Heterogeneous Nucleotide Occupancy Stimulates Functionality of Phage Shock Protein F, an AAA+ Transcriptional Activator
2006; Elsevier BV; Volume: 281; Issue: 46 Linguagem: Inglês
10.1074/jbc.m606628200
ISSN1083-351X
AutoresNicolas Joly, Jörg Schumacher, Martin Buck,
Tópico(s)Endoplasmic Reticulum Stress and Disease
ResumoThe catalytic AAA+ domain (PspF1–275) of an enhancer-binding protein is necessary and sufficient to contact σ54-RNA polymerase holoenzyme (Eσ54), remodel it, and in so doing catalyze open promoter complex formation. Whether ATP binding and hydrolysis is coordinated between subunits of PspF and the precise nature of the nucleotide(s) bound to the oligomeric forms responsible for substrate remodeling are unknown. We demonstrate that ADP stimulates the intrinsic ATPase activity of PspF1–275 and propose that this heterogeneous nucleotide occupancy in a PspF1–275 hexamer is functionally important for specific activity. Binding of ADP and ATP triggers the formation of functional PspF1–275 hexamers as shown by a gain of specific activity. Furthermore, ATP concentrations congruent with stoichiometric ATP binding to PspF1–275 inhibit ATP hydrolysis and Eσ54-promoter open complex formation. Demonstration of a heterogeneous nucleotide-bound state of a functional PspF1–275·Eσ54 complex provides clear biochemical evidence for heterogeneous nucleotide occupancy in this AAA+ protein. Based on our data, we propose a stochastic nucleotide binding and a coordinated hydrolysis mechanism in PspF1–275 hexamers. The catalytic AAA+ domain (PspF1–275) of an enhancer-binding protein is necessary and sufficient to contact σ54-RNA polymerase holoenzyme (Eσ54), remodel it, and in so doing catalyze open promoter complex formation. Whether ATP binding and hydrolysis is coordinated between subunits of PspF and the precise nature of the nucleotide(s) bound to the oligomeric forms responsible for substrate remodeling are unknown. We demonstrate that ADP stimulates the intrinsic ATPase activity of PspF1–275 and propose that this heterogeneous nucleotide occupancy in a PspF1–275 hexamer is functionally important for specific activity. Binding of ADP and ATP triggers the formation of functional PspF1–275 hexamers as shown by a gain of specific activity. Furthermore, ATP concentrations congruent with stoichiometric ATP binding to PspF1–275 inhibit ATP hydrolysis and Eσ54-promoter open complex formation. Demonstration of a heterogeneous nucleotide-bound state of a functional PspF1–275·Eσ54 complex provides clear biochemical evidence for heterogeneous nucleotide occupancy in this AAA+ protein. Based on our data, we propose a stochastic nucleotide binding and a coordinated hydrolysis mechanism in PspF1–275 hexamers. The members of the functionally versatile AAA+ (ATPases associated with various cellular activities) 3The abbreviations used are: AAA+ proteins, ATPases associated with various cellular activities; EBP, enhancer-binding protein; Eσ54, σ54-RNA polymerase holoenzyme; ITC, isothermal titration calorimetry; PspF, phage shock protein F; ATPγS, adenosine 5′-O-(thiotriphosphate); AMPPNP, adenosine 5′-(β,γ-imido)triphosphate. 3The abbreviations used are: AAA+ proteins, ATPases associated with various cellular activities; EBP, enhancer-binding protein; Eσ54, σ54-RNA polymerase holoenzyme; ITC, isothermal titration calorimetry; PspF, phage shock protein F; ATPγS, adenosine 5′-O-(thiotriphosphate); AMPPNP, adenosine 5′-(β,γ-imido)triphosphate. protein family are found in all kingdoms of life. Activities include cell division, cell differentiation, and transcription activation (1Hanson P.I. Whiteheart S.W. Nat. Rev. Mol. Cell Biol. 2005; 6: 519-529Crossref PubMed Scopus (879) Google Scholar, 2Dougan D.A. Mogk A. Zeth K. Turgay K. Bukau B. FEBS Lett. 2002; 529: 6-10Crossref PubMed Scopus (179) Google Scholar, 3Lupas A.N. Martin J. Curr. Opin. Struct. Biol. 2002; 12: 746-753Crossref PubMed Scopus (295) Google Scholar, 4Zhang X. Chaney M. Wigneshweraraj S.R. Schumacher J. Bordes P. Cannon W. Buck M. Mol. Microbiol. 