Role of Plasmacytoid Dendritic Cells for Aberrant Class II Expression in Exocrine Glands from Estrogen-Deficient Mice of Healthy Background
2009; Elsevier BV; Volume: 174; Issue: 5 Linguagem: Inglês
10.2353/ajpath.2009.080695
ISSN1525-2191
AutoresRieko Arakaki, Ai Nagaoka, Naozumi Ishimaru, Akiko Yamada, Satoko Yoshida, Yoshio Hayashi,
Tópico(s)Immune Cell Function and Interaction
ResumoAlthough it has been well documented that aberrant major histocompatibility complex class II molecules may contribute to the development of autoimmune disorders, the precise mechanisms responsible for their tissue-specific expression remain unknown. Here we show that estrogen deficiency induces aberrant class II major histocompatibility complex expression in exocrine glands via interactions between epithelial cells and plasmacytoid dendritic cells. Relatively modest but functionally significant expression levels of major histocompatibility complex class II and class II transactivator molecules were observed in the exocrine glands of ovariectomized (Ovx) C57BL/6 (B6) mice, but were not seen in the exocrine glands of control B6 mice. We observed that the salivary dendritic cells adjacent to the apoptotic epithelial cells positive for terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling, were activated in Ovx mice, but were not activated in control mice. We obtained evidence that the salivary gland cells express both interferon regulatory factor-1 and class II transactivator type IV molecules in Ovx mice. Salivary gland cells from Ovx mice were also capable of inducing the activation of antigen-specific T cells from OT-II transgenic mice. These findings indicate that estrogen deficiency initiates class II transactivator type IV mRNA expression in exocrine glands via interactions between epithelial cells and plasmacytoid dendritic cells, suggesting that plasmacytoid dendritic cells play a pivotal role in gender-based autoimmune disorders in postmenopausal women. Although it has been well documented that aberrant major histocompatibility complex class II molecules may contribute to the development of autoimmune disorders, the precise mechanisms responsible for their tissue-specific expression remain unknown. Here we show that estrogen deficiency induces aberrant class II major histocompatibility complex expression in exocrine glands via interactions between epithelial cells and plasmacytoid dendritic cells. Relatively modest but functionally significant expression levels of major histocompatibility complex class II and class II transactivator molecules were observed in the exocrine glands of ovariectomized (Ovx) C57BL/6 (B6) mice, but were not seen in the exocrine glands of control B6 mice. We observed that the salivary dendritic cells adjacent to the apoptotic epithelial cells positive for terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling, were activated in Ovx mice, but were not activated in control mice. We obtained evidence that the salivary gland cells express both interferon regulatory factor-1 and class II transactivator type IV molecules in Ovx mice. Salivary gland cells from Ovx mice were also capable of inducing the activation of antigen-specific T cells from OT-II transgenic mice. These findings indicate that estrogen deficiency initiates class II transactivator type IV mRNA expression in exocrine glands via interactions between epithelial cells and plasmacytoid dendritic cells, suggesting that plasmacytoid dendritic cells play a pivotal role in gender-based autoimmune disorders in postmenopausal women. Major histocompatibility complex (MHC) class II molecules are crucial for restricting immune reactivity to self versus foreign antigens during thymic education, and their expression level is essential for determining T cell activation in the periphery.1Jones EY Fugger L Strominger JL Siebold C MHC class II proteins and disease: a structural perspective.Nat Rev Immunol. 