Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Different Foci for the Regulation of the Activity of the KefB and KefC Glutathione-gated K+ Efflux Systems

1999; Elsevier BV; Volume: 274; Issue: 14 Linguagem: Inglês

10.1074/jbc.274.14.9524

ISSN

1083-351X

Autores

L. S. Ness, Ian R. Booth,

Tópico(s)

Heme Oxygenase-1 and Carbon Monoxide

Resumo

KefB and KefC are glutathione-gated K+ efflux systems in Escherichia coli, and the proteins exhibit strong similarity at the level of both primary sequence and domain organization. The proteins are maintained closed by glutathione and are activated by binding of adducts formed between glutathione and electrophiles. By construction of equivalent mutations in each protein, this study has analyzed the control over inactive state of the proteins. A UV-induced mutation in KefB, L75S, causes rapid spontaneous K+ efflux but has only a minor effect on K+ efflux via KefC. Similarly amino acid substitutions that cause increased spontaneous activity in KefC have only small effects in KefB. Exchange of an eight amino acid region from KefC (HALESDIE) with the equivalent sequence from KefB (HELETAID) has identified a role for a group of acidic residues in controlling KefC activity. The mutations HELETAID and L74S in KefC act synergistically, and the activity of the resultant protein resembles that of KefB. We conclude that, despite the high degree of sequence similarity, KefB and KefC exhibit different sensitivities to the same site-specific mutations. KefB and KefC are glutathione-gated K+ efflux systems in Escherichia coli, and the proteins exhibit strong similarity at the level of both primary sequence and domain organization. The proteins are maintained closed by glutathione and are activated by binding of adducts formed between glutathione and electrophiles. By construction of equivalent mutations in each protein, this study has analyzed the control over inactive state of the proteins. A UV-induced mutation in KefB, L75S, causes rapid spontaneous K+ efflux but has only a minor effect on K+ efflux via KefC. Similarly amino acid substitutions that cause increased spontaneous activity in KefC have only small effects in KefB. Exchange of an eight amino acid region from KefC (HALESDIE) with the equivalent sequence from KefB (HELETAID) has identified a role for a group of acidic residues in controlling KefC activity. The mutations HELETAID and L74S in KefC act synergistically, and the activity of the resultant protein resembles that of KefB. We conclude that, despite the high degree of sequence similarity, KefB and KefC exhibit different sensitivities to the same site-specific mutations. N-ethylmaleimide polymerase chain reaction kilobase(s) KefB and KefC are independent, glutathione-gated potassium efflux systems found in Escherichia coli (1Booth I.R. Epstein W. Giffard P.M. Rowland G.C. Biochimie (Paris). 1985; 67: 83-90Crossref PubMed Scopus (23) Google Scholar). The efflux systems are maintained in a closed state by glutathione or by its non-sulfydryl analogue, ophthalmic acid (2Meury J. Kepes A. EMBO J. 1982; 1: 339-343Crossref PubMed Scopus (70) Google Scholar, 3Elmore M.J. Lamb A.J. Ritchie G.Y. Douglas R.M. Munro A. Gajewska A. Booth I.R. Mol. Microbiol. 1990; 4: 405-412Crossref PubMed Scopus (68) Google Scholar). The systems are fully activated by adducts formed by reaction of glutathione with electrophilic compounds, such as N-ethylmaleimide (NEM),1 methylglyoxal (MG), and chlorodinitrobenzene (3Elmore M.J. Lamb A.J. Ritchie G.Y. Douglas R.M. Munro A. Gajewska A. Booth I.R. Mol. Microbiol. 1990; 4: 405-412Crossref PubMed Scopus (68) Google Scholar, 4Ferguson G.P. Munro A.W. Douglas R.M. McLaggan D. Booth I.R. Mol. Microbiol. 1993; 9: 1297-1303Crossref PubMed Scopus (74) Google Scholar). Activation of KefB and KefC provokes rapid potassium efflux, accompanied by acidification of the cytoplasm and influx of sodium ions (5Ferguson G.P. McLaggan D. Booth I.R. Mol. Microbiol. 1995; 17: 1025-1033Crossref PubMed Scopus (88) Google Scholar, 6Ferguson G.P. Nikolaev Y. McLaggan D. MacLean M. Booth I.R. J. Bacteriol. 1997; 179: 1007-1012Crossref PubMed Google Scholar). The viability of mutants lacking KefB and KefC is markedly reduced, but incubation with weak acids, which mimics the fall in pH associated with channel activation, leads to retention of viability (5Ferguson G.P. McLaggan D. Booth I.R. Mol. Microbiol. 