2002; 45: 895-903Crossref PubMed Scopus (136) Google Scholar). AAA+ proteins share Walker A (consensus sequence GXXXXGK (Thr/Ser)) and Walker B (consensus sequence HHHHDE, where H represents hydrophobic amino acids) motifs that are involved in ATP binding and hydrolysis, respectively, and a second region of homology (5Ogura T. Wilkinson A.J. Genes Cells. 2001; 6: 575-597Crossref PubMed Scopus (826) Google Scholar, 6Patel S. Latterich M. Trends Cell Biol. 1998; 8: 65-71Crossref PubMed Google Scholar). Usually, AAA+ proteins form hexameric rings in their active conformation, often assembled from inactive dimers (7Beuron F. Flynn T.C. Ma J. Kondo H. Zhang X. Freemont P.S. J. Mol. Biol. 2003; 327: 619-629Crossref PubMed Scopus (90) Google Scholar, 8DeLaBarre B. Brunger A.T. Nat. Struct. Biol. 2003; 10: 856-863Crossref PubMed Scopus (312) Google Scholar, 9Krzywda S. Brzozowski A.M. Verma C. Karata K. Ogura T. Wilkinson A.J. Structure. 2002; 10: 1073-1083Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). The nucleotide binding sites of AAA+ proteins lie at the interface between subunits permitting determinants from adjacent subunits to contribute to nucleotide hydrolysis. The energy derived from NTP hydrolysis is usually coupled to substrate remodeling and functional output (6Patel S. Latterich M. Trends Cell Biol. 1998; 8: 65-71Crossref PubMed Google Scholar).In AAA+ proteins the more general unresolved question is if and how nucleotide binding and hydrolysis are coordinated within hexameric AAA+ ring structures for their biological output. Founded on studies of the nucleotide occupancy, two basic models may serve to distinguish how AAA+ molecular machines function (10Ades S.E. Curr. Biol. 2006; 16: 46-48Abstract Full Text Full Text PDF PubMed Scopus (8) Google Scholar). The homogeneous nucleotide occupancy observed in a large number of AAA+ crystal structures (11Lenzen C.U. Steinmann D. Whiteheart S.W. Weis W.I. Cell. 1998; 94: 525-536Abstract Full Text Full Text PDF PubMed Scopus (287) Google Scholar, 12Zhang X. Shaw A. Bates P.A. Newman R.H. Gowen B. Orlova E. Gorman M.A. Kondo H. Dokurno P. Lally J. Leonard G. Meyer H. van Heel M. Freemont P.S. Mol. Cell. 2000; 6: 1473-1484Abstract Full Text Full Text PDF PubMed Scopus (377) Google Scholar, 13Gai D. Zhao R. Li D. Finkielstein C.V. Chen X.S. Cell. 2004; 119: 47-60Abstract Full Text Full Text PDF PubMed Scopus (261) Google Scholar) supports a concerted ATP hydrolysis cycle, where all subunits hydrolyze ATP simultaneously. Other structures showed sub-stoichiometric and mixed nucleotide occupancy within the hexameric ring (14Bochtler M. Hartmann C. Song H.K. Bourenkov G.P. Bartunik H.D. Huber R. Nature. 2000; 403: 800-805Crossref PubMed Scopus (376) Google Scholar, 15Wang J. Song J.J. Seong I.S. Franklin M.C. Kamtekar S. Eom S.H. Chung C.H. Structure. 2001; 9: 1107-1116Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar), which supports either a sequential or a rotational hydrolysis mechanism where heterogeneous nucleotide occupancy is coordinated between subunits.One subfamily of AAA+ proteins, the enhancer-binding proteins (EBPs), also termed σ54 activators, activate bacterial genes transcribed from σ54-dependent promoters (for review, see Refs. 16Studholme D.J. Dixon R. J. Bacteriol. 