2006; 4: 271-282Crossref Scopus (301) Google Scholar, 2Nicholson MJ Hahn M Wucherpfennig KW Unusual features of self-peptide/MHC binding by autoimmune T cell receptors.Immunity. 2005; 23: 351-360Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 3Watts C The exogenous pathway for antigen presentation on major histocompatibility complex class II and CD1 molecules.Nat Immunol. 2004; 7: 685-692Crossref Scopus (200) Google Scholar MHC class II molecules are basically expressed on antigen (Ag)-presenting cells of the hematopoietic lineage, but can be induced by unknown stimuli on many other cell types (such as endothelial cells, hepatocytes, pancreatic β-cells, thyrocytes, and salivary gland cells) in association with autoimmunity.4Müller-Hilke B Mitchison NA The role of HLA promoters in autoimmunity.Curr Pharm Des. 2006; 12: 3743-3752Crossref PubMed Scopus (28) Google Scholar, 5Mandik-Nayak L Allen PM Initiation of an autoimmune response: insights from a transgenic model of rheumatoid arthritis.Immunol Res. 2005; 32: 5-13Crossref PubMed Google Scholar, 6Nepom GT Kwok WW Molecular basis for HLA-DQ associations with IDDM.Diabetes. 1998; 47: 1177-1184Crossref PubMed Scopus (135) Google Scholar, 7Caturegli P Kimura H Rocchi R Rose NR Autoimmune thyroid diseases.Curr Opin Rheumatol. 2007; 19: 44-48Crossref PubMed Scopus (124) Google Scholar, 8Stratmann T Apostolopoulos V Mallet-Designe V Corper AL Scott CA Wilson IA Kang AS Teyton L The I-Ag7 MHC class II molecule linked to murine diabetes is a promiscuous peptide binder.J Immunol. 2000; 165: 3214-3225PubMed Google Scholar, 9van der Helm-van Mil AH Wesoly JZ Huizinga TW Understanding the genetic contribution to rheumatoid arthritis.Curr Opin Rheumatol. 2005; 17: 299-304Crossref PubMed Scopus (83) Google Scholar, 10Fox RI Stem M Michelson P Update in Sjogren's syndrome.Curr Opin Rheumatol. 2000; 12: 391-398Crossref PubMed Scopus (231) Google Scholar MHC class II proteins play a central role in the control of normal immune homeostasis, while aberrant expression of MHC class II is frequently associated with abnormalities in immune responses.11Loureiro J Ploegh HL Antigen presentation and the ubiquitin-proteasome system in host-pathogen interactions.Adv Immunol. 2006; 92: 225-305Crossref PubMed Scopus (132) Google Scholar, 12Londei M Lamb JR Bottazzo G F. Feldmann M Epithelial cell expressing aberrant MHC class II determinants can present antigen to cloned human T cells.Nature. 1984; 312: 639-641Crossref PubMed Scopus (326) Google Scholar, 13He XL Radu C Sidney J Sette A Ward ES Garcia KC Structural snapshot of aberrant antigen presentation linked to autoimmunity: the immunodominant epitope of MBP complexed with I-Au.Immunity. 2002; 17: 83-94Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar MHC class II expression is regulated by multiple cytokines, including interferon (IFN)-γ, which can enhance the immune response by upregulating MHC class II expression in immune cells, in addition to inducing Ag-presentation capacity.14Renauld JC Class II cytokine receptors and their ligands: key antiviral and inflammatory modulators.Nat Rev Immunol. 2003; 3: 667-676Crossref PubMed Scopus (206) Google Scholar, 15Liu YJ Kanzler H Soumelis V Gilliet M Dendritic cell lineage, plasticity and cross-regulation.Nat Immunol. 2001; 2: 585-589Crossref PubMed Scopus (532) Google Scholar It is well known that the induction of MHC class II gene transcription by IFN-γ is mediated by the MHC class II transactivator (CIITA), and depends on the presence of two transcription factors; signal transducer and activator of transcription 1 and interferon regulatory factor (IRF-1).16Friese MA Jones EY Fugger L MHC II molecules in inflammatory diseases: interplay of qualities and quantities.Trends Immunol. 