Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Conjugation of Nedd8 to CUL1 Enhances the Ability of the ROC1-CUL1 Complex to Promote Ubiquitin Polymerization

2000; Elsevier BV; Volume: 275; Issue: 41 Linguagem: Inglês

10.1074/jbc.m004847200

ISSN

1083-351X

Autores

Kenneth Wu, Angus Chen, Zhen‐Qiang Pan,

Tópico(s)

Cancer-related Molecular Pathways

Resumo

The SCF-ROC1 ubiquitin-protein isopeptide ligase (E3) ubiquitin ligase complex targets the ubiquitination and subsequent degradation of protein substrates required for the regulation of cell cycle progression and signal transduction pathways. We have previously shown that ROC1-CUL1 is a core subassembly within the SCF-ROC1 complex, capable of supporting the polymerization of ubiquitin. This report describes that the CUL1 subunit of the bacterially expressed, unmodified ROC1-CUL1 complex is conjugated with Nedd8 at Lys-720 by HeLa cell extracts or by a purified Nedd8 conjugation system (consisting of APP-BP1/Uba3, Ubc12, and Nedd8). This covalent linkage of Nedd8 to CUL1 is both necessary and sufficient to markedly enhance the ability of the ROC1-CUL1 complex to promote ubiquitin polymerization. A mutation of Lys-720 to arginine in CUL1 eliminates the Nedd8 modification, abolishes the activation of the ROC1-CUL1 ubiquitin ligase complex, and significantly reduces the ability of SCFHOS/β-TRCP-ROC1 to support the ubiquitination of phosphorylated IκBα. Thus, although regulation of the SCF-ROC1 action has been previously shown to preside at the level of recognition of a phosphorylated substrate, we demonstrate that Nedd8 is a novel regulator of the efficiency of polyubiquitin chain synthesis and, hence, promotes rapid turnover of protein substrates. The SCF-ROC1 ubiquitin-protein isopeptide ligase (E3) ubiquitin ligase complex targets the ubiquitination and subsequent degradation of protein substrates required for the regulation of cell cycle progression and signal transduction pathways. We have previously shown that ROC1-CUL1 is a core subassembly within the SCF-ROC1 complex, capable of supporting the polymerization of ubiquitin. This report describes that the CUL1 subunit of the bacterially expressed, unmodified ROC1-CUL1 complex is conjugated with Nedd8 at Lys-720 by HeLa cell extracts or by a purified Nedd8 conjugation system (consisting of APP-BP1/Uba3, Ubc12, and Nedd8). This covalent linkage of Nedd8 to CUL1 is both necessary and sufficient to markedly enhance the ability of the ROC1-CUL1 complex to promote ubiquitin polymerization. A mutation of Lys-720 to arginine in CUL1 eliminates the Nedd8 modification, abolishes the activation of the ROC1-CUL1 ubiquitin ligase complex, and significantly reduces the ability of SCFHOS/β-TRCP-ROC1 to support the ubiquitination of phosphorylated IκBα. Thus, although regulation of the SCF-ROC1 action has been previously shown to preside at the level of recognition of a phosphorylated substrate, we demonstrate that Nedd8 is a novel regulator of the efficiency of polyubiquitin chain synthesis and, hence, promotes rapid turnover of protein substrates. ubiquitin ubiquitin-activating enzyme ubiquitin carrier protein ubiquitin-protein isopeptide ligase polyacrylamide gel electrophoresis glutathione S-transferase hemagglutinin polymerase chain reaction dithiothreitol Degradation of a protein substrate by the ubiquitin (Ub)1-mediated proteasome pathway is dependent upon the coordinated action between the targeted substrate and components of the ubiquitination machinery that include the E1 activating enzyme, E2 conjugating enzymes, and E3 ligases (1Hershko A. Ciechanover A. Annu. Rev. Biochem. 