1995; 17: 1025-1033Crossref PubMed Scopus (88) Google Scholar, 6Ferguson G.P. Nikolaev Y. McLaggan D. MacLean M. Booth I.R. J. Bacteriol. 1997; 179: 1007-1012Crossref PubMed Google Scholar). Thus, a major determinant of the sensitivity of E. coli cells to electrophiles is the cytoplasmic pH, and this can be modulated by the controlled activation of KefB and KefC by glutathione adducts. The structural gene for KefC has been cloned and sequenced (7Munro A.W. Ritchie G.Y. Lamb A.J. Douglas R.M. Booth I.R. Mol. Microbiol. 1991; 5: 607-616Crossref PubMed Scopus (86) Google Scholar). The protein has a distinct domain structure: an amino-terminal membrane protein (residues 1–380) and an extremely hydrophilic linker that connects the membrane domain to the carboxyl-terminal hydrophilic domain (residues 401–620) (8Booth I.R. Jones M. McLaggan D. Nikolaev Y. Ness L. Wood C. Miller S. Tötemeyer S. Ferguson G. Konings W.N. Kaback H.R. Lolkema J.S. Handbook of Biological Physics. 2. Elsevier Science Publishers B. V., Amsterdam1996: 693-729Google Scholar). The carboxyl-terminal domain contains a sequence highly similar to a Rossman fold (7Munro A.W. Ritchie G.Y. Lamb A.J. Douglas R.M. Booth I.R. Mol. Microbiol. 1991; 5: 607-616Crossref PubMed Scopus (86) Google Scholar, 8Booth I.R. Jones M. McLaggan D. Nikolaev Y. Ness L. Wood C. Miller S. Tötemeyer S. Ferguson G. Konings W.N. Kaback H.R. Lolkema J.S. Handbook of Biological Physics. 2. Elsevier Science Publishers B. V., Amsterdam1996: 693-729Google Scholar). A number of mutations that cause increased spontaneous activity in KefC have been characterized and fall in two regions: a region (the "HALESDIE" sequence) predicted to lie at the cytoplasmic face of the membrane domain and residues within, and adjacent to, the Rossman fold of the carboxyl-terminal domain (7Munro A.W. Ritchie G.Y. Lamb A.J. Douglas R.M. Booth I.R. Mol. Microbiol. 1991; 5: 607-616Crossref PubMed Scopus (86) Google Scholar, 8Booth I.R. Jones M. McLaggan D. Nikolaev Y. Ness L. Wood C. Miller S. Tötemeyer S. Ferguson G. Konings W.N. Kaback H.R. Lolkema J.S. Handbook of Biological Physics. 2. Elsevier Science Publishers B. V., Amsterdam1996: 693-729Google Scholar, 9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). One mutation at the latter site alters the glutathione regulation of the KefC protein (9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar), but the specific mechanism of activation by the other lesions is not known. The two E. coli glutathione-gated K+ efflux systems can be differentiated by their activation by MG (4Ferguson G.P. Munro A.W. Douglas R.M. McLaggan D. Booth I.R. Mol. Microbiol. 1993; 9: 1297-1303Crossref PubMed Scopus (74) Google Scholar). Methylglyoxal only weakly activates KefC, whereas KefB achieves almost maximum activity with this electrophile. In this study we sought to characterize the structural gene for KefB to determine the relatedness to KefC. The two proteins are similar at the sequence and organizational levels. However, the creation of equivalent mutations at a number of positions in KefB and KefC shows that the residues controlling the activation of the two systems are different. All chemical reagents were purchased from Sigma or BDH and were of analytical grade where possible. Chemicals used for preparation of complex growth medium were supplied by Oxoid. Restriction enzymes and Taq DNA polymerase were supplied by Boehringer. Pfu polymerase was obtained from Stratagene. The Qiagen Plasmid Preparation Kits were obtained from Qiagen. All primers used in this study were purchased from Genosys Biotechnologies Inc. The Wizard PCR Preps DNA Purification System was obtained from Promega. The PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit was obtained from Applied Biosystems Ltd. Bacterial strains used in this study are all derivatives of E. coli K-12 (TableI). Strains MJF270 and MJF276 were previously thought to carry an internal deletion in the kefBgene, as they were isolated as suppressers of the kefB110mutation. 2W. Epstein, personal communication. However, sequence analysis during the current work revealed that the strain carries two mutations, L75S and D157N, that together inactivate KefB.Table IStrains and plasmids used in this studyDescriptionSourceStrainsJM109(recA1, supE44, endA1, hsdR17, gyrA96, relA1, thi,Δ(lac-proAB), F′[traD36,proAB +, laqIq,lacZΔM15])Ref. 16Yanisch-Perron C. Vieira J. Messing J. Gene (Amst.). 