2003; 185: 1757-1767Crossref PubMed Scopus (236) Google Scholar and 17Wigneshweraraj S.R. Burrows P.C. Bordes P. Schumacher J. Rappas M. Finn R.D. Cannon W.V. Zhang X. Buck M. Prog. Nucleic Acid Res. Mol. Biol. 2005; 79: 339-369Crossref PubMed Scopus (32) Google Scholar)). ATP hydrolysis by the AAA+ domain of EBPs is used to isomerize the Eσ54-closed promoter complex to a transcriptional competent open complex (17Wigneshweraraj S.R. Burrows P.C. Bordes P. Schumacher J. Rappas M. Finn R.D. Cannon W.V. Zhang X. Buck M. Prog. Nucleic Acid Res. Mol. Biol. 2005; 79: 339-369Crossref PubMed Scopus (32) Google Scholar, 18Cannon W.V. Gallegos M.T. Buck M. Nat. Struct. Biol. 2000; 7: 594-601Crossref PubMed Scopus (92) Google Scholar).One well studied example of EBPs, PspF (phage shock protein F), from Escherichia coli comprises (i) a catalytic AAA+ domain (PspF1–275), which is (as for a number of EBPs) sufficient to activate transcription of σ54-dependent promoters in vivo and in vitro (19Berger D.K. Narberhaus F. Lee H.S. Kustu S. J. Bacteriol. 1995; 177: 191-199Crossref PubMed Google Scholar, 20Jovanovic G. Rakonjac J. Model P. J. Mol. Biol. 1999; 285: 469-483Crossref PubMed Scopus (66) Google Scholar, 21Wikstrom P. O'Neill E. Ng L.C. Shingler V. J. Mol. Biol. 2001; 314: 971-984Crossref PubMed Scopus (46) Google Scholar, 22Xu H. Gu B. Nixon B.T. Hoover T.R. J. Bacteriol. 2004; 186: 3499-3507Crossref PubMed Scopus (26) Google Scholar), and (ii) a C-terminal helix-turn-helix domain, which binds upstream activator sequences) (20Jovanovic G. Rakonjac J. Model P. J. Mol. Biol. 1999; 285: 469-483Crossref PubMed Scopus (66) Google Scholar, 23Pelton J.G. Kustu S. Wemmer D.E. J. Mol. Biol. 1999; 292: 1095-1110Crossref PubMed Scopus (66) Google Scholar, 24Sallai L. Tucker P.A. J. Struct. Biol. 2005; 151: 160-170Crossref PubMed Scopus (53) Google Scholar, 25Xu H. Hoover T.R. Curr. Opin. Microbiol. 2001; 4: 138-144Crossref PubMed Scopus (98) Google Scholar). For EBPs XylR (26Perez-Martin J. de Lorenzo V. Cell. 1996; 86: 331-339Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar) and NtrC (27Klose K.E. North A.K. Stedman K.M. Kustu S. J. Mol. Biol. 1994; 241: 233-245Crossref PubMed Scopus (57) Google Scholar), the helix-turn-helix domain when bound to their respective upstream activator sequences aid high order oligomer formation in combination with nucleotides. The Eσ54 transcriptional activator PspF activates transcription of Psp regulon genes from pspA-E and pspG promoters and is negatively regulated by PspA (28Elderkin S. Jones S. Schumacher J. Studholme D. Buck M. J. Mol. Biol. 2002; 320: 23-37Crossref PubMed Scopus (92) Google Scholar, 29Lloyd L.J. Jones S.E. Jovanovic G. Gyaneshwar P. Rolfe M.D. Thompson A. Hinton J.C. Buck M. J. Biol. Chem. 2004; 279: 55707-55714Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar) (for review, see Ref. 30Darwin A.J. Mol. Microbiol. 2005; 57: 621-628Crossref PubMed Scopus (222) Google Scholar).Chaney et al. (31Chaney M. Grande R. Wigneshweraraj S.R. Cannon W. Casaz P. Gallegos M.T. Schumacher J. Jones S. Elderkin S. Dago A.E. Morett E. Buck M. Genes Dev. 2001; 15: 2282-2294Crossref PubMed Scopus (111) Google Scholar) showed that PspF1–275 with ATP hydrolysis transition state analogue ADP-AlFx (non-hydrolyzable) forms stable hexamers that efficiently engage with σ54 or Eσ54. Bordes et al. (32Bordes P. Wigneshweraraj S.R. Schumacher J. Zhang X. Chaney M. Buck M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 2278-2283Crossref PubMed Scopus (78) Google Scholar) provided evidence that the consensus GAFTGA loop motif in PspF1–275 was responsible for this binding interaction with σ54. The ADP·AlFx·PspF1–275·Eσ54 trap complex appears to be an intermediate en route for open complex formation. However, the ADP·AlFx·PspF1–275·Eσ54promoter complex cannot isomerize to an open complex (4Zhang X. Chaney M. Wigneshweraraj S.R. Schumacher J. Bordes P. Cannon W. Buck M. Mol. Microbiol. 