Targeting of Tumor Cells by Cell Surface Urokinase Plasminogen Activator-dependent Anthrax Toxin
2001; Elsevier BV; Volume: 276; Issue: 21 Linguagem: Inglês
10.1074/jbc.m011085200
ISSN1083-351X
AutoresShihui Liu, Thomas Bugge, Stephen H. Leppla,
Tópico(s)Bacterial Genetics and Biotechnology
ResumoUrokinase plasminogen activator receptor (uPAR) binds pro-urokinase plasminogen activator (pro-uPA) and thereby localizes it near plasminogen, causing the generation of active uPA and plasmin on the cell surface. uPAR and uPA are overexpressed in a variety of human tumors and tumor cell lines, and expression of uPAR and uPA is highly correlated to tumor invasion and metastasis. To exploit these characteristics in the design of tumor cell-selective cytotoxins, we constructed mutated anthrax toxin-protective antigen (PrAg) proteins in which the furin cleavage site is replaced by sequences cleaved specifically by uPA. These uPA-targeted PrAg proteins were activated selectively on the surface of uPAR-expressing tumor cells in the presence of pro-uPA and plasminogen. The activated PrAg proteins caused internalization of a recombinant cytotoxin, FP59, consisting of anthrax toxin lethal factor residues 1–254 fused to the ADP-ribosylation domain of Pseudomonas exotoxin A, thereby killing the uPAR-expressing tumor cells. The activation and cytotoxicity of these uPA-targeted PrAg proteins were strictly dependent on the integrity of the tumor cell surface-associated plasminogen activation system. We also constructed a mutated PrAg protein that selectively killed tissue plasminogen activator-expressing cells. These mutated PrAg proteins may be useful as new therapeutic agents for cancer treatment. Urokinase plasminogen activator receptor (uPAR) binds pro-urokinase plasminogen activator (pro-uPA) and thereby localizes it near plasminogen, causing the generation of active uPA and plasmin on the cell surface. uPAR and uPA are overexpressed in a variety of human tumors and tumor cell lines, and expression of uPAR and uPA is highly correlated to tumor invasion and metastasis. To exploit these characteristics in the design of tumor cell-selective cytotoxins, we constructed mutated anthrax toxin-protective antigen (PrAg) proteins in which the furin cleavage site is replaced by sequences cleaved specifically by uPA. These uPA-targeted PrAg proteins were activated selectively on the surface of uPAR-expressing tumor cells in the presence of pro-uPA and plasminogen. The activated PrAg proteins caused internalization of a recombinant cytotoxin, FP59, consisting of anthrax toxin lethal factor residues 1–254 fused to the ADP-ribosylation domain of Pseudomonas exotoxin A, thereby killing the uPAR-expressing tumor cells. The activation and cytotoxicity of these uPA-targeted PrAg proteins were strictly dependent on the integrity of the tumor cell surface-associated plasminogen activation system. We also constructed a mutated PrAg protein that selectively killed tissue plasminogen activator-expressing cells. These mutated PrAg proteins may be useful as new therapeutic agents for cancer treatment. amino-terminal fragment of urokinase plasminogen activator Dulbecco's modified Eagle's medium edema factor fusion protein of LF amino acids 1–254 and Pseudomonas exotoxin A domain III human umbilical vein endothelial cells lethal factor matrix metalloproteinase 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide anthrax toxin-protective antigen amino-terminal 20-kDa fragment of PrAg carboxyl-terminal 63-kDa fragment of PrAg polyacrylamide gel electrophoresis plasminogen activator