2005; 26: 559-561Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar CIITA is a true co-activator because it does not bind directly to DNA but mediates its function on the class II MHC promoter through interaction with other proteins.17Chang CH Gourley TS Sisk TJ Function and regulation of class II transactivator in the immune system.Immunol Res. 2002; 25: 131-142Crossref PubMed Scopus (14) Google Scholar, 18Ting JP Trowsdale J Genetic control of MHC class II expression.Cell. 2002; 109: S21-S33Abstract Full Text Full Text PDF PubMed Scopus (446) Google Scholar It is considered a master regulator because it is necessary and sufficient for the expression of all of the genes in the MHC class II pathway. Although recent studies have begun to reveal that epigenetic mechanisms have a key role in activating CIITA expression in normal cells,19Wright KL Ting JP Epigenetic regulation of MHC-II and CIITA genes.Trends Immunol. 2006; 27: 405-412Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar the factors regulating this promoter have yet to be investigated. Physiological gender differences in the immune system are well recognized and suggest that sex steroid hormones such as estrogens may be involved in the regulation of the immunocompetence.20Nalbandian G Kovats S Understanding sex biases in immunity: effects of estrogen on the differentiation and function of antigen-presenting cells.Immunol Res. 2005; 31: 91-106Crossref PubMed Google Scholar, 21Gourdy P Araujo LM Zhu R Garmy-Susini B Diem S Laurell H Leite-de-Moraes M Dy M Arnal JF Bayard F Herbelin A Relevance of sexual dimorphism to regulatory T cells: estradiol promotes IFN-γ production by invariant natural killer T cells.Blood. 2005; 105: 2415-2420Crossref PubMed Scopus (128) Google Scholar, 22Mo R Chen J Grolleau-Julius A Murphy HS Richardson BC Yung RL Estrogen regulates CCR gene expression and function in T lymphocytes.J Immunol. 2005; 174: 6023-6029PubMed Google Scholar, 23Soucy G Boivin G Labrie F Rivest S Estradiol is required for a proper immune response to bacterial and viral pathogens in the female brain.J Immunol. 2005; 174: 6391-6398PubMed Google Scholar, 24Polanczyk MJ Carson BD Subramanian S Afentoulis M Vandenbark AA Ziegler SF Offner H Estrogen drives expansion of the CD4+CD25+ regulatory T cell compartment.J Immunol. 2004; 173: 2227-2230PubMed Google Scholar Estrogenic action has been suggested to be responsible for the strong female preponderance of many autoimmune diseases, including systemic lupus erythematosus, rheumatoid arthritis, and Sjögren's syndrome (SS).25Whitacre CC Sex differences in autoimmune disease.Nat Immunol. 2001; 2: 777-780Crossref PubMed Scopus (928) Google Scholar, 26Whitacre CC Reingold SC O'Looney PA A gender gap in autoimmunity.Science. 1999; 283: 1277-1278Crossref PubMed Scopus (730) Google Scholar Previously, we demonstrated that estrogenic action influences target epithelial cells through Fas-mediated apoptosis in a murine model of SS.27Ishimaru N Saegusa K Yanagi K Haneji N Saito I Hayashi Y Estrogen deficiency accelerates autoimmune exocrinopathy in murine Sjogren's syndrome through Fas-mediated apoptosis.Am J Pathol. 1999; 155: 173-181Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar Moreover, we found that the tissue-specific apoptosis in the exocrine glands spontaneously occurring in estrogen-deficient healthy C56BL/6 (B6) mice may contribute to the development of autoimmune exocrinopathy resembling SS.28Ishimaru N Arakaki R Watanabe M Kobayashi M Miyazaki K Hayashi Y Development of autoimmune exocrinopathy resembling Sjogren's syndrome in estrogen deficient mice of healthy background.Am J Pathol. 