2002; 45: 895-903Crossref PubMed Scopus (136) Google Scholar, 31Chaney M. Grande R. Wigneshweraraj S.R. Cannon W. Casaz P. Gallegos M.T. Schumacher J. Jones S. Elderkin S. Dago A.E. Morett E. Buck M. Genes Dev. 2001; 15: 2282-2294Crossref PubMed Scopus (111) Google Scholar, 33Burrows P.C. Severinov K. Buck M. Wigneshweraraj S.R. EMBO J. 2004; 23: 4253-4263Crossref PubMed Scopus (33) Google Scholar, 34Cannon W.V. Schumacher J. Buck M. Nucleic Acids Res. 2004; 32: 4596-4608Crossref PubMed Scopus (14) Google Scholar, 35Wigneshweraraj S.R. Burrows P.C. Severinov K. Buck M. J. Biol. Chem. 2005; 280: 36176-36184Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar). Recent structural studies of a ADP·AlFx·PspF1–275·σ54 complex revealed that the connecting densities between a hexameric PspF1–275 and σ54 critically involve some but not all of the GAFTGA loops from some but not all AAA+ domains, suggesting an asymmetrical structure (36Rappas M. Schumacher J. Beuron F. Niwa H. Bordes P. Wigneshweraraj S. Keetch C.A. Robinson C.V. Buck M. Zhang X. Science. 2005; 307: 1972-1975Crossref PubMed Scopus (139) Google Scholar). A model based on the crystal structures of PspF1–275 soaked with different nucleotides suggested a molecular mechanism within a PspF subunit by which ATP binding and hydrolysis could coordinate movements of the GAFTGA loop (37Rappas M. Schumacher J. Niwa H. Buck M. Zhang X. J. Mol. Biol. 2006; 357: 481-492Crossref PubMed Scopus (73) Google Scholar). How and if movements between PspF1–275 subunits are coordinated throughout nucleotide binding and hydrolysis to orchestrate a sequential multistep structural remodeling of Eσ54-closed promoter complex is unclear.We now report biochemical data to address relationships between nucleotide occupancy and functionality of PspF1–275. We determined the relative affinity for different nucleotides and observed only modest cooperative binding of ATP and ADP to PspF1–275. We show by gel filtration that PspF1–275 is in equilibrium between different oligomeric states and that either ATP or ADP binding shifts this equilibrium toward higher order oligomers, most probably hexamers. Strikingly, we found that physiological ADP concentrations stimulate the intrinsic ATPase rates of oligomeric PspF1–275, suggesting that heterogeneous nucleotide occupancy could play a functional role in the catalytic function of this AAA+ protein. Further support for mixed nucleotide binding comes from our finding that ATP at concentrations above those found in E. coli and where ATP possibly occupies all the binding sites in the PspF1–275 oligomer inhibit ATP hydrolysis and transcriptional activation. Heterogeneous nucleotide occupancy is also evident in the functionally significant ADP·AlFx·PspF1–275·Eσ54 complex. Simultaneous binding of ADP and ATP within a PspF1–275 hexamer clearly increases functionality at physiological nucleotide concentrations. Our data support probabilistic nucleotide binding in PspF1–275 hexamers with a coordinated nucleotide hydrolysis mechanism. We propose that the mechanical actions used for making open promoter complexes arise from asymmetric forms of PspF1–275 created by differential nucleotide bound states of protomers within a hexamer.EXPERIMENTAL PROCEDURESNucleotides—ATP, ADP, AMPPNP, and ATPγS were from Sigma and are at the highest purity level available. Radiolabeled nucleotides were from Amersham Biosciences. Fluorescent DNA probes and oligonucleotides were from Sigma Genosys: WVC7, gaaagaaagccgagtagttttatttcagacggctggcacgacttttgcactcgactaaaggggcgcgcatgctgttgcgcattcatgt; WVC3 HEX, catgaatgcgcaacagcatgcgcgcccagggctgatcgtgcaaaagtcgtgccagccgtctgaaataaaactactcggctttctttc, labeled at 5′.PspF1–275-wild