1985; 33: 103-119Crossref PubMed Scopus (12033) Google ScholarMJF274(F−, ΔkdpABC5, thi, rha, lacI,lacZ, trkD1)Ref. 4Ferguson G.P. Munro A.W. Douglas R.M. McLaggan D. Booth I.R. Mol. Microbiol. 1993; 9: 1297-1303Crossref PubMed Scopus (74) Google ScholarMJF277(MJF274,kefC::Tn10)Ref. 4Ferguson G.P. Munro A.W. Douglas R.M. McLaggan D. Booth I.R. Mol. Microbiol. 1993; 9: 1297-1303Crossref PubMed Scopus (74) Google ScholarMJF270(MJF274, kefB157)Ref. 4Ferguson G.P. Munro A.W. Douglas R.M. McLaggan D. Booth I.R. Mol. Microbiol. 1993; 9: 1297-1303Crossref PubMed Scopus (74) Google ScholarMJF276(MJF270,kefC::Tn10)Ref. 4Ferguson G.P. Munro A.W. Douglas R.M. McLaggan D. Booth I.R. Mol. Microbiol. 1993; 9: 1297-1303Crossref PubMed Scopus (74) Google ScholarFrag5(F−, ΔkdpABC5 thi rha lacZ)Ref. 10Epstein W. Kim B.S. J. Bacteriol. 1971; 108: 639-644Crossref PubMed Google ScholarMJF110(Frag5,kefC::Tn10, kefB110)This studyMJF111(Frag5, Δ(yabF-kefC::Kan),kefB111)This studyMJF113(Frag5, Δ(yabF-kefC::Kan), kefB113)This studyMJF115(Frag5,kefC::Tn10, kefB115)This studyMJF117(Frag5,kefC::Tn10, kefB117)This studyPlasmidpHG165pBR322 copy number derivative of pUC8Ref. 11Stewart G.S.A.B. Lubinsky-Mink S. Jackson C.G. Cassel A. Kuhn J. Plasmid. 1986; 15: 172-181Crossref PubMed Scopus (143) Google ScholarpTZ19UKefBpTZ19U carrying 2.6-kbyheR kefB fragmentThis studypSM7pTZ19U carrying 1.8-kb kefC fragment deleted foryabFRef. 9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google ScholarpSM19pSM7 carrying D264A mutation in KefCRef. 9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google ScholarpSM43pSM7 carrying V427A mutation in KefCUnpublishedpKefBpHG165 carrying 2.6-kbyheR-kefB fragmentThis studypKefB-1pKefB carrying L75S mutation in KefBThis studypKefB-2pKefB carrying A262DThis studypKefB-3pKefB carrying HALESDIE 257–264This studypKefB-4pKefB carrying V428A mutation in KefBThis studypKefB-5pKefB carrying HALESDIE and V428AThis studypkC11pHG165 carrying 2.6-kbyabF-kefC fragmentRef. 7Munro A.W. Ritchie G.Y. Lamb A.J. Douglas R.M. Booth I.R. Mol. Microbiol. 1991; 5: 607-616Crossref PubMed Scopus (86) Google ScholarpkC11-1pkC11 carrying L74S mutation in KefCThis studypkC11-2pkC11 carrying D264A from pSM19This studypkC11-3pkC11 carrying HELETAID 259–266This studypkC11-4pkC11 carrying V427A mutation in KefC; from pSM43This studypkC11-5pkC11 carrying HELETAID and L74S from pSM43This study Open table in a new tab The growth medium used throughout was KX, where X is the concentration of K+ (10Epstein W. Kim B.S. J. Bacteriol. 1971; 108: 639-644Crossref PubMed Google Scholar). Strains were grown overnight at 37 °C in K10 minimal medium supplemented with 0.04% (w/v) glucose and 1 μg·ml−1 thiamine. Ampicillin (25 μg·ml−1) was included if the strain carried a plasmid. Aliquots of 3 ml were washed in K1 buffer, suspended in 30 ml of K1 minimal medium containing 0.2% (w/v) glucose and 1 μg·ml−1 thiamine placed at 37 °C and the OD650 monitored over time. For analysis of cell viability the appropriate strains were grown as above and grown to early exponential phase (OD650 = 0.4) before diluting 10-fold into fresh prewarmed medium containing MG from a 540 mmstock solution. Cell viability was determined exactly as described previously (4Ferguson G.P. Munro A.W. Douglas R.M. McLaggan D. Booth I.R. Mol. Microbiol. 1993; 9: 1297-1303Crossref PubMed Scopus (74) Google Scholar). Potassium efflux and cytoplasmic pH determinations were carried out as described previously (3Elmore M.J. Lamb A.J. Ritchie G.Y. Douglas R.M. Munro A. Gajewska A. Booth I.R. Mol. Microbiol. 1990; 4: 405-412Crossref PubMed Scopus (68) Google Scholar, 5Ferguson G.P. McLaggan D. Booth I.R. Mol. Microbiol. 1995; 17: 1025-1033Crossref PubMed Scopus (88) Google Scholar, 6Ferguson G.P. Nikolaev Y. McLaggan D. MacLean M. Booth I.R. J. Bacteriol. 1997; 179: 1007-1012Crossref PubMed Google Scholar) with cells grown at 37 °C in K120 minimal medium (10Epstein W. Kim B.S. J. Bacteriol. 1971; 108: 639-644Crossref PubMed Google Scholar) supplemented with 0.2% (w/v) glucose and 1 μg·ml−1 thiamine. For the assay cells were washed and suspended in K0 buffer, which lacks ammonium sulfate and MgSO4. To determine the intracellular K+ content of cells during growth, samples were incubated in K120 minimal medium to an OD650 of 0.8–1.0 and 6 × 1-ml samples were centrifuged through 200 μl of bromodecane oil and the supernatant and oil removed. The intracellular potassium concentration was then determined as for potassium efflux (3Elmore M.J. Lamb A.J. Ritchie G.Y. Douglas R.M. Munro A. Gajewska A. Booth I.R. Mol. Microbiol. 