2003; 163: 1481-1490Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar Recently in minor salivary glands from patients with SS, significantly increased development of IFN pathways and increased plasmacytoid dendritic cells (pDCs) as a possible source of IFN were shown.29Gottenberg J-E Cagnard N Lucchesi C Letourneur F Mituou S Lazure T Jacques S Ba N Ittah M Lwpajolec C Labetoulle M Ardizzone M Sibilia J Fournier C Chiocchia G Mariette X 2006. Activation of IFN pathways and plasmacytoid dendritic cell recruitment in target organs of primary Sjogren's syndrome.Proc Natl Acad Sci USA. 2006; 103: 2770-2775Crossref PubMed Scopus (463) Google Scholar The persistence of the IFN signature might be related to a vicious circle in the pathogenesis of autoimmune diseases. Despite extensive characterization of pDCs, there are still unsolved mysteries regarding their origin and function. In this study, we have focused on the molecular mechanisms responsible for tissue-specific CIITA expression caused by estrogen deficiency, resulting in aberrant expression of MHC class II molecules in the exocrine glands. Female B6 mice (H-2b) were purchased from Japan SLC (Shizuoka, Japan), and maintained in a specific pathogen-free mouse colony and given food and water ad libitum. Mice were ovariectomized (Ovx group) at 4 weeks of age and compared with sham-operated (Sham) mice. At 1 to 5 weeks after ovariectomy, all organs were removed from the mice and analyzed. To examine the antigen-presenting activity, ovalbumin (OVA)-specific T cell receptor-transgenic OT-II mice30Robertson JM Jensen PE Evavold BD DO11.10 and OT-II T cells recognize a C-terminal ovalbumin 323–339 epitope.J Immunol. 2000; 164: 4706-4712PubMed Google Scholar (C57BL/6-Tg [TcraTcrb]425Cbn/J) obtained from S. Webb (The Scripps Research Institute, La Jolla, CA), were used. All of the experiments were approved by the animal ethics board of Tokushima University. Mouse salivary gland suspension (SGS) cells were prepared as previously described.27Ishimaru N Saegusa K Yanagi K Haneji N Saito I Hayashi Y Estrogen deficiency accelerates autoimmune exocrinopathy in murine Sjogren's syndrome through Fas-mediated apoptosis.Am J Pathol. 1999; 155: 173-181Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 28Ishimaru N Arakaki R Watanabe M Kobayashi M Miyazaki K Hayashi Y Development of autoimmune exocrinopathy resembling Sjogren's syndrome in estrogen deficient mice of healthy background.Am J Pathol. 2003; 163: 1481-1490Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar Briefly, mouse submandibular glands were minced into 1-mm2 pieces, digested with collagenase (750 U/ml of type I) and hyarulonidase (500 U/ml of type IV) in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. The digested suspension was passed through a 75-μm nylon mesh filter. SGS number were counted and seeded at 2 × 105/ml with Dulbecco's modified Eagle's medium containing 10% fetal calf serum in a collagen-coated dish. After 4 hours, culture medium was changed to HuMedia-KB2 (Kurabo, Osaka Japan) and was incubated in 5% CO2 atmosphere at 37°C. Over the next 4 to 7 days the original cultures using the KB2 medium were cultured with phenol red-free Dulbecco's modified Eagle's medium containing 2% charcoal-stripped fetal calf serum for 24 hours. The primary cultured SGS cells were treated with (E2) (10 pM) (Wako Pure Chemical Ltd., Osaka), tamoxifen (10 μM) (MP Biomedicals, Burlingame, CA) with or without IFN-γ (4 ng/ml) (eBioscience, San Diego, CA) for 4 hours. Finally, the total RNA was prepared from these treated cells for quantitative RT-PCR. Surface markers of spleen cells and SGS cells were identified with monoclonal