type, -K42A, -D107A, and -R168A Plasmids— Plasmid pPB1 encodes E. coli PspF1–275 with an N-terminal His6 tag in pET28b (32Bordes P. Wigneshweraraj S.R. Schumacher J. Zhang X. Chaney M. Buck M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 2278-2283Crossref PubMed Scopus (78) Google Scholar). Variants of PspF1–275 were generated from plasmid pPB1 mutagenized to yield pPB1-K42A, pPB1-D107A, and pPB1-R168A (38Schumacher J. Zhang X. Jones S. Bordes P. Buck M. J. Mol. Biol. 2004; 338: 863-875Crossref PubMed Scopus (65) Google Scholar).Protein Purification—PspF1–275-wild type, -K42A, -D107A, and -R168A were purified as described in Bordes et al. (32Bordes P. Wigneshweraraj S.R. Schumacher J. Zhang X. Chaney M. Buck M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 2278-2283Crossref PubMed Scopus (78) Google Scholar) from, respectively, pPB1, pPB1-K42A, pPB1-D107A, and pPB1-R168A, respectively. Briefly, 1 liter of LB media was inoculated with an overnight culture (2% v/v) and grown at 37 °C until an A600 nm of 0.4–0.6. After down-shift of temperature to 25 °C, the protein production was induced with 1 mm final concentration of isopropyl thio-β-d-galactoside for 3 h. After centrifugation, cells were resuspended in buffer A (25 mm sodium phosphate buffer, pH 7.0, 50 mm NaCl, and 5% glycerol) and broken by sonication. The supernatant was loaded onto a 5-ml HiTrap™ chelating high performance column (Amersham Biosciences) precharged with nickel and purified as described in Bordes et al. (32Bordes P. Wigneshweraraj S.R. Schumacher J. Zhang X. Chaney M. Buck M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 2278-2283Crossref PubMed Scopus (78) Google Scholar). The His tag was removed by thrombin cleavage for 3 h at 23°C. Finally the protein was dialyzed overnight at 4 °C against final storage buffer (20 mm Tris-HCl, pH 8.0, 50 mm NaCl, 1 mm dithiothreitol, 0.1 mm EDTA, and 5% glycerol) and frozen at –80 °C. σ54 was purified as described (18Cannon W.V. Gallegos M.T. Buck M. Nat. Struct. Biol. 2000; 7: 594-601Crossref PubMed Scopus (92) Google Scholar). RNA polymerase core enzyme from E. coli was purchased from Epicenter.ATPase Activity—ATPase activity assays were performed in a 10-μl final volume in buffer containing final concentrations of 35 mm Tris acetate, pH 8.0, 70 mm potassium acetate, 15 mm magnesium acetate, 19 mm ammonium acetate, 0.7 mm dithiothreitol, and different concentrations of PspF1–275. The mix was preincubated at 23 °C for 10 min, and the reaction was started by adding 3 μl of an ATP solution containing 0.6 μCi/μl of [α-32P]ATP (3000 Ci/mmol) plus different concentrations of ATP, ADP, AMPPNP, or AMP and incubated for different times at 23 °C. In the case of ADP, AMPPNP, or AMP competition, a fixed concentration of substrate ATP (1 μm) was chosen to minimize the contribution of ATP from [α-32P] ATP. Reactions were stopped by adding 5 volumes of 2 m formic acid. [α-32P]ADP was separated from ATP by thin-layer chromatography, and radiolabeled ADP and ATP were measured by phosphorimaging (Fuji Bas-1500) and analyzed using the Aida software. Activity is expressed in turnover per minute. Reactions were stopped when around 20% of total ATP was hydrolyzed to keep the same proportion of ADP present in all reactions. The fitting curves were obtained by using the automatic sigmoidal fitting equation on Origin 7.0 software (OriginLab Corp.). All experiments were done at least in triplicate independently and gave the same results. In addition we established (data not shown) that the rate of ATP hydrolysis was linear under assay conditions.Isothermal Titration Calorimetry (ITC)—ITC experiments were conducted using a MicroCal VP isothermal titration calorimeter. PspF1–275 was dialyzed overnight at 4 °C