1990; 4: 405-412Crossref PubMed Scopus (68) Google Scholar). A 2.6-kb fragment encompassing theyheR and kefB genes was amplified by PCR from strain MJF277 using primers KefB3 and KefB4 (TableII), both of which had BamHI restriction sites incorporated at their 5′ ends. The PCR products obtained were end-filled by treating with the Klenow enzyme, restricted with BamHI, ligated into similarly restricted plasmid pHG165 (11Stewart G.S.A.B. Lubinsky-Mink S. Jackson C.G. Cassel A. Kuhn J. Plasmid. 1986; 15: 172-181Crossref PubMed Scopus (143) Google Scholar) to create plasmid pKefB, and transformed into strain JM109. Klenow treatment, restriction enzyme digestion, ligation, and transformation procedures were carried out following standard protocols (12Maniatis T. Fritsch E.F. Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1982Google Scholar).Table IIPrimers used for cloning and mutagenesisPrimerSequence (5′-3′)Restriction siteaRestriction sites introduced (+) or deleted (−) to identify introduction of mutation.PlasmidKefB3TGGTGTACGGATCCCGTCGGCGCTGATTKefB4TGGTGTACGGATCCCTACTCAAATTCATCKefB8GTCGTGGAGATCGATATCCGTTTCCAGTTCEcoRV(+)pKefB-2KefB HALESDIEGAATATCGCCATGCACTGGAAAGCGATATCGAACCCTTCAAAGGEcoRV(+)ClaI(−)pKefB-3KefB V428AGCGCATTACCGCGCTCGAGCGGGATATCXhoI(+)pKefB-4KefC HELETAIDGAATACCGTCATGAGCTGGAGACCGCTATCGATCCATTTAAAGGEcoRV(−)ClaI(+)pkC11-3KefC L74SATCGGCCTCGAGAGCGATCCACAAAGGXhoI(+)pkC11-1KefB L75SCATCGGCCTCGAGTCGAATCCCTCCAAACXhoI(+)pKefB-1a Restriction sites introduced (+) or deleted (−) to identify introduction of mutation. Open table in a new tab For DNA sequencing, the clonedyheR and kefB genes from plasmid pKefB and mutant plasmids were amplified in 450 ± 50 base pairs overlapping fragments, using primers designed specifically to complement the available yheR and kefB gene sequences from theE. coli genome project (13.Blattner, F. R., Plunkett, G., III, Mayhew, G. F., Perna, N. T., and Glasner, F. D. (1995) Escherichia coliGenome Entry; GenBankTM accession number, U18997.Google Scholar). The PCR products obtained were cleaned using Promega PCR DNA clean-up kit. A cycle sequencing reaction with each one of the primer pair used for amplification was performed using Applied Biosystems sequencing premix. The products were cleaned by ethanol precipitation and run on the Applied Biosystems 373A sequencer before being analyzed using the Applied Biosystems "Sequence Editor" program. To create plasmid pKefB-2, which carries an aspartate residue at position 262 of the KefB protein in place of the wild-type alanine residue (Table I), site-directed mutagenesis was performed. Primer KefB8 (Table II) was designed such that it encompassed bases 774–792 of the kefB gene (amino acids 258–264 of the KefB protein) and contained one mismatch base T781A, which created A262D. Used in conjunction with primer KefB3, KefB8 amplified, by PCR, a product of 1.6 kb in length. This product was Klenow-treated, cleaned, and restricted (as above) at two internal restriction sites, ClaI and DraIII. The resulting 1.15-kb restricted product was ligated into similarly restricted plasmid pKefB to create plasmid pKefB-2. The A262D mutation was confirmed by DNA sequencing of the 1.15-kb insert (as above). All other mutant plasmids were obtained using the following method, which is based on a technique developed by Stratagene. Parental or wild-type plasmid DNA was purified from a strain that methylates its DNA (JM109 was used for this purpose), and this was used as template for 18 rounds of PCR using the appropriate mutagenic primers (Table II) and Pfu polymerase. Restriction with DpnI, an enzyme that restricts methylated DNA only, digests template DNA, while leaving amplified and, therefore, mutated DNA undigested. After transformation of the restricted PCR reactions into JM109, the majority of colonies obtained, therefore, should contain the desired mutant plasmid. Analysis of the putative mutants was by restriction enzyme digestion followed by DNA sequencing (see above). The kefBlocus at 75 min on the E. coli genetic map is required for K+ efflux elicited by MG (4Ferguson G.P. Munro A.W. Douglas R.M. McLaggan D. Booth I.R. Mol. Microbiol. 