inhibitor-1 plasminogen activator inhibitor-2 tissue plasminogen activator urokinase plasminogen activator urokinase plasminogen activator receptor Dissolution of the extracellular matrix is a prerequisite for invasive growth and metastatic spread of tumors as well as for physiological tissue remodeling and tissue repair. Matrix dissolution is accomplished by the concerted effort of a number of extracellular proteolytic systems, including serine, metallo-, and cysteine proteases (1Dano K. Romer J. Nielsen B.S. Bjorn S. Pyke C. Rygaard J. Lund L.R. APMIS. 1999; 107: 120-127Crossref PubMed Scopus (293) Google Scholar, 2Andreasen P.A. Egelund R. Petersen H.H. Cell Mol. Life Sci. 2000; 57: 25-40Crossref PubMed Scopus (850) Google Scholar, 3Koblinski J.E. Ahram M. Sloane B.F. Clin. Chim. Acta. 2000; 291: 113-135Crossref PubMed Scopus (517) Google Scholar). A particularly well studied proteolytic system implicated in tumor progression is the plasminogen activation system, a complex system of serine proteases, protease inhibitors, and protease receptors, that governs the conversion of the abundant plasma protease zymogen, plasminogen, to the active protease, plasmin (1Dano K. Romer J. Nielsen B.S. Bjorn S. Pyke C. Rygaard J. Lund L.R. APMIS. 1999; 107: 120-127Crossref PubMed Scopus (293) Google Scholar, 2Andreasen P.A. Egelund R. Petersen H.H. Cell Mol. Life Sci. 2000; 57: 25-40Crossref PubMed Scopus (850) Google Scholar). Plasmin is formed by the proteolytic cleavage of plasminogen by either of two plasminogen activators, the urokinase plasminogen activator (uPA)1 and the tissue plasminogen activator (tPA). uPA is a 52-kDa serine protease that is secreted as an inactive single chain proenzyme (pro-uPA) that is efficiently converted to active two-chain uPA by plasmin (4Nielsen L.S. Hansen J.G. Skriver L. Wilson E.L. Kaltoft K. Zeuthen J. Dano K. Biochemistry. 1982; 21: 6410-6415Crossref PubMed Scopus (182) Google Scholar). Two-chain uPA, in turn, is a potent activator of plasminogen, leading to a powerful feedback loop that results in productive plasmin formation. However, both pro-uPA and plasminogen are catalytically inactive pro-enzymes, and the mechanism of initiation of uPA-mediated plasminogen activation is not fully understood. Pro-uPA binds with high affinity (Kd = 0.5 nm) to a specific glycosylphosphatidylinositol-linked cell surface receptor, the uPA receptor (uPAR), via an epidermal growth factor-like amino-terminal fragment (ATF; amino acids 1–135, 15 kDa) (5Ploug M. Ellis V. Dano K. Biochemistry. 1994; 33: 8991-8997Crossref PubMed Scopus (110) Google Scholar). uPAR is a 60-kDa, three-domain glycoprotein whose first and third domains constitute a composite high affinity binding site for the ATF of pro-uPA (5Ploug M. Ellis V. Dano K. Biochemistry. 1994; 33: 8991-8997Crossref PubMed Scopus (110) Google Scholar, 6Ploug M. Ronne E. Behrendt N. Jensen A.L. Blasi F. Dano K. J. Biol. Chem. 1991; 266: 1926-1933Abstract Full Text PDF PubMed Google Scholar, 7Behrendt N. Ploug M. Patthy L. Houen G. Blasi F. Dano K. J. Biol. Chem. 1991; 266: 7842-7847Abstract Full Text PDF PubMed Google Scholar, 8Ploug M. Ostergaard S. Hansen L.B. Holm A. Dano K. Biochemistry. 