immediately before use in 20 mm Tris-HCl, pH 8.0, 50 mm NaCl, 10 mm MgCl2. After degassing each sample under vacuum, each nucleotide solution (in dialysis buffer) containing ATPγS, ADP, or AMPPNP (8 mm) was titrated into the protein solution (99 μm) in 70 injections of 4 μl (300 s). Raw data for 70 injections at 37 °C were obtained by using the MicroCal VP-VIEWER software. Control titrations of nucleotide into dialysis buffer demonstrated that there was no significant heat of dilution or injection for any of the tested nucleotides (data not shown). ITC data were corrected for heats of injection of nucleotide solution. Binding stoichiometry, enthalpy, entropy and binding constants were determined by fitting the corrected data to a one site binding model. The ITC data were fitted using Origin 7.0 (OriginLab Corp.). All titration were performed at least twice independently. The resultant fitting value was exactly the same.ADP-AlF Trapping—ADP-AlFx trapping experiments were performed in a 10-μl volume with final concentrations of 10 mm Tris acetate, pH 8.0, 50 mm potassium acetate, 8 mm magnesium acetate, 0.1 mm dithiothreitol, 5 mm NaF, and different concentrations of PspF1–275 +/– σ54 +/– RNA polymerase core enzyme. The mix was then preincubated at 23 °C for 10 min, and the reaction was started by the addition of 1 μl of mix nucleotide containing 4 mm concentrations of either ADP or ATP or AMPPNP. For radiolabeled trapping experiments, this mix contained 4 mm ATP with either 20 μCi of [α-32P]ATP (3000 Ci/mmol) or 20 μCi of [γ-32P]ATP (3000 Ci/mmol). AlCl3 (0.4 mm, final concentration) was then added, and the reaction was incubated for 5 min at 23 °C. After adding of 2 μl of loading buffer (50% glycerol, bromphenol blue), all of the sample was loaded onto native 4.5% polyacrylamide gel (acrylamide/bisacrylamide, 37.5:1) and run in 25 mm Tris, pH 8.3, + 192 mm glycine (TG buffer). Proteins were detected by Coomassie Blue straining, and radioactivity was measured by phosphorimaging (Fuji Bas-1500) and analyzed using the Aida software.Gel Filtration through Superdex 200—PspF1–275 wild type or R168A (at different concentrations) were incubated for 3 min at 4 °C in buffer containing 20 mm Tris-HCl, pH 8.0, 50 mm NaCl, and 15 mm MgCl2 +/– 1 mm ATP or ADP where indicated. Samples (50 μl) were then injected onto a Superdex 200 column (10 × 300 mm, 24 ml) (Amersham Biosciences) installed on an AKTA system (Amersham Biosciences) and equilibrated with the sample buffer. Chromatography was performed at 4 °C at a flow rate of 0.5 ml·min–1, and columns were calibrated with globular proteins: apoferritin (443 kDa), alcohol dehydrogenase (150 kDa), bovine serum albumin (66 kDa), and carbonic anhydrase (29 kDa).Native Gel Complex Formation Assays—Heparin challenge experiments were performed in a 10-μl reaction volume with final concentrations of 10 mm Tris acetate, pH 8.0, 50 mm potassium acetate, 8 mm magnesium acetate, 0.1 mm dithiothreitol, 0.3 μm RNA polymerase, 0.3 μm σ54, 0.2 μm fluorescent-labeled DNA heteroduplex (HEX-labeled) assembled from purified oligonucleotides WVC7/WVC3HEX, 2 μm PspF1–275, and varying concentrations of ATP. The mix was preincubated at room temperature for 10 min, and reactions were then started by the addition of 1 μl of ATP solution at different concentrations and incubated for 1 min at 23 °C; 2 μl of a stop mix containing heparin (1 mg/ml) in loading buffer were then added to the reaction mixture. The competitor challenging reaction was performed for 2 min at 23 °C, and all samples were loaded onto a running (to further stop the reaction) native 4.5% polyacrylamide gel (acrylamide/bisacrylamide 37.5/1) and run in 1× TG buffer. Fluorescence was directly scanned by fluoroimaging (Fuji