antibodies (mAbs) using FACSCanto flow cytometer (Beckman Coulter, Inc., Miami, FL). Fluorescein isothiocyanate (FITC)-conjugated rat mAb to MHC Class II and phycoerythrin (PE)-conjugated rat mAbs to CD86 and B220, and allophycocyanin (APC)-conjugated hamster mAb to CD11c (eBioscience, San Diego, CA) were used. Epithelial cells were stained with rabbit anti-mouse keratin Abs (Cosmo Bio CO. LTD, Tokyo) as primary Ab and PE-conjugated anti-rabbit IgG as secondary Ab. Appropriate isotype-matched controls were used. Data were analyzed with FlowJo FACS analysis software (Tree Star, Ashland, OR). The frozen sections of salivary and lacrimal glands from Ovx- and Sham B6 mice were fixed with cold acetone, then blocked with M.O.M.™ blocking reagent (Vector Laboratories, Inc. Burlingame, CA), and stained with following antibodies: PE-conjugated antibodies to EpCAM, PDCA1, CD86, and CD11c; biotinylated antibodies to CD11c. The secondary detection reagents included FITC-conjugated antibodies to MHC class and CD11c; Alexa Fluor 488-conjugated antibody to rat IgG (H+L), Alexa Fluor 568-conjugated streptavidin, and Alexa Fluor 488-conjugated anti-FITC IgG (Molecular Probes Inc., Eugene, Oregon). The nuclear DNA was stained with 4′,6-diamidino-2-phenylindole dihydrochloride (Molecular Probe Inc.). The images were acquired with LSM 5 PASCAL Confocal Laser-scanning microscope (Carl Zeiss, Germany). For quantitative analysis of sections, positive cells and 4′,6-diamidino-2-phenylindole-stained nuclei were counted in 10 areas of the microscopic slides at a magnification of ×630. The value was presented as the percentage of the number of positive cells to the total number of nuclei. Total RNA was extracted from primary cultured SGS and tissue using ISOGEN (Wako Pure Chemical, Osaka, Japan), and reverse transcribed. Transcript levels of MHC class II, IRF-1, CIITA, and β-actin were observed using PTC-200 DNA Engine Cycler (BioRad) with SYBR Premix Ex Taq (Takara, Kyoto, Japan). The following primer sequences were used: for MHC class II, 5′-GCCTCTGCGGAGGTGAAGA-3′ (forward) and 5′-CAAGTCCACATAGAACAACTCATCACC-3′ (reverse); for IRF-1, 5′- AACTCCAGCACTGTCACCGTG-3′ (forward) and 5′- GAGTTGCCCAGCAGGCTGTCC-3′ (reverse): for total CIITA, 5′- TGCAGGCGACCAGGAGAGACA-3′ (forward) and 5′- GAAGCTGGGCACCTCAAAGAT-3′ (reverse); for type I CIITA, 5′-AAGAGCTGCTCTCACGGGAAT-3′ (forward); for type III CIITA, 5′-TCTTACCTGCCGGAGTT-3′ (forward); for type IV CIITA, 5′-GAGACTGCATGCAGGCAGCA-3′ (forward); for type1, type III, and type IV CIITA reverse, GGTCGGCATCACTGTTAAGGA; and for β-actin, 5′- GTGGGCCGCTCTAGGCACCA-3′ (forward) and 5′-CGGTTGGCCTTAGGGTTCAGGGGGG-3′ (reverse). Relative mRNA abundance of each transcript was normalized against β-actin. The amount of mouse interleukin (IL)-2 and IL-10 in culture supernatants from CD4+ T cells and SGS cells were analyzed by enzyme-linked immunosorbent assay (ELISA). Briefly, immunoplates were coated with anti-cytokine capture antibody, and washed with PBS/0.1% Tween 20. After blocking with 2% bovine serum albumin in PBS, the plates were incubated with diluted culture supernatants or standards. The plates were washed and incubated with biotin-conjugated antibodies for cytokine detection and a horseradish peroxidase-conjugated streptavidin was added. Color reaction was developed with o-phenylendiamine (Sigma Chemical Co., St. Louis, MO) in 0.1 M citrate buffer (pH5.0) containing 0.01% H2O2. Rat anti-mouse IL-2 mAb (JES6-1A12, eBioscience), biotinylated rat anti-mouse IL-2 mAb (JES6-5H4, eBioscience), and recombinant mouse IL-2 standard (eBioscience) were used for IL-2 ELISA. Rat anti-mouse IL-10 (JES5-16E3, eBioscience), biotinylated rat anti-mouse IL-10 mAb (LES5-2A5, eBioscience), and recombinant mouse IL-10 standard (eBioscience) were used for IL-10 ELISA. The detection limits of cytokine for each were; 5 pg/ml for IL-2, 40 pg/ml for IL-10. Apoptotic cells were detected in sections using the in situ apoptotic detection kit (Wako Pure Chemical Industries) according to the manufacture's instructions. Frozen sections were fixed with 3% paraformaldehyde and incubated in labeling reaction mixture (consisting of TdT Enzyme and Labeling Safe Buffer containing fluorescein-labeled nucleotides) for 90 minutes at 37°C. For the double staining of CD11, the sections were incubated with biotin blocking system (Dako North America, Inc, Carpinteria, CA) to block endogenous biotin, and blocked with Vector M.O.M. blocking reagents (Vector, Burlingame, CA), stained with the biotinylated hamster anti-CD11c mAb, and finally, visualized with Alexa Fluor 568-conjugated streptavidin. OT-II CD4+ T cells from OT–II transgenic mice for OVA-specific T cell receptor were isolated from spleen cells by negative depletion using a mixture of anti-CD8, anti-B220, and anti-CD25 mAbs, followed by anti-rat IgG conjugated magnetic beads (Dynal, Olso, Morway). Enriched CD4+ T cells (105) were cultured with irradiated (7 Gy) SGS cells or CD11c-depleted SGS cells at the appropriated ratio in round-bottom 96-well plates. Cells were treated with 10 μg/ml OVA peptide, amino acids 323 to 339 (Abgent, San Diego CA), for 72 hours, and were pulsed with 3H-thymidine during the final 8 hours of culture, and 3H-thymidine incorporation was assayed with an automated liquid scintillation counter. For flow cytometric analysis, SGS derived dendritic cells were prepared from SGS cells in Sham and Ovx mice by negative selection with anti-EpCAM mAb and anti-rat IgG conjugated magnetic beads. For stimulation with UV-induced apoptotic epithelial cells, salivary gland DCs were purified by positive selection using CD11c microbeads (Miltenyi Biotec). Freshly isolated CD11c+ cells were stimulated with primary cultured SGS cells with or without the UV irradiation (5 minutes.) for 48 hours. Cytokine concentration of the culture medium was assayed by ELISA for IL10. To examine the in vivo effect of IFN-γ administration, 0.5 μg recombinant mouse IFN-γ (eBioscience) in 100 μl PBS was injected intravenously into Sham or Ovx B6 mice. At 3 hours after the injection all of the organs were removed, and then the total RNA was extracted for analyzing the expression of IRF-1 and CIITA by quantitative reverse transcription (RT)-PCR. The results were expressed as means ± SD with at least in triplicates per group. Values of p were determined using Student's t-test. To examine the in vivo expression of MHC class II in estrogen deficient B6 mice, ovariectomy was performed at the age of 4 weeks. Increased MHC class II mRNA expression in the salivary and lacrimal glands at 3 weeks after ovariectomy (7 weeks old) was detected, but declined with age by 8 weeks (12 weeks old) as determined by quantitative RT-PCR analysis (Figure 1A). No change in MHC class II expression was observed in other organs of Ovx-B6 and Sham-B6 mice (data not shown). We detected a distinct MHC class II expression in salivary and lacrimal gland duct cells at 3 weeks after ovariectomy (7 weeks old) by confocal analysis, as compared with negligible expression in Sham-B6 mice (*P < 0.05) (Figure 1B). The expression of MHC class II molecules is regulated generally at the transcriptional level, including the transcription factor CIITA, the master regulator for MHC class II gene expression.17Chang CH Gourley TS Sisk TJ Function and regulation of class II transactivator in the immune system.Immunol Res. 2002; 25: 131-142Crossref PubMed Scopus (14) Google Scholar, 18Ting JP Trowsdale J Genetic control of MHC class II expression.Cell. 2002; 109: S21-S33Abstract Full Text Full Text PDF PubMed Scopus (446) Google Scholar, 31Steimle V Siegrist CA Mottet A Lisowska-Grospierre B Mach B Regulation of MHC class II expression by interferon-γ mediated by the transactivator gene CIITA.Science. 