1993; 9: 1297-1303Crossref PubMed Scopus (74) Google Scholar). Analysis of open reading frames in this region of the E. coli genetic map identified a sequence, ECOUW67_274 (P45522) with strong sequence similarity to KefC from E. coli and KefX from Hemophilus influenzae and Myxococcus xanthus. The predicted open reading frame is 601 amino acids (compared with 620 residues for KefC) shows 42% identity and 70% similarity at the amino acid sequence and exhibits similar domain organization to KefC. Another open reading frame ECOUW67_275 (P42621), yheR, overlapped kefBby a single base the 5′ end. This gene arrangement is similar to that found for kefC, in which an upstream open reading frame,yabF, is required for the activity of the KefC protein (14.Wood, C. M., A Molecular Analysis of the Potassium Eflux System KefC. Ph.D. thesis, 1996, University of Aberdeen, Aberdeen, UK.Google Scholar). The putative yheR-kefB region was amplified and cloned into plasmid pHG165 to create pKefB (see "Experimental Procedures") and transformed into strain MJF276 (KefB− KefC−). The cloned fragment was sequenced and confirmed to carry the same sequence as that deposited in the data base (13.Blattner, F. R., Plunkett, G., III, Mayhew, G. F., Perna, N. T., and Glasner, F. D. (1995) Escherichia coliGenome Entry; GenBankTM accession number, U18997.Google Scholar). The transformants were analyzed for electrophile-elicited K+ efflux activity and for restoration of protection against MG. Strain MJF276/pKefB rapidly lost 25% of the cell K+ pool on suspension into K0 buffer (first time point 40 s after suspension in K0), and the pool declined to less than 50% of the control over a 25-min incubation (Fig.1 A). The K+ pool of MJF276/pKefB was equal to, or greater than, that of MJF276 prior to suspension in K0 (705 ± 21 and 598 ± 51 μmol·g−1 dry cell mass, respectively). Addition of MG caused more than 85% of the K+ pool to be lost in the first 7 min of the incubation with the electrophile. The MG-elicited rate of efflux was considerably faster than that observed with strain MJF276 (KefB− KefC−) and MJF274 (KefB+ KefC+), which carries a single chromosomal copy of the kefB gene (note that KefC makes little contribution to MG-elicited efflux) (Fig. 1 B). It is notable that the initial rate of K+ loss after addition of MG is slower than the maximum activity, which was achieved approximately 3–5 min after addition of the electrophile. Activation by NEM, which reacts spontaneously with glutathione to form the activator N-ethylsuccinimido-S-glutathione elicited high rates of K+ efflux from MJF276/pKefB (Fig.1 C). The rate of K+ efflux declined steadily as the K+ pool declined. When compared with data for strains MJF274 (KefB+ KefC+) and MJF277 (KefB+ KefC−), which possess single copies of KefB, these data suggest a 10–12-fold increased expression of the KefB protein in MJF276/pKefB. The cloned kefB gene provided full protection against MG. When incubated with 0.4 mm MG growth of E. colicells was inhibited but strain MJF274 (KefB+KefC+) and MJF276/pKefB recovered and subsequent growth occurred at the same rate. Strain MJF276, which lacks functional KefB and KefC systems, also recovered but at a much slower rate (data not shown). When exposed to higher concentrations of MG cell death ensued and the degree of survival was greater in MJF276/pKefB than in MJF274 (Fig. 2 A). The enhanced protection afforded by the higher activity of KefB in strain MJF276/pKefB correlated with the rate and magnitude of the lowering of cytoplasmic pH (pHi). Thus, on addition of MG, the cytoplasmic pH of MJF276/pKefB fell rapidly to a level lower than in either MJF276 or MJF274 (Fig. 2 B), and these observations are consistent with our previously published model (5Ferguson G.P. McLaggan D. Booth I.R. Mol. Microbiol. 1995; 17: 1025-1033Crossref PubMed Scopus (88) Google Scholar, 6Ferguson G.P. Nikolaev Y. McLaggan D. MacLean M. Booth I.R. J. Bacteriol. 1997; 179: 1007-1012Crossref PubMed Google Scholar). UV-induced chromosomal kefB mutants, which exhibit a rapid K+ leak, have been isolated previously (1Booth I.R. Epstein W. Giffard P.M. Rowland G.C. Biochimie (Paris). 1985; 67: 83-90Crossref PubMed Scopus (23) Google Scholar,10Epstein W. Kim B.S. J. Bacteriol. 