1998; 37: 3612-3622Crossref PubMed Scopus (81) Google Scholar). The concomitant binding of pro-uPA to uPAR, and of plasminogen to as yet uncharacterized cell surface receptors, strongly potentiates uPA-mediated plasminogen activation (9Ellis V. Scully M.F. Kakkar V.V. J. Biol. Chem. 1989; 264: 2185-2188Abstract Full Text PDF PubMed Google Scholar, 10Stephens R.W. Pollanen J. Tapiovaara H. Leung K.C. Sim P.S. Salonen E.M. Ronne E. Behrendt N. Dano K. Vaheri A. J. Cell Biol. 1989; 108: 1987-1995Crossref PubMed Scopus (303) Google Scholar, 11Ellis V. Behrendt N. Dano K. J. Biol. Chem. 1991; 266: 12752-12758Abstract Full Text PDF PubMed Google Scholar, 12Ronne E. Behrendt N. Ellis V. Ploug M. Dano K. Hoyer-Hansen G. FEBS Lett. 1991; 288: 233-236Crossref PubMed Scopus (184) Google Scholar), possibly due to the formation of ternary complexes, aligning the two proenzymes in a way that exploits their low intrinsic activity and thereby favors a mutual activation process (13Ellis V. Dano K. J. Biol. Chem. 1993; 268: 4806-4813Abstract Full Text PDF PubMed Google Scholar). The net result of this process is the efficient and localized generation of active uPA and plasmin on the cell surface. Although many studies have documented the central role of uPA-mediated cell-surface plasminogen activation requiring uPAR, recent studies in uPAR-deficient mice have demonstrated the existence of additional, uPAR-independent pathways of uPA-mediated plasminogen activation, in the context of both physiological cell migration and fibrin dissolution (14Bugge T.H. Flick M.J. Danton M.J. Daugherty C.C. Romer J. Dano K. Carmeliet P. Collen D. Degen J.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5899-5904Crossref PubMed Scopus (238) Google Scholar, 15Carmeliet P. Moons L. Dewerchin M. Rosenberg S. Herbert J.M. Lupu F. Collen D. J. Cell Biol. 1998; 140: 233-245Crossref PubMed Scopus (117) Google Scholar). uPAR and uPA are overexpressed with remarkable consistency in malignant human tumors, including monocytic and myelogenous leukemias (16Plesner T. Ralfkiaer E. Wittrup M. Johnsen H. Pyke C. Pedersen T.L. Hansen N.E. Dano K. Am. J. Clin. Pathol. 1994; 102: 835-841Crossref PubMed Scopus (107) Google Scholar, 17Lanza F. Castoldi G.L. Castagnari B. Todd III, R.F. Moretti S. Spisani S. Latorraca A. Focarile E. Roberti M.G. Traniello S. Br. J. Haematol. 1998; 103: 110-123Crossref PubMed Scopus (56) Google Scholar) and cancers of the colon (18Pyke C. Kristensen P. Ralfkiaer E. Grondahl-Hansen J. Eriksen J. Blasi F. Dano K. Am. J. Pathol. 1991; 138: 1059-1067PubMed Google Scholar), breast (19Carriero M.V. Del Vecchio S. Franco P. Potena M.I. Chiaradonna F. Botti G. Stoppelli M.P. Salvatore M. Clin. Cancer Res. 1997; 3: 1299-1308PubMed Google Scholar), bladder (20Hudson M.A. McReynolds L.M. J. Natl. Cancer Inst. 1997; 89: 709-717Crossref PubMed Scopus (50) Google Scholar), thyroid (21Ragno P. Montuori N. Covelli B. Hoyer-Hansen G. Rossi G. Cancer Res. 1998; 58: 1315-1319PubMed Google Scholar), liver (22De Petro G. Tavian D. Copeta A. Portolani N. Giulini S.M. Barlati S. Cancer Res. 1998; 58: 2234-2239PubMed Google Scholar), pleura (23Shetty S. Idell S. Arch. Biochem. Biophys. 1998; 356: 265-279Crossref PubMed Scopus (33) Google Scholar), lung (24Morita S. Sato A. Hayakawa H. Ihara H. Urano T. Takada Y. Takada A. Int. J. Cancer. 1998; 78: 286-292Crossref PubMed Scopus (63) Google Scholar), pancreas (25Taniguchi T. Kakkar A.K. Tuddenham E.G. Williamson R.C. Lemoine N.R. Cancer Res. 1998; 58: 4461-4467PubMed Google Scholar), ovaries (26Sier C.F. Stephens R. Bizik J. Mariani A. Bassan M. Pedersen N. Frigerio L. Ferrari A. Dano K. Brunner N. Blasi F. Cancer Res. 1998; 58: 1843-1849PubMed Google Scholar), and the head and neck (27Schmidt M. Hoppe F. Acta Otolaryngol. 