1998; 67: 425-479Crossref PubMed Scopus (6959) Google Scholar). Recent studies have revealed an elegant mechanism by which the SCF-ROC1 E3 ligase complex specifically targets phosphorylated substrates for ubiquitination (2Skowyra D. Craig K. Tyers M. Elledge S.J. Harper J.W. Cell. 1997; 91: 209-219Abstract Full Text Full Text PDF PubMed Scopus (1032) Google Scholar, 3Feldman R.M.R. Correll C.C. Kaplan K.B. Deshaies R.J. Cell. 1997; 91: 221-230Abstract Full Text Full Text PDF PubMed Scopus (716) Google Scholar, 4Tan P. Fuchs S.Y. Chen A. Wu K. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. 1999; 3: 527-533Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar, 5Ohta T. Michel J.J. Schottelius A.J. Xiong Y. Mol. Cell. 1999; 3: 535-541Abstract Full Text Full Text PDF PubMed Scopus (402) Google Scholar, 6Kamura T. Koepp D.M. Conrad M.N. Skowyra D. Moreland R.J. Iliopoulos O. Lane W.S. Kaelin Jr., W.G. Elledge S.J. Conaway R.C. Harper J.W. Conaway J.W. Science. 1999; 284: 657-661Crossref PubMed Scopus (670) Google Scholar, 7Skowyra D. Koepp D.M. Kamura T. Conrad M.N. Conaway R.C. Conaway J.W. Elledge S.J. Harper J.W. Science. 1999; 284: 662-665Crossref PubMed Scopus (357) Google Scholar, 8Seol J.H. Feldman R.M. Zachariae W. Shevchenko A. Correll C.C. Lyapina S. Chi Y. Galova M. Claypool J. Sandmeyer S. Nasmyth K. Deshaies R.J. Genes Dev. 1999; 13: 1614-1626Crossref PubMed Scopus (360) Google Scholar). However, little is known about regulation of the enzymatic mechanism through which a polyubiquitin chain is formed and attached onto a given substrate. The ROC1-CUL1 complex was initially identified as a core subassembly within the SCFHOS/β-TRCP-ROC1 E3 ligase complex (4Tan P. Fuchs S.Y. Chen A. Wu K. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. 1999; 3: 527-533Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar, 5Ohta T. Michel J.J. Schottelius A.J. Xiong Y. Mol. Cell. 1999; 3: 535-541Abstract Full Text Full Text PDF PubMed Scopus (402) Google Scholar, 8Seol J.H. Feldman R.M. Zachariae W. Shevchenko A. Correll C.C. Lyapina S. Chi Y. Galova M. Claypool J. Sandmeyer S. Nasmyth K. Deshaies R.J. Genes Dev. 1999; 13: 1614-1626Crossref PubMed Scopus (360) Google Scholar). A unique biochemical feature of the ROC1-CUL1 complex is its intrinsic ability to support the polymerization of Ub molecules in the presence of E1 and Cdc34 (4Tan P. Fuchs S.Y. Chen A. Wu K. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. 1999; 3: 527-533Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar) or Ubc4/5 (5Ohta T. Michel J.J. Schottelius A.J. Xiong Y. Mol. Cell. 1999; 3: 535-541Abstract Full Text Full Text PDF PubMed Scopus (402) Google Scholar). The Ub conjugates formed appear to correspond to unanchored Ub polymers, suggesting that the Cdc34/ROC1-CUL1 ligase system catalyzes Ub self-ligation. This notion was strongly supported by the observation that (SCFHOS/β-TRCP-ROC1)/Cdc34 synthesized Ub polymers, ranging in size from dimers to octamers, migrated identically to those produced by E2–25K (9Wu K. Fuchs S.Y. Chen A. Tan P. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. Biol. 2000; 20: 1382-1393Crossref PubMed Scopus (92) Google Scholar), which has been shown to catalyze the polymerization of Ub free chains (10Chen Z. Pickart C.M. J. Biol. Chem. 1990; 265: 21835-21842Abstract Full Text PDF PubMed Google Scholar). The mechanism and biological significance of this self-ligation reaction is presently unclear. However, this reaction obviates the requirement for a specific substrate, thus providing a sensitive assay to measure the capacity of Cdc34 and SCFHOS/β-TRCP-ROC1, or ROC1-CUL1, to support Ub polymerization. It has been reported that, in yeast, Rbx1/Hrt1 (ROC1) complexed with either SCF or Cdc53 (CUL1 homologue) alone catalyzed the extensive auto-ubiquitination of Cdc34 (7Skowyra D. Koepp D.M. Kamura T. Conrad M.N. Conaway R.C. Conaway J.W. Elledge S.J. Harper J.W. Science. 