1994; 265: 106-109Crossref PubMed Scopus (693) Google Scholar, 32Harton JA Ting JP Class II transactivator: mastering the art of major histocompatibility complex expression.Mol Cell Biol. 2000; 20: 6185-6194Crossref PubMed Scopus (184) Google Scholar In Ovx-B6 mice, significant CIITA mRNA expression in the salivary and lacrimal gland tissues was observed respectively at 2 weeks and 3 weeks after ovariectomy, and later declined with age by quantitative RT-PCR analysis (Figure 1C). CIITA has three different isoforms synthesized from different, cell-specific promoters33Barbieri G Deffrennes V Prod'homme T Vedrenne J Baton F Cortes C Fischer A Bono MR Lisowska-Grospierre B Charron D Alcaïde-Loridan C Isoforms of the class II transactivator protein.Int Immunol. 2002; 14: 839-848Crossref PubMed Scopus (15) Google Scholar; promoter I is mainly used in dendritic cells, promoter III in B lymphocytes, and promoter IV in nonhematopoietic cells. The CIITA expression was controlled by each promoter referred to as type I, III, and IV. Using the type specific CIITA primers, a significantly increased expression of type IV mRNA, not type I or type III mRNA, was observed in the salivary glands from Ovx-B6 mice, compared with those from Sham-B6 mice (*P < 0.002)(Figure 1D). We next examined by flow cytometry whether SGS cells from Ovx-B6 mice could express MHC class II and CD11c molecules. An increased proportion of MHC class II+ and CD11c+ cells was observed in SGS cells from Ovx-B6 mice, compared with those from Sham-B6 mice (*P < 0.05 and **P < 0.002) (Figure 2A). Keratin+ and CD11c+ SGS cells from Ovx-B6 mice expressed significantly greater levels of MHC class II molecule compared with those from Sham-B6 mice (Figure 2B). It was confirmed after depletion of epithelial cells with anti-EpCAM antibody that these CD11c+ DC enriched from SGS cells, were positive for B220 by flow cytometry (Figure 2C), implying that the salivary gland DCs were pDCs. The population of salivary gland B220+CD11c+ cells from Ovx-B6 mice was significantly larger than that in the spleen, and expressed the higher intensity of CD11c. In addition to the epithelial duct cells positively stained with MHC class II, a lower number of CD11c+ dendritic cells adjacent to the ducts was also positive for class II within the salivary glands from Ovx-B6 mice (Figure 2D). Confocal analysis also demonstrated that the salivary CD11c+ cells expressed PDCA1, a specific pDCs marker, from Ovx-B6 mice (Figure 2D). When the existence of pDCs in the salivary glands were searched for in normal conditions, a smaller number of pDCs in the normal salivary glands from Sham-B6 mice was found than from Ovx-B6 mice, indicating that estrogen deficiency led to increase in the number of pDCs in the salivary glands. These data strongly suggest that estrogen deficiency plays an important role of aberrant MHC class II expression on the exocrine gland through pDCs in vivo. A previous paper stated that significant apoptosis in the salivary gland cells was induced in estrogen-deficient B6 mice,28Ishimaru N Arakaki R Watanabe M Kobayashi M Miyazaki K Hayashi Y Development of autoimmune exocrinopathy resembling Sjogren's syndrome in estrogen deficient mice of healthy background.Am J Pathol. 