Bas-1500) and analyzed using the Aida software.RESULTSPspF1–275 Has Low Binding Affinity for Nucleotides—Nucleoside triphosphate binding has been shown to promote oligomer assembly and/or substrate binding in a number of AAA+ proteins (39Mitchell A.H. West S.C. J. Mol. Biol. 1994; 243: 208-215Crossref PubMed Scopus (63) Google Scholar, 40Hersch G.L. Burton R.E. Bolon D.N. Baker T.A. Sauer R.T. Cell. 2005; 121: 1017-1027Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar, 41Schumacher J. Joly N. Rappas M. Zhang X. Buck M. J. Struct. Biol. 2006; (in press)PubMed Google Scholar). For some AAA+ proteins, using ITC, ADP and ATPγS dissociation constants (KD) have been reported in the low μm range (see Ref. 8DeLaBarre B. Brunger A.T. Nat. Struct. Biol. 2003; 10: 856-863Crossref PubMed Scopus (312) Google Scholar for p97 and Ref. 42Kazmirski S.L. Podobnik M. Weitze T.F. O'Donnell M. Kuriyan J. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 16750-16755Crossref PubMed Scopus (51) Google Scholar for replication factor C). A much higher KD (90 μm) for ATPγS was reported for the EBP NtrC (43Rombel I. Peters-Wendisch P. Mesecar A. Thorgeirsson T. Shin Y.K. Kustu S. J. Bacteriol. 1999; 181: 4628-4638Crossref PubMed Google Scholar). A high KD for EBP would agree with the proposed high nucleotide off-rate for ATP (41Schumacher J. Joly N. Rappas M. Zhang X. Buck M. J. Struct. Biol. 2006; (in press)PubMed Google Scholar, 43Rombel I. Peters-Wendisch P. Mesecar A. Thorgeirsson T. Shin Y.K. Kustu S. J. Bacteriol. 1999; 181: 4628-4638Crossref PubMed Google Scholar). We have used ITC to determine the affinity constant of different nucleotides for PspF1–275 in the presence of magnesium at 37 °C (Fig. 1). We have determined a KD of 34 μm for ATPγS with a Hill constant of 1.33 (Fig. 1A). The KD for ADP was 118 μm with a Hill constant of 1.33 (Fig. 1B), indicating that nucleotide binding sites of PspF1–275 within the oligomer have a very low cooperativity for binding ATPγS or ADP. Schumacher et al. (38Schumacher J. Zhang X. Jones S. Bordes P. Buck M. J. Mol. Biol. 2004; 338: 863-875Crossref PubMed Scopus (65) Google Scholar) showed a 50% loss of PspF1–275 ATPase activity in the presence of a 3 ADP to 1 ATP ratio, in agreement with 3-fold higher affinity for ATP compared with ADP. The 3-fold higher KD for ADP compared with ATPγS suggests that affinities for ATPγS and ATP are similar. Taken together, these results show that the affinity of EBPs for ADP and ATP are significantly lower than those reported for several other AAA+ proteins. This would explain why we could not obtained faithful heat readings in ITC experiments at low nucleotide concentrations (molar ratio <1). Therefore, we did not determine stoichiometry constants for these nucleotides. We tested AMP binding to PspF1–275 using ITC. No change in energy could be detected, suggesting that PspF1–275 has a very low affinity for AMP. This is consistent with results from AMP competition experiments in ATPase assays with PspF1–275, where a 100,000-fold excess of AMP over ATP was required to partly inhibit ATP hydrolysis (data not shown).The PspF1–275 Catalytic AAA+ Domain Forms an Apohexamer—AAA+ proteins usually function as hexameric ring assemblies (for review, see Ref. 4Zhang X. Chaney M. Wigneshweraraj S.R. Schumacher J. Bordes P. Cannon W. Buck M. Mol. Microbiol. 