1999; 284: 662-665Crossref PubMed Scopus (357) Google Scholar, 8Seol J.H. Feldman R.M. Zachariae W. Shevchenko A. Correll C.C. Lyapina S. Chi Y. Galova M. Claypool J. Sandmeyer S. Nasmyth K. Deshaies R.J. Genes Dev. 1999; 13: 1614-1626Crossref PubMed Scopus (360) Google Scholar). It is possible that the high molecular weight Ub ligation products produced by the mammalian Cdc34/ROC1-CUL1 system also contains some auto-ubiquitinated Cdc34 species. The ROC1-CUL1 mediated Ub ligase activity requires an intact ROC1 RING-H2 finger domain, in which eight conserved residues Cys-42, Cys-45, Cys-75, His-77, His-80, Cys-83, Cys-94, and Asp-97 have been identified as being essential for the ligase function (5Ohta T. Michel J.J. Schottelius A.J. Xiong Y. Mol. Cell. 1999; 3: 535-541Abstract Full Text Full Text PDF PubMed Scopus (402) Google Scholar, 6Kamura T. Koepp D.M. Conrad M.N. Skowyra D. Moreland R.J. Iliopoulos O. Lane W.S. Kaelin Jr., W.G. Elledge S.J. Conaway R.C. Harper J.W. Conaway J.W. Science. 1999; 284: 657-661Crossref PubMed Scopus (670) Google Scholar, 7Skowyra D. Koepp D.M. Kamura T. Conrad M.N. Conaway R.C. Conaway J.W. Elledge S.J. Harper J.W. Science. 1999; 284: 662-665Crossref PubMed Scopus (357) Google Scholar, 11Ohta T. Michel J.J. Xiong Y. Oncogene. 1999; 18: 6758-6766Crossref PubMed Scopus (44) Google Scholar, 12Kamura T. Conrad M.N. Yan Q. Conaway R.C. Conaway J.W. Genes Dev. 1999; 13: 2928-2933Crossref PubMed Scopus (237) Google Scholar, 13Chen A. Wu K. Fuchs S.Y. Tan P. Gomez C. Pan Z.Q. J. Biol. Chem. 2000; 275: 15432-15439Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). Although there is some evidence suggesting that the RING finger plays a critical role in recruiting an E2 conjugating enzyme (14Joazeiro C.A. Wing S.S. Huang H. Leverson J.D. Hunter T. Liu Y.C. Science. 1999; 286: 309-312Crossref PubMed Scopus (916) Google Scholar, 15Lorick K.L. Jensen J.P. Fang S. Ong A.M. Hatakeyama S. Weissman A.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11364-11369Crossref PubMed Scopus (947) Google Scholar), the precise role the RING finger plays in the mechanism of Ub ligation remains to be established (13Chen A. Wu K. Fuchs S.Y. Tan P. Gomez C. Pan Z.Q. J. Biol. Chem. 2000; 275: 15432-15439Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 16Xie Y. Varshavsky A. EMBO J. 1999; 18: 6832-6844Crossref PubMed Scopus (144) Google Scholar). Wu et al. (9Wu K. Fuchs S.Y. Chen A. Tan P. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. Biol. 2000; 20: 1382-1393Crossref PubMed Scopus (92) Google Scholar) have established CUL1 as a bipartite molecule with the C terminus required for interacting with ROC1 and, hence, responsible for the assembly of a core Ub ligase activity. Meanwhile, the N terminus is required for binding to Skp1 (9Wu K. Fuchs S.Y. Chen A. Tan P. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. Biol. 2000; 20: 1382-1393Crossref PubMed Scopus (92) Google Scholar, 17Patton E.E. Willems A. Sa D. Kuras L. Thomas D. Craig K.L. Tyers M. Genes Dev. 1998; 12: 692-705Crossref PubMed Scopus (235) Google Scholar), which recruits a substrate targeting F-box molecule, such as HOS/β-TRCP. These distinct modules work in tandem to mediate the ubiquitination of the sequestered substrate protein. It has previously been shown that Nedd8 or its orthologue Rub1, small Ub-like proteins, modify several members of the cullin/Cdc53 family (18Hochstrasser M. Genes Dev. 1998; 12: 901-907Crossref PubMed Scopus (112) Google Scholar, 19Liakopoulos D Doenges G. Matuschewski K. Jentsch S. EMBO J. 1998; 17: 2208-2214Crossref PubMed Scopus (307) Google Scholar). Studies with budding yeast have shown that deletion of RUB1 alone had no significant growth defect (20Lammer D. Mathias N. Laplaza J.M. Jiang W. Liu Y. Callis J. Goebl M. Estelle