2003; 163: 1481-1490Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar indicating that anti-estrogenic action seems to play an important role for epithelial cell apoptosis in vivo. Apoptosis was clearly detected in a significant number of DCs adjacent to the apoptotic epithelial duct cells positive for terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL+) in the salivary glands from Ovx-B6 mice, and not from Sham-B6 mice (Figure 3A). We found frequently that these apoptotic epithelial cells existed closely to CD11c+ DCs in the salivary glands from Ovx-B6 mice (Figure 3A). Moreover, it confirmed the salivary gland DCs from Ovx-B6 mice were activated and expressed CD86, but not DCs from Sham-B6 mice (*P < 0.01) (Figure 3B). Next we examined the effect of UV-induced apoptotic stimuli of primary cultured salivary epithelial cells on the production of IL-12p40, and IL-10 by salivary gland DCs. The increased production of IL-10, not IL-12p40, induced by the co-culture of apoptotic epithelial cells and DCs in the salivary glands from Ovx-B6 mice, was detected (Figure 3C). These results indicate that estrogen deficiency induces the apoptosis of epithelial duct cells, and there is a possible connection between the epithelial cells and DCs in the salivary glands. To determine whether MHC class II-expressing salivary gland cells induced by estrogen deficiency may function as antigen-presenting cells, we performed an in vitro proliferation assay using CD4+ T cells from OT-II Tg mice. The enriched CD4+ (1 × 105) T cells from OT-II Tg mice were capable of proliferating to irradiated SGS cells pulsed with OVA peptide from Ovx-B6 mice, compared with those from Sham-mice (Figure 4A). As CD11c-depletion of SGS cells with anti-CD11c mAbs inhibited these responses, most of the activity of antigen-specific T cell proliferation in estrogen-deficient salivary gland cells was attributed to CD11c+ DCs (Figure 4B). Moreover, significant IL-2 production was detected in the culture medium of this condition (Figure 4C). These data suggest that MHC class II-expressing salivary gland cells induced by estrogen deficiency can function as antigen-presenting cells to stimulate antigen-specific T cell response. The expression of MHC class II molecules is also regulated generally at the transcriptional level, including by the transcription factor IRF-1.34Piskurich JF Linhoff MW Wang Y Ting JP Two distinct gamma interferon-inducible promoters of the major histocompatibility complex class II transactivator gene are differentially regulated by STAT1, interferon regulatory factor 1, and transforming growth factor beta.Mol Cell Biol. 1999; 19: 431-440Crossref PubMed Google Scholar Transcription of CIITA induces transcription of IRF-1. Significantly increased expression of IRF-1 mRNA in the salivary gland tissues from Ovx-B6 mice was observed, but not in Sham-B6 mice (Figure 5A). It has been recently reported that the transcription factor IRF-1 mRNA expression is induced by ICI 182,780 and repressed by estrogens in anti-estrogen–sensitive cells.35Bouker KB Skaar TC Fernandez DR O'Brien KA Riggins RB Cao D Clarke R Interferon regulatory factor-1 mediates the proapoptotic but not cell cycle arrest effects of the steroidal antiestrogen ICI 182,780 (Faslodex, Fulvestrant).Cancer Res. 2004; 64: 4030-4039Crossref PubMed Scopus (59) Google Scholar In in vitro studies using primary cultured SGS cells, we detected an increased type IV CIITA mRNA expression when treated with anti-estrogenic tamoxifen plus IFN-γ, as compared with IFN-γ alone. Estrogen (E2) decreased the type IV CIITA mRNA expression amplified with IFN-γ (Figure 5B). Recent studies have begun to reveal that epigenetic mechanisms have a key role in activating CIITA expression in normal cells,19Wright KL Ting JP Epigenetic regulation of MHC-II and CIITA genes.Trends Immunol. 2006; 27: 405-412Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 36Zika E Ting JP Epigenetic control of MHC-II: interplay between CIITA and histone-modifying
Referência(s)