1999; 119: 949-953Crossref PubMed Scopus (25) Google Scholar). Extensive in situ hybridization and immunohistochemical studies of various human tumor types have demonstrated that cancer cells typically express uPAR, whereas pro-uPA may be expressed by either the cancer cells or by adjacent stromal cells (18Pyke C. Kristensen P. Ralfkiaer E. Grondahl-Hansen J. Eriksen J. Blasi F. Dano K. Am. J. Pathol. 1991; 138: 1059-1067PubMed Google Scholar, 28Pyke C. Ralfkiaer E. Ronne E. Hoyer-Hansen G. Kirkeby L. Dano K. Histopathology. 1994; 24: 131-138Crossref PubMed Scopus (108) Google Scholar, 29Nielsen B.S. Sehested M. Timshel S. Pyke C. Dano K. Lab. Invest. 1996; 74: 168-177PubMed Google Scholar). Plasminogen activation by uPA is regulated by two physiological inhibitors, plasminogen activator inhibitors-1 and -2 (PAI-1 and PAI-2) (30Cubellis M.V. Andreasen P. Ragno P. Mayer M. Dano K. Blasi F. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4828-4832Crossref PubMed Scopus (173) Google Scholar, 31Ellis V. Wun T.C. Behrendt N. Ronne E. Dano K. J. Biol. Chem. 1990; 265: 9904-9908Abstract Full Text PDF PubMed Google Scholar, 32Baker M.S. Bleakley P. Woodrow G.C. Doe W.F. Cancer Res. 1990; 50: 4676-4684PubMed Google Scholar), each forming a 1:1 complex with uPA. Plasmin generated by the cell surface plasminogen activation system is relatively protected from its primary physiological inhibitor α2-antiplasmin (11Ellis V. Behrendt N. Dano K. J. Biol. Chem. 1991; 266: 12752-12758Abstract Full Text PDF PubMed Google Scholar,33Plow E.F. Freaney D.E. Plescia J. Miles L.A. J. Cell Biol. 1986; 103: 2411-2420Crossref PubMed Scopus (388) Google Scholar, 34Hall S.W. Humphries J.E. Gonias S.L. J. Biol. Chem. 1991; 266: 12329-12336Abstract Full Text PDF PubMed Google Scholar). Unlike uPA, plasmin is a relatively nonspecific protease, capable of degrading fibrin and several other glycoproteins and proteoglycans of the extracellular matrix (35Liotta L.A. Goldfarb R.H. Brundage R. Siegal G.P. Terranova V. Garbisa S. Cancer Res. 1981; 41: 4629-4636PubMed Google Scholar). Therefore, cell surface plasminogen activation facilitates invasion and metastasis of tumor cells by dissolution of restraining tissue barriers. In addition, cell surface plasminogen activation may facilitate matrix degradation through the activation of latent matrix metalloproteinases (MMP) (36Werb Z. Mainardi C.L. Vater C.A. Harris Jr., E.D. N. Engl. J. Med. 1977; 296: 1017-1023Crossref PubMed Scopus (554) Google Scholar). Plasmin can also activate growth factors, such as transforming growth factor-β, which may further modulate stromal interactions in the expression of enzymes and tumor neo-angiogenesis (37Mignatti P. Rifkin D.B. Enzyme Protein. 1996; 49: 117-137Crossref PubMed Scopus (294) Google Scholar). Another protein that requires cell surface proteolytic activation is anthrax toxin. This three-component toxin consists of protective antigen (PrAg, 83 kDa), lethal factor (LF, 90 kDa), and edema factor (EF, 90 kDa) (38Smith H. Stanley J.L. J. Gen. Microbiol. 1962; 29: 517-521Crossref PubMed Scopus (32) Google Scholar, 39Leppla S.H. Iglewski B.J. Vaughan M. Tu A. Bacterial Toxins and Virulence Factors in Disease. Handbook of Natural Toxins. 8. Marcel Dekker, Inc., New York1995: 543-572Google Scholar, 40Leppla S.H. Alouf J.E. Freer J.H. Comprehensive Sourcebook of Bacterial Protein Toxins. Academic Press, London1999: 243-263Google Scholar). PrAg binds to an unidentified cell surface receptor and is cleaved at the sequence,164RKKR167, by a cell-surface, furin-like protease (41Molloy S.S. Bresnahan P.A. Leppla S.H. Klimpel K.R. Thomas G. J. Biol. Chem. 1992; 267: 16396-16402Abstract Full Text PDF PubMed Google Scholar, 42Klimpel K.R. Molloy S.S. Thomas G. Leppla