1971; 108: 639-644Crossref PubMed Google Scholar). Five independent mutants, MJF110, MJF111, MJF113, MJF115, and MJF117, were analyzed by PCR amplification of gene fragments from the mutant kefB genes. In each case the same single amino acid change was observed, L75S. This residue is strongly conserved in members of the KefB/C family for which the gene sequence is available (Fig. 3). The amino acid change causes rapid spontaneous K+ efflux via the chromosomally encoded KefB system (Fig. 4 A). The addition of either MG or NEM did not greatly amplify the rate of K+ efflux, which may indicate that the L75S mutation causes the protein to achieve almost maximum activity.Figure 4L75S in KefB is important for channel regulation and activity. A, potassium efflux from the KefB leaky mutant, MJF111 (kefC::Tn10;kefB111; L75S). Symbols: ○, MJF111; ▪, MJF111 plus 3 mm MG; and ▴, MJF111 plus 0.5 mm NEM. The electrophile was added after 3 min (arrow). B, partial suppression of K+ efflux in strain MJF111/pKefB. Symbols: ●, spontaneous K+ efflux from Frag5 (KefB+ KefC+); ▴, Frag5/pKefB; ○, MJF111 (kefC::Tn10, kefB111; L75S); ▵, MJF111/pKefB; and ■, MJF111/pkC11. Plasmids pKefB and pkC11 carry the yheR-kefB and yabF-kefC genes, respectively, and their upstream regulatory regions. Time 0 indicates suspension of the cells in K0 buffer.View Large Image Figure ViewerDownload (PPT) We have shown previously that the wild-type kefC gene can suppress mutations that cause partial spontaneous activation of KefC. The rapid K+ leak seen in strain MJF276/pKefB was not observed in strain Frag5/pKefB; there was no immediate loss of K+ on suspension in K0 medium, and the cells retained a similar K+ pool to Frag5 throughout the incubation (Fig. 4 B). Since Frag5 is the isogenic parent of MJF111, this enabled the potential suppression of the KefBL75S mutant by the wild type gene to be analyzed (Fig. 4 B). Potassium loss was consistently observed to be slower from MJF111/pKefB than from MJF111. However, the effect was small relative to the suppression seen previously with the cloned kefC gene and kefCmissense mutants (9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar, 15Douglas R.M. Ritchie G.Y. Munro A.W. McLaggan D. Booth I.R. Mol. Membr. Biol. 1994; 11: 55-61Crossref PubMed Scopus (9) Google Scholar). Introduction of pkC11, which carries thekefC gene in the same plasmid vector as pKefB, did not alter the rate or extent of K+ loss. These data suggest that the small effect seen with pKefB is specific and is not due to a general change in membrane organization consequent upon the higher level of expression of the KefB system in MJF111/pKefB. Thus, the L75S mutation has a profound effect on the regulation of the activity of the KefB system and is dominant over the wild-type allele. We have described previously the effects of a number of mutations that increase the spontaneous activity of the KefC system (9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Since KefB and KefC display significant similarity of sequence and organization, we sought to determine whether each was affected by mutations that affect the spontaneous activity of the other, i.e. do they share common control points. We have established previously that the KefC mutation D264A causes high rates of spontaneous K+ efflux (9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). The KefB protein carries an alanine at the equivalent position (A262) as the wild type sequence (Fig. 3). Since pKefB causes a spontaneous leak we generated the mutation A262D, predicting that it would reduce the leak, but strain MJF276/pKefB-2, which carries the A262D mutation, exhibited only a slightly reduced rate of spontaneous K+efflux (data not shown). The initial rate of MG-induced K+efflux was significantly inhibited and there was a slight reduction in NEM-elicited efflux (data not shown). Therefore, it is clear that this residue plays a less significant role than D264 in KefC. Mutations in the Rossman fold of KefC (R416S and V427A) result in a similar phenotype to that seen with the L75S mutation in KefB (9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Val427 is conserved in the KefC family of proteins (Fig. 3) and the E. coli KefC mutant V427A exhibits rapid K+ efflux when present in single or low copy number (9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Strain MJF276/pkC11-4 (V427A), which is a multicopy plasmid based on pkC11 (Table I), failed to grow even in K120 medium suggesting that the K+ leak is too severe to allow growth. In contrast, only a small increase in spontaneous K+ leak was observed when the equivalent V428A mutation was introduced into KefB (Fig. 5; cf. pKefB and