M. Genes Dev. 1998; 12: 914-926Crossref PubMed Scopus (279) Google Scholar). However, when mutations in Cdc34, Cdc53, or Skp1 were combined with the RUB1 deletion, the growth and cell cycle defects of the former group were enhanced significantly (20Lammer D. Mathias N. Laplaza J.M. Jiang W. Liu Y. Callis J. Goebl M. Estelle M. Genes Dev. 1998; 12: 914-926Crossref PubMed Scopus (279) Google Scholar). Recently, Osaka and co-workers (21Osaka F. Saeki M. Katayama S. Aida N. Toh-E A Kominami K. Toda T. Suzuki T. Chiba T. Tanaka K. Kato S. EMBO J. 2000; 19: 3475-3484Crossref PubMed Scopus (188) Google Scholar) have shown that the Nedd8-modifying pathway is essential for cell viability and function of CUL1 in fission yeast (21Osaka F. Saeki M. Katayama S. Aida N. Toh-E A Kominami K. Toda T. Suzuki T. Chiba T. Tanaka K. Kato S. EMBO J. 2000; 19: 3475-3484Crossref PubMed Scopus (188) Google Scholar). Furthermore, inactivation of theSMC1 (APP-BP1 homologue) gene, encoding for a subunit of the Nedd8 activating enzyme, caused cells to undergo multiple S phases without intervening mitosis (22Handeli S. Weintraub H. Cell. 1992; 71: 599-611Abstract Full Text PDF PubMed Scopus (87) Google Scholar). These results suggest that Nedd8 plays an important regulatory role in cell proliferation and raise an intriguing question as to whether the Nedd8 pathway exerts its regulatory function through its conjugation to cullin/Cdc53 proteins. In this report, we have provided compelling evidence demonstrating that Nedd8 is conjugated to CUL1 at residue Lys-720 and that this modification markedly stimulates the ability of ROC1-CUL1 to support Ub polymerization. These studies illustrate that, although phosphorylation triggers substrate targeting in the SCF-ROC1 pathway, Nedd8 modification provides a means to up-regulate the Ub polymerization activity, leading to efficient degradation of the targeted protein substrates. To construct a plasmid allowing for the simultaneous expression of GST-fused, HA-tagged ROC1 and the C-terminal CUL1 fragment (aa 324–776) tagged with both a six-histidine and a Flag epitopes, the following three cloning steps were used. First, the multi-restriction cloning site from the pET-15b vector (Novagen) was inserted into the pGEX-4T3 vector (Amersham Pharmacia Biotech). For this purpose, a pair of primers (GACGTCGATCGAGATCTCGATCCCGC (5′) and CCACCTGACGTCTAAGAAACC (3′); with AatII sites in bold letters) were used to amplify the desired pET-15b cloning site-containing fragment, and this segment was then cloned into PCR2.1-TOPO (Invitrogen) using the procedure described previously (9Wu K. Fuchs S.Y. Chen A. Tan P. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. Biol. 2000; 20: 1382-1393Crossref PubMed Scopus (92) Google Scholar). This was then followed by excising the pET-15b cloning site sequence by restriction digestion using AatII, and the resultingAatII fragment was subsequently inserted into pGEX-4T3 to create the hybrid vector, pGEX-4T3/pET-15b. Second, HA-ROC1 was cloned into pGEX-4T3/pET-15b. To do this, the HA-ROC1 sequence was PCR-amplified using pcDNA-HA-ROC1 (5Ohta T. Michel J.J. Schottelius A.J. Xiong Y. Mol. Cell. 1999; 3: 535-541Abstract Full Text Full Text PDF PubMed Scopus (402) Google Scholar) as a template with primers GTCGACAGCCAAGCTATGTACCCATACG (5′) and CTAGTGCCCATACTT TTGGAATTC (3′) (with SalI site in bold letters). The PCR fragment was then cloned into the pCR2.1-TOPO vector, and the HA-ROC1 sequence was excised using SalI digestion and inserted into the pGEX-4T3 cloning site on the pGEX-4T3/pET-15b vector. In this manner, GST was fused with HA-ROC1 in frame. This vector is designated as pGEX-4T3/pET- 15b-(GST-HA-ROC1). Finally, to clone the FLAG-CUL1(324–776) sequence into the pGEX-4T3/pET-15b-(GST-HA-ROC1) vector, the DNA was amplified by PCR using pcDNA FLAG-CUL1(324–776) plasmid (9Wu K. Fuchs S.Y. Chen A. Tan P. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. Biol. 2000; 20: 1382-1393Crossref PubMed Scopus (92) Google Scholar) as a template with primers CATATGGATTACAAGGATGACGACG (5′) andCATATGTTAAGCCAAGTAACTGTAGGT (3′) (with NdeI sites in bold letters). The resulting PCR fragment was cloned into the pCR2.1-TOPO vector, and the FLAG-CUL1(324–776) sequence was excised using NdeI digestion followed by insertion into the pET-15b cloning site on the pGEX-4T3/pET-15b-(GST-HA-ROC1) vector. This insertion also added a six-histidine epitope at the N terminus of FLAG-CUL1(324–776). The final vector is designated as pGEX-4T3/pET-15b-(GST-HA-ROC1)-(His-Flag-CUL1(324–776)). For simplicity, throughout the text, the (GST-HA-ROC1)-(His-Flag-CUL1(324–776)) complex is named GST-ROC1-CUL1324–776, while (HA-ROC1)-(His-Flag-CUL1(324–776)) is called ROC1-CUL1324–776. To construct mutant CUL1(K720R)324–776or CUL1K720R, the QuickChange™ site-directed mutagenesis kit (Stratagene) was employed per manufacturer's instructions using pGEX-4T3/pET-15b-(GST-HA-ROC1)-(His-Flag-CUL1(324–776)) or pCDNA3.1 FLAG-CUL1 as a template with primers CTACTGATTCAGGCGGCGATCGTGAGAATCATGCGCATGAGGAAGGTTCTG and CAGAACCTTCCTCATGCGCATGATTCTCACGATCGCCGCCTGAATCAGTAG. To construct CUL1324–719, the QuickChange™ site-directed mutagenesis kit (Stratagene) was employed using pGEX-4T3/pET-15b-(GST-HA-ROC1)-(His-Flag-CUL1(324–776)) as a template with primers CTACTGATTCAGGCGGCGATCGTGAGAATCATGTAGATGAGGAAGGTTCTG and CAGAACCTTCCTCATCTACATGATTCTCACGATCGCCGCCTGAATCAGTAG, which mutated the sequence coding Lys-720 to a stop codon. Human UBC12 sequence was amplified by PCR from pCDNA3 MYC-UBC12 (kindly provided by Y. Xiong) and inserted into pCR2.1 using the following primers (AGATCTATGATCAAGCTGTTCTCGCTG (5′) and CTATTTCAGGCAGCGC TCAAAG) (with BglII site in bold letters). The UBC12 sequence was then excised using BglII and NotI and inserted into pGEX-4T3 (digested with BamHI andNotI) to create pGEX-4T3-GST-UBC12. pGEX-4T3/pET-15b-(GST-HA-ROC1)-(His-FLAG-CUL1(324–776)) was transformed into BL21 (DE3) and grown in LB (0.5 liter) with 0.4% glucose in the presence of ampicillin at 37 °C. Cultures were then cooled to room temperature when the optical density at 600 nm reached 0.5. Isopropyl-1-thio-β-d-galactopyranoside at a final concentration of 0.2 mm was added to induce the culture overnight (12–14 h) at 25 °C. Cells were pelleted at 5,000 ×g for 15 min at 4 °C. The pellet was resuspended in 1/25 culture volume of lysis buffer (50 mm Tris-HCl, pH 8.0, 1% Triton X-100, 0.5M NaCl, 10 mm EDTA, 10 mm EGTA, 10% glycerol, 2 mm phenylmethylsulfonyl fluoride, 0.4 μg/ml antipain, 0.2 μg/ml leupeptin, and 5 mm DTT). The resuspended material was then sonicated (four repetitive 20-s treatments) and centrifuged at 17,000 rpm in an SS-34 rotor for 30 min, 4 °C. The supernatant was saved. For glutathione affinity purification, indicated amounts of extracts were adsorbed to the beads (20 μl) and excess bacteria proteins were removed by washing the beads three times with lysis buffer followed by two washes with buffer A (25 mmTris-HCl, pH 7.5, 1 mm EDTA, 0.01% Nonidet P-40, 10% glycerol, 1 mm DTT, 0.2 μg/ml leupeptin, 0.2 μg/ml antipain, and 1 mm phenylmethylsulfonyl fluoride) plus 50 mm NaCl. Typically, 10 μl of GST-ROC1-CUL1324–776-containing extracts yielded approximately 5 pmol of the complex bound to the glutathione beads. To generate the ROC1-CUL1324–776 complex, GST-ROC1- CUL1324–776-containing extracts (10 ml) were bound to glutathione beads (0.5 ml). Thrombin (Amersham Pharmacia Biotech) cleavage was carried out on beads with 35 units in phosphate-buffered saline for 2 h at 12 °C. More than 95% of GST-ROC1 was cleaved. This procedure yielded 0.6 mg of ROC1-CUL1324–776 with purity greater than 90% (Fig.1 A). Human E1 was isolated from cytosolic extracts of HeLa cells using a Ub affinity column as described previously (4Tan P. Fuchs S.Y. Chen A. Wu K. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. 1999; 3: 527-533Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar). Cdc34 was purified from extracts derived from Sf9 cells infected with mCdc34-baculovirus using a Ni2+-nitrilotriacetic acid-based affinity column (Qiagen) followed by a Q-Sepharose chromatographic step (4Tan P. Fuchs S.Y. Chen A. Wu K. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. 1999; 3: 527-533Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar). GST-UBC12 was transformed into BL21 (DE3) and grown in LB (100 ml) with 0.4% glucose in the presence of ampicillin at 37 °C. Cultures were induced for 3 h, with 0.4 mmisopropyl-1-thio-β-d-galactopyranoside added when the optical density at 600 nm reached 0.5. Extracts (4 ml) were made using the same method as for GST-ROC1-CUL1324–776, mixed with glutathione beads (0.5 ml, Amersham Pharmacia Biotech), pre-equilibrated with lysis buffer, and the mixture was rocked for 1 h at 4 °C. The slurry was then loaded onto a column and washed three times with 2 ml of lysis buffer, followed by washing twice with 2 ml of buffer A-50. GST-UBC12 was eluted with 20 mmglutathione in buffer A-50. 7.5 mg of GST-Ubc12 was obtained with purity greater than 95%. The pET3a-Nedd8 plasmid (kindly provided by C. Pickart) was transformed into BL21 (DE3). It was then expressed and harvested using the same method as GST-UBC12 except the protein was found in the pellet. The protein was solubilized and purified using a published procedure (23Whitby F.G. Xia G. Pickart C.M. Hill C.P. J. Biol. Chem. 1998; 273: 34983-34991Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar) with modifications. The inclusion body pellet was resuspended and washed three times with lysis buffer, and two times with centrifugation buffer (50 mm Tris-HCl, pH 7.5, 1 mm EDTA, 2% sucrose, 1% Triton X-100, 2 mm phenylmethylsulfonyl fluoride, 0.4 μg/ml antipain, 0.2 μg/ml leupeptin). The pellet was solubilized in urea buffer (50 mm Tris-HCl, pH 7.5, 8m urea, and 2 mm EDTA) by rocking at room temperature for 30 min. Solubilized material was then clarified using the ultracentrifuge at 100,000 × g for 1 h, 16 °C. The clarified material was thoroughly dialyzed against dialysis buffer (50 mm Tris-HCl, pH 7.5, 2 mmEDTA, 1 mm DTT, 5% glycerol, and 50 mm NaCl). The refolded protein was then concentrated using anM r 5,000 cut-off filter (Millipore) and passed through Q- and SP-Sepharose (Amersham Pharmacia Biotech) columns, pre-equilibrated with dialysis buffer, consecutively. The flow-through from the SP column was then further purified on a Superdex-75 column using a fast protein liquid chromatograph. 3 mg of pure Nedd8 were obtained per 0.5 liter of induced culture. Human APP-BP1/Uba3 was purified from extracts of HeLa cells using a Nedd8 affinity column. To pack a Nedd8 affinity column, Nedd8 protein (4 mg/ml, 3 ml), maintained in 0.1 m NaHCO3 (pH 8.0), 0.5 m NaCl, was mixed with CH-Sepharose 4B (Amersham Pharmacia Biotech), which was prepared by swelling 0.2 g of dried beads in 2.5 ml of 1 mm HCl, followed by washing the beads with 50 ml of 1 mm HCl. The mixture was rocked at 4 °C for 5 h. The reaction was stopped by removing the supernatant and incubating the beads in 1 m ethanolamine at room temperature for 1 h. Beads were then washed with alternating washes of low and high pH buffers (low: 0.1 m sodium acetate, pH 4.0, 1 m NaCl; high: 0.1 mTris-HCl, pH 8.0). The beads were stored in buffer A-50, 4 °C. The estimated capacity is 18 mg of Nedd8/ml of beads. HeLa cell extracts (150 ml, 10 mg/ml), prepared as described previously (24Wobbe C.R. Dean F. Weissbach L. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 5710-5714Crossref PubMed Scopus (228) Google Scholar), were extensively dialyzed against buffer A-50. Dialyzed extracts were then clarified by ultra centrifugation at 100,000 ×g, 4 °C, for 1 h. The extracts were adjusted to contain 50 mm creatine phosphate, pH 7.7, 10 mmMgCl2, 3 mm ATP, and 6.7 μg/ml creatine phosphokinase. This mixture was allowed to pass through the Nedd8-linked CH-Sepharose column by re-circulating overnight at 4 °C. The column was then washed with 100 ml of lysis buffer, followed by 100 ml of buffer A-50. Proteins were eluted by 20 mm DTT in buffer A-50 (15 ml). To separate APP-BP1/Uba3 from Ubc12, the 20 mm DTT-eluted material was passed on a Q-Sepharose column, pre-equilibrated with buffer A-50. The flow-through was found to contain Ubc12. After extensively washing the column with buffer A-50, the bound protein was eluted with a 10-ml gradient of 50–500 mm NaCl in buffer A. The peak of APP-BP1/Uba3 was eluted around 150 mm NaCl. Approximately 13 μg of APP-BP1/Uba3 were obtained. To sediment APP-BP1/Uba3 by glycerol gradient, Q-Sepharose fraction 21 (130 μl) was loaded onto the top of a 15–30% glycerol gradient (5 ml) containing buffer A plus 0.15 m NaCl. The gradient was run at 45,000 rpm (SW50.1 rotor) for 22 h at 4 °C. 34 fractions were collected. Recombinant GST-ROC1-CUL1324–776, immobilized on glutathione-Sepharose, or ROC1-CUL1324–776, bound to M2-matrix (Sigma), were added to a Ub ligation reaction mixture (30 μl) that contained 50 mm Tris-HCl, pH 7.4, 5 mm MgCl2, 2 mm NaF, 10 nm okadaic acid, 2 mm ATP, 0.6 mmDTT, 5 μg of [32P]Ub, 0.6 pmol of E1, and 10 pmol of Cdc34. The mixture was incubated at 37 °C for 60 min, or otherwise specified. The bound protein was released by boiling the beads with 20 μl of 4-fold concentrated Laemmli loading buffer for 3 min prior to 12.5% SDS-PAGE analysis, followed by autoradiography. For NEDD8 conjugation to CUL1324–776 with HeLa extracts, glutathione bead-coupled GST-ROC1-CUL1324–776 was incubated with 40 mmCrPO4, pH 7.7, 0.5 mm DTT, 35 mmKCl, 0.4 mm EDTA, 3.4% glycerol, 7 mmMgCl2, 2 mm ATP, 50 μg/ml creatine kinase (Sigma), and 92 μg of HeLa extract protein. The mixture was incubated at 37 °C for 60 min. For NEDD8 conjugation to CUL1324–776 with purified components, M2 bead-bound ROC1-CUL1324–776 (1 μg) was incubated with 50 mm Tris-HCl, pH 7.4, 5 mmMgCl2, 2 mm ATP, 0.6 mm DTT, 0.1 mg/ml bovine serum albumin, 5 ng of APP-BP1/Uba3 (Q-Sepharose fraction 19), 0.6 μg of NEDD8 and GST-Ubc12 in amounts indicated. The mixture was incubated at 37 °C for 60 min. To activate the Ub ligase activity of the ROC1-CUL1 complex, glutathione bead-coupled GST-ROC1-CUL1324–776 was incubated with 40 mmCrPO4, pH 7.7, 0.5 mm DTT, 35 mmKCl, 0.4 mm EDTA, 3.4% glycerol, 7 mmMgCl2, 2 mm ATP, 50 μg/ml creatine kinase, and 92 μg of HeLa extract protein. After incubation at 37 °C for 60 min, the beads were washed three times with buffer B (50 mm Tris-HCl, pH 7.5, 0.5 m NaCl, 0.25% Nonidet P-40) and then were washed twice with buffer A-50. The resulting beads were then assayed for Ub ligation as described above. To activate the Ub ligase activity of the ROC1-CUL1 complex with purified NEDD8 conjugation components, M2 bead-bound ROC1-CUL1324–776 was modified by NEDD8 as described above. The treated beads were washed twice with buffer B and then twice with buffer A-50. The washed beads were then assayed for Ub ligation as described above. We have shown recently that the RING-H2 finger protein ROC1 specifically binds to the C terminus of CUL1 (spanning amino acid residues 324–776) in transfected 293T cells and that the resulting ROC1-CUL1324–776 complex is fully active in supporting Ub ligation (9Wu K. Fuchs S.Y. Chen A. Tan P. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. Biol. 2000; 20: 1382-1393Crossref PubMed Scopus (92) Google Scholar). To identify factors that may regulate the Ub ligase activity of the ROC1-CUL1 complex, we co-expressed GST-ROC1 with CUL1324–776 in E. coli. As shown in Fig.1 A, the two co-expressed proteins formed a complex that was co-purified from a glutathione affinity column (lane 2). The co-eluted ∼33-kDa polypeptides were probably proteolyzed or prematurely terminated products of GST-ROC1 since they reacted with anti-GST antibodies (data not shown). Furthermore, the GST moiety can be removed by thrombin digestion, yielding the ROC1-CUL1324–776 complex (lane 3). The Ub ligase activity of GST-ROC1-CUL1324–776 was measured by the previously established [32P]Ub incorporation assay (4Tan P. Fuchs S.Y. Chen A. Wu K. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. 1999; 3: 527-533Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar, 5Ohta T. Michel J.J. Schottelius A.J. Xiong Y. Mol. Cell. 1999; 3: 535-541Abstract Full Text Full Text PDF PubMed Scopus (402) Google Scholar, 9Wu K. Fuchs S.Y. Chen A. Tan P. Gomez C. Ronai Z. Pan Z.Q. Mol. Cell. Biol. 2000; 20: 1382-1393Crossref PubMed Scopus (92) Google Scholar, 13Chen A. Wu K. Fuchs S.Y. Tan P. Gomez C. Pan Z.Q. J. Biol. Chem. 2000; 275: 15432-15439Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). In this system, the bacterial-assembled GST-ROC1-CUL1324–776 complex was coupled to glutathione-beads and the resulting matrix was incubated with E1, Cdc34, and [32P]Ub. The results showed that GST-ROC1-CUL1324–776 converted monomeric Ub molecules into high molecular mass Ub polymers in a concentration-dependent manner (Fig. 1 B,lanes 1–5). This reaction depended on the presence of Cdc34 as its omission abolished the reaction (lane 6). This result demonstrates that ROC1 and the CUL1324–776 fragment contain all of the essential elements that constitute a Ub polymerization activity. To explore whether the unmodified GST-ROC1-CUL1324–776could be activated, the glutathione beads coupled with the GST-ROC1-CUL1324–776 complex were incubated with HeLa cell extracts in the presence of an ATP regenerating system. Following a brief incubation, excess HeLa proteins were removed by extensively washing the beads. The treated-complex was then incubated with ubiquitination agents to initiate the Ub polymerization reaction. The results showed that the treated complex was significantly more active than the untreated complex in supporting Ub ligation (Fig.1 B, compare lanes 2–5 withlanes 7–10). As shown, the Ub ligase activity of the GST-ROC1-CUL1324–776 complex was increased up to 10-fold when low levels of the complex were used (Fig. 1 B,bottom panel). Of note, at the highest levels of GST-ROC1-CUL1324–776 used, the majority of monomeric Ub had been consumed (lanes 9 and 10), thus limiting the production of high molecular weight Ub conjugates. The depletion of the Ub substrate may have significantly resulted in the underestimation of the degree of activation in the presence of high levels of GST-ROC1-CUL1324–776. Additionally, the results from kinetic analysis indicated that the HeLa extract-treated GST-ROC1-CUL1324–776 promoted the polymerization of Ub molecules more rapidly than the mock-treated complex (data not shown). Subsequent immunoblot analysis revealed that a fraction of CUL1324–776 was conjugated with NEDD8 following incubation with HeLa extracts (Fig.2, upper panel). In contrast, no detectable mobility changes were observed with GST-ROC1 (Fig. 2, bottom panel). Collectively, these results demonstrate that the HeLa extracts catalyze the conjugation of NEDD8 to the CUL1324–776 subunit of the GST-ROC1-CUL1324–776 complex an

Referência(s)