S.H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10277-10281Crossref PubMed Scopus (409) Google Scholar). This cleavage is absolutely required for the subsequent steps in toxin action. The carboxyl-terminal 63-kDa fragment (PrAg63) remains bound to receptor, associates to form a heptamer, and binds and internalizes LF and EF (40Leppla S.H. Alouf J.E. Freer J.H. Comprehensive Sourcebook of Bacterial Protein Toxins. Academic Press, London1999: 243-263Google Scholar, 43Milne J.C. Furlong D. Hanna P.C. Wall J.S. Collier R.J. J. Biol. Chem. 1994; 269: 20607-20612Abstract Full Text PDF PubMed Google Scholar, 44Leppla S.H. Friedlander A.M. Cora E. Fehrenbach F. Alouf J.E. Falmagne P. Goebel W. Jeljaszewicz J. Jurgen D. Rappouli R. Bacterial Protein Toxins. Gustav Fischer, New York1988: 111-112Google Scholar, 45Benson E.L. Huynh P.D. Finkelstein A. Collier R.J. Biochemistry. 1998; 37: 3941-3948Crossref PubMed Scopus (162) Google Scholar). LF kills animals (46Beall F.A. Taylor M.J. Thorne C.B. J. Bacteriol. 1962; 83: 1274-1280Crossref PubMed Google Scholar, 47Ezzell J.W. Ivins B.E. Leppla S.H. Infect. Immun. 1984; 45: 761-767Crossref PubMed Google Scholar) and lyses mouse macrophages (48Friedlander A.M. J. Biol. Chem. 1986; 261: 7123-7126Abstract Full Text PDF PubMed Google Scholar, 49Hanna P.C. Kochi S. Collier R.J. Mol. Biol. Cell. 1992; 3: 1269-1277Crossref PubMed Scopus (79) Google Scholar), probably due to the proteolytic cleavage of mitogen-activated protein kinase kinases (50Duesbery N.S. Webb C.P. Leppla S.H. Gordon V.M. Klimpel K.R. Copeland T.D. Ahn N.G. Oskarsson M.K. Fukasawa K. Paull K.D. Vande Woude G.F. Science. 1998; 280: 734-737Crossref PubMed Scopus (898) Google Scholar, 51Vitale G. Pellizzari R. Recchi C. Napolitani G. Mock M. Montecucco C. Biochem. Biophy. Res. Commun. 1998; 248: 706-711Crossref PubMed Scopus (363) Google Scholar). EF damages cells due to its intracellular adenylate cyclase activity (52Leppla S.H. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 3162-3166Crossref PubMed Scopus (773) Google Scholar). A potent PrAgdependent cytotoxin, FP59, created by fusing LF amino acids 1–254 to the ADP-ribosylation domain of Pseudomonas exotoxin A can kill any cell having receptors for PrAg and the ability to activate PrAg by cleavage at amino acids 164–167 (53Arora N. Klimpel K.R. Singh Y. Leppla S.H. J. Biol. Chem. 1992; 267: 15542-15548Abstract Full Text PDF PubMed Google Scholar, 54Arora N. Leppla S.H. J. Biol. Chem. 1993; 268: 3334-3341Abstract Full Text PDF PubMed Google Scholar). The unique requirement that PrAg be activated on the target cell surface provides an opportunity to re-engineer this protein to make its activation dependent on the tumor cell surface urokinase plasminogen activation system. Our previous work showed that PrAg can be made specific for MMP-expressing cells by replacing the164RKKR167 furin site with sequences preferentially cleaved by MMPs (55Liu S. Netzel-Arnett S. Birkedal-Hansen H. Leppla S.H. Cancer Res. 2000; 60: 6061-6067PubMed Google Scholar). In this report we extended this approach to exploit the localized activity of the uPA protease on tumor cells. uPA and tPA possess an extremely high degree of structural similarity (56Spraggon G. Phillips C. Nowak U.K. Ponting C.P. Saunders D. Dobson C.M. Stuart D.I. Jones E.Y. Structure. 1995; 3: 681-691Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar, 57Lamba D. Bauer M. Huber R. Fischer S. Rudolph R. Kohnert U. Bode W. J. Mol. Biol. 1996; 258: 117-135Crossref PubMed Scopus (123) Google Scholar), share the same primary physiological substrate