pKefB-4). Rates of MG-elicited efflux were rapid but showed no significant difference between pKefB and pKefB-4 (V428A) (data not shown). Located between two highly conserved regions of KefC is a variable sequence HALESDIE that contains three acidic residues in all four known sequences (Fig. 3). Two UV-induced mutations in this region in E. coli KefC, D264A and E262K, enhance spontaneous K+ efflux (9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). The KefB protein also has three acidic residues in the equivalent sequence (HELETAID), but also carries an alanine residue at position 262, echoing the D264A mutation in KefC. Therefore, we determined whether it was the presence of three acidic residues or their location at specific positions that controlled the activity of the KefC system. We exchanged the equivalent regions from KefB and KefC, namely the HELETAID and HALESDIE motifs, respectively, and measured the spontaneous and electrophile-induced rates of K+ efflux (Figs. 5 and6, A and B). Replacement of the KefB HELETAID with KefC HALESDIE in plasmid pKefB-3 (Table I) had only a small effect on spontaneous efflux, enhancing the initial rate approximately 2-fold (Fig. 5). The mutation did not significantly affect the rate of electrophile-elicited efflux, which was faster than the spontaneous rate of K+ loss (data not shown). Combinations of the HALESDIE motif and V428A in KefB (pKefB-5) also led to higher spontaneous rates of K+ efflux, but the double change did not emulate the severity of the combination in KefC. Electrophile-elicited efflux was not significantly affected in the KefB mutant (data not shown). In contrast, in KefC, replacement of the HALESDIE sequence with HELETAID (plasmid pkC11-3) significantly enhanced the spontaneous K+ loss (Fig. 6 A). This multiple change creates in KefC the D264A mutation but leaves three acidic amino acids in the motif. As a control, an equivalent plasmid pkC11-2 (KefC D264A) was created. Strain MJF276/pkC11-2 failed to grow in K120 medium, suggesting that the K+ leak overwhelms the uptake capacity of the strain. In contrast, MJF276/pSM19 (D264A), which has reduced expression of KefC due to a deletion 5′ to the structural gene, was able to grow normally in K120medium (9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Strain MJF276/pkC11-3 (HELETAID), which recreates the D264A mutation but in a different context to pkC11-2 (KefC D264A) (Table I), grew normally in K120 medium and exhibited only a moderate K+ leak. These data suggest that the D264A mutation in plasmid pkC11-3 (HELETAID) is partially compensated by the presence of the three acidic residues in the motif. The KefB L75S mutants exhibited rapid spontaneous efflux (Fig. 4). The importance of this residue in regulating KefC activity was therefore investigated. Strain MJF276/pkC11-1 (L74S) exhibited spontaneous K+ efflux, such that there was a rapid initial loss of K+ (approximately 16% of the K+ pool) followed by a slower loss of 45% of the K+ pool over 25 min (Fig. 6 A). However, given that the mutation in thekefC gene is carried on a multicopy plasmid, which leads to an approximately 20-fold increase in KefC protein (4Ferguson G.P. Munro A.W. Douglas R.M. McLaggan D. Booth I.R. Mol. Microbiol. 1993; 9: 1297-1303Crossref PubMed Scopus (74) Google Scholar), this rate of K+ loss is slow compared with the rate of spontaneous K+ efflux observed from the chromosomal KefBL75S mutant (MJF111). This observation applies to both spontaneous (Fig.6 A) and MG-elicited (Fig. 6 B) efflux. Transformants carrying pKefB-1 (L75S), a construct equivalent to pkC11-1 (KefC L74S), grew poorly in K120 medium and could not be assayed for K+ efflux. Therefore, the L75S mutation has a much greater effect on the activity of KefB than on KefC. When the L74S and HELETAID mutations were combined in KefC (plasmid pkC11-5) spontaneous K+ efflux was so rapid that at the first time point (approximately 40 s) the cells were completely depleted of K+ (Fig. 6 A). These cells grew poorly and even in K120 medium achieved a rate that was only 78% of that of MJF276/pkC11 (μ = 0.6 h−1 and 0.47 h−1, for MJF276/pkC11 and MJF276/pkC11-5 (HELETAID + L74S), respectively. Thus, L74S acted synergistically with the HELETAID mutation. These data are consistent with the effect of the L75S mutation on KefB, which naturally possesses the HELETAID motif, and suggest that these two regions are critical to maintenance