2002; 45: 895-903Crossref PubMed Scopus (136) Google Scholar). ATP binding is thought to promote hexamer assembly from lower oligomers (39Mitchell A.H. West S.C. J. Mol. Biol. 1994; 243: 208-215Crossref PubMed Scopus (63) Google Scholar), but hexamer formation using a physiologically relevant ATP concentration has not been demonstrated for any EBP, probably due to the high off-rate for ATP (see above) and/or turnover (turnover around 23 min–1; see below). High order oligomer formation from PspF1–275 lower-order oligomers was suggested by the strong concentration-dependent ATPase activity of PspF1–275. To date the only nucleotide reported to lead to stable PspF1–275 hexamer formation is ADP-AlFx, a non-hydrolyzable ATP hydrolysis transition state mimic used in nucleotide saturating conditions (31Chaney M. Grande R. Wigneshweraraj S.R. Cannon W. Casaz P. Gallegos M.T. Schumacher J. Jones S. Elderkin S. Dago A.E. Morett E. Buck M. Genes Dev. 2001; 15: 2282-2294Crossref PubMed Scopus (111) Google Scholar, 37Rappas M. Schumacher J. Niwa H. Buck M. Zhang X. J. Mol. Biol. 2006; 357: 481-492Crossref PubMed Scopus (73) Google Scholar).We performed gel filtration experiments to detect different discrete oligomeric states of PspF1–275 (Fig. 2). At low concentrations of PspF1–275 (9 μm) the major form of PspF1–275 elutes at 13.76 ml, which corresponds, based on reference elution volumes obtain for different protein standards (Fig. 2A), to an elution volume expected for an apparent dimer of PspF1–275 (66 kDa). At increasing concentrations of PspF1–275, the apparent number of PspF1–275 monomers (33 kDa) present in the major complex increases from 2 (66 kDa) to a maximum of 6 (198 kDa) (Fig. 2B).FIGURE 2PspF1–275 filtration through a Superdex 200 column. A, calibration of the Superdex 200 filtration column. Standard globular proteins were filtered at 4 °C. Samples containing different concentrations of PspF1–275 were chromatographed at 4 °C (B) or preincubated with 1 mm ATP and chromatographed in the presence of 1 mm ATP at 4 °C (C) or 1 mm ADP and chromatographed in the presence of 1 mm ADP at 4 °C (D). The scale bars in B–D give the scale of the ordinate axis; absorption units (AU) correspond to an A280 of 1. WT, wild type.View Large Image Figure ViewerDownload Hi-res image Download (PPT)ATP or ADP Favors Hexamer Formation—To examine the effect of physiologically occurring ATP concentrations on oligomer formation, we performed gel filtration experiments using a column pre-equilibrated with 1 mm ATP at 4 °C. In the presence of ATP, PspF1–275 elutes as an apparent octamer (264 kDa) independently of its concentration (Fig. 2C), demonstrating that ATP promotes and stabilizes a limited high-order oligomer form of PspF1–275. PspF1–275-R168A, a protein that forms constitutive hexameric rings in the absence of nucleotide (deduced from electron microscopy, negative staining) and whose crystal structure is almost indistinguishable from the reported hexameric structure of PspF1–275 (36Rappas M. Schumacher J. Beuron F. Niwa H. Bordes P. Wigneshweraraj S. Keetch C.A. Robinson C.V. Buck M. Zhang X. Science. 2005; 307: 1972-1975Crossref PubMed Scopus (139) Google Scholar, 38Schumacher J. Zhang X. Jones S. Bordes P. Buck M. J. Mol. Biol. 2004; 338: 863-875Crossref PubMed Scopus (65) Google Scholar, 41Schumacher J. Joly N. Rappas M. Zhang X. Buck M. J. Struct. Biol. 2006; (in press)PubMed Google Scholar), also elutes as an apparent octamer (264 kDa) in gel filtration (data not shown). Furthermore, Rappas et al. (36Rappas M. Schumacher J. Beuron F. Niwa H. Bordes P. Wigneshweraraj S. Keetch C.A. Robinson C.V. Buck M. Zhang X. Science. 2005; 307: 1972-1975Crossref PubMed Scopus (139) Google Scholar) have established by nanoelectrospray mass spectroscopy that there are six PspF1–275 monomers and one σ54 in the ADP·AlFx· PspF1–275·σ54 complex. This 252-kDa complex elutes with an apparent size of 351 kDa (data not shown). Nucleotide-dependent hexamer assembly has also been shown for the EBP NtrC (44De Carlo S. Chen B. Hoover T.R. Kondrashkina E. Nogales E. Nixon B.T. Genes Dev. 2006; 20: 1485-1495Crossref PubMed Scopus
Referência(s)