression plasmid that has a different targeting sequence for these 6 putative hits. We successfully generated the second shRNAs for 5 of these 6 putative hits. Among these 5 shRNAs, only Arhgef5 shRNA showed more than 50% inhibition of RAW264.7 cell migration (supplemental Table S1 and Fig. 1A). To further validate siRNA specificity, we coexpressed an Arhgef5 expression plasmid together with its shRNA plasmid to determine whether effects of shRNA can be rescued. To prevent the silencing effect of the shRNA on expression of exogenous Arhgef5, we introduced silent mutations at the shRNA targeting sequence of the Arhgef5 cDNA. As shown in Fig. 1B, expression of Arhgef5 effectively rescued the effect of Arhgef5 shRNA on RAW264.7 cell migration. We also tested the effect of Arhgef5 shRNA on the migration of J774 cells; the shRNA could also effectively inhibit its migration, which could be rescued by expression of the silently mutated Arhgef5 (Fig. 1C). The efficiency of this Arhgef5 siRNA was validated as shown in Fig. 1D. Putting all of these results together, we believe that Arhgef5 may have an important role in the migration of these two myeloid cell lines. Arhgef5, as a member of the Rho-GEF superfamily, possesses a DH-PH tandem domain and a C-terminal SH3 domain. Some members of the subfamily, including Arhgef15 (24Ogita H. Kunimoto S. Kamioka Y. Sawa H. Masuda M. Mochizuki N. Circ. Res. 2003; 93: 23-31Crossref PubMed Scopus (100) Google Scholar), Ephexin-1 (25Shamah S.M. Lin M.Z. Goldberg J.L. Estrach S. Sahin M. Hu L. Bazalakova M. Neve R.L. Corfas G. Debant A. Greenberg M.E. Cell. 2001; 105: 233-244Abstract Full Text Full Text PDF PubMed Scopus (446) Google Scholar), and Arhgef5 (26Xie X. Chang S.W. Tatsumoto T. Chan A.M. Miki T. Cell Signal. 2005; 17: 461-471Crossref PubMed Scopus (28) Google Scholar), were shown to activate RhoA, whereas the other (SGEF) was shown to activate RhoG (27Ellerbroek S.M. Wennerberg K. Arthur W.T. Dunty J.M. Bowman D.R. DeMali K.A. Der C. Burridge K. Mol. Biol. Cell. 2004; 15: 3309-3319Crossref PubMed Scopus (91) Google Scholar). We tested the effects of Arhgef5 on a number of Rho small GTPases. Previous studies have shown that the RhoA-binding domain of Rhotekin (RBD) has a high affinity for a subset of GTP-bound small Rho GTPases that include RhoA, RhoB, and RhoC (28Ren X.D. Kiosses W.B. Schwartz M.A. EMBO J. 1999; 18: 578-585Crossref PubMed Scopus (1369) Google Scholar, 29Aspenström P. Fransson A. Saras J. Biochem. J. 2004; 377: 327-337Crossref PubMed Scopus (315) Google Scholar), whereas the p21-binding domain of PAK1 (PBD) has a high affinity for Rac, RhoQ, RhoD, and RhoV (29Aspenström P. Fransson A. Saras J. Biochem. J. 2004; 377: 327-337Crossref PubMed Scopus (315) Google Scholar, 30Benard V. Bohl B.P. Bokoch G.M. J. Biol. Chem. 1999; 274: 13198-13204Abstract Full Text Full Text PDF PubMed Scopus (672) Google Scholar). Active RhoG was found to be bound to Elmo (31Gumienny T.L. Brugnera E. Tosello-Trampont A.C. Kinchen J.M. Haney L.B. Nishiwaki K. Walk S.F. Nemergut M.E. Macara I.G. Francis R. Schedl T. Qin Y. Van Aelst L. Hengartner M.O. Ravichandran K.S. Cell. 2001; 107: 27-41Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). These interactions have been used to determine the levels of active small GTPases in pulldown assays (28Ren X.D. Kiosses W.B. Schwartz M.A. EMBO J. 1999; 18: 578-585Crossref PubMed Scopus (1369) Google Scholar, 29Aspenström P. Fransson A. Saras J. Biochem. J. 2004; 377: 327-337Crossref PubMed Scopus (315) Google Scholar, 30Benard V. Bohl B.P. Bokoch G.M. J. Biol. Chem. 1999; 274: 13198-13204Abstract Full Text Full Text PDF PubMed Scopus (672) Google Scholar). As shown in Fig. 2A, expression of Arhgef5, but not an Arhgef5 mutant with its DH domain mutated, led to a strong increase in the levels of active RhoA and RhoB, resulting in weak activation of RhoC and RhoG. Expression of Arhgef5 had no effect on the level of active RhoD, RhoV, RhoQ, or Rac1 (Fig. 2A). Previous studies also showed that GEFs generally exhibit high affinities for the GTP-free mutant forms of small GTPases they regulate (32Feng Q. Baird D. Cerione R.A. EMBO J. 2004; 23: 3492-3504Crossref PubMed Scopus (74) Google Scholar, 33Meller N. Irani-Tehrani M. Kiosses W.B. Del Pozo M.A. Schwartz M.A. Nat. Cell Biol. 2002; 4: 639-647Crossref PubMed Scopus (148) Google Scholar). Consistent with the pulldown assay results, Arhgef5 co-immunoprecipitated with RhoA-N19, but not RhoC-N19 or RhoD-N31 (Fig. 2B). In addition, RhoF-N33 did not show detectable interaction with Arhgef5 (Fig. 2B), suggesting that Arhgef5 may not regulate RhoF. These results indicate that Arhgef5, Ephexin-1, and Arhgef15, which are more homologous in amino acid sequences than SGEF, belong to a subgroup that potently activates RhoA rather than RhoG. Next, we wanted to assess the significance of Arhgef5 in chemoattractant-induced small GTPase activation. Because of the relative low transfection efficiency for leukocytes and the large number of cells required for the pulldown assays particularly for detection of e
Referência(s)