of the closed state of KefB. These studies were undertaken to ascertain whether the amino acid residues critical to the regulation of two homologous K+efflux systems were the same. KefB and KefC are 601 and 620 amino acid proteins, respectively, and are 42% identical and 70% similar in their sequences. The linker regions (amino acids 380–400 in KefB) are quite diverse and the major points of sequence deviation lie in the extreme carboxyl-terminal region. In view of their overall similarity, it was reasonable to expect that they might possess common regions responsible for the regulation of their activity. KefC is maintained in an inactive state even when present on a multi-copy plasmid, except in the presence of an activating electrophile (7Munro A.W. Ritchie G.Y. Lamb A.J. Douglas R.M. Booth I.R. Mol. Microbiol. 1991; 5: 607-616Crossref PubMed Scopus (86) Google Scholar). We have documented previously a number of KefC mutations that increase the spontaneous K+ efflux via this protein (9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). The mutations substantially increased the rate of K+ loss from cells such that they could not grow in media low in K+ (K0.2) (1Booth I.R. Epstein W. Giffard P.M. Rowland G.C. Biochimie (Paris). 1985; 67: 83-90Crossref PubMed Scopus (23) Google Scholar, 9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar,15Douglas R.M. Ritchie G.Y. Munro A.W. McLaggan D. Booth I.R. Mol. Membr. Biol. 1994; 11: 55-61Crossref PubMed Scopus (9) Google Scholar). The mutations with the greatest effect on activity clustered to two sequences, the Rossman fold and HALESDIE, suggesting that these might be significant controlling regions in the protein. However, this study suggests that KefB and KefC have evolved different critical residues and that sequence conservation alone is not a guide to the identification of important sequences. The HALESDIE region is different in KefB and KefC despite strong conservation in the flanking sequences (Fig. 3). Both proteins, and the KefX proteins of H. influenzae and M. xanthus, contain three acidic residues in this sequence, but it is noteworthy that their positions are not conserved. This study aimed to analyze the relative importance of position and sequence. Cells overexpressing the KefC D264A mutation in the HALESDIE context exhibit a much more profound growth defect in K120 medium than those where the mutation is surrounded by HELETAID, which retains the three acidic residues. The rate of spontaneous K+ loss in MJF276/pkC11-3 (KefC HELETAID) is similar to that observed previously in MJF276/pSM26 (9Miller S. Douglas R. Carter P. Booth I.R. J. Biol. Chem. 1997; 272: 24942-24947Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar), which carries the kefC D264A mutation but expresses the KefC protein at an approximately 20-fold lower level. Consistent with this observation, MJF276/pkC11-2 (KefC D264A), which has high level expression of the KefC system, cannot grow in K120 medium. These data suggest that the context of the D264A mutation is a significant determinant of its impact on KefC activity and is consistent with the hypothesis that the number of acidic residues in the HALESDIE region of KefC is more important than their absolute position. Five independent UV-induced mutations causing fast spontaneous K+ leak via KefB were found to be L75S. The importance of Leu75 is consistent with the observations on the L74S/HELETAID double mutant of KefC. Combination of L74S and HELETAID in KefC resulted in spontaneous efflux characteristics, resembling those of KefB (L75S). The KefB mutation is more severe than the change in KefC, since strain MJF276/pKefB-1 (L75S) could not grow in K120 medium, whereas MJF276/pkC11-5 (KefC L74S/HELETAID) grew, albeit with a reduced growth rate. The combination of the two mutations had a synergistic effect on spontaneous K+ loss via KefC (Fig. 6 A). These data strongly suggest a possible interaction between the region surrounding L75S and the HELETAID motif that leads to the maintenance of the protein in the closed state. We are indebted to Wolf Epstein who initiated studies on KefB and isolated the original kefB mutants, to Dr. Guy Plunkett (Laboratory of Genetics, University of Wisconsin) who supplied sequence information for the kefB region prior to publication, and to Dr. Philip Carter (Department of Medical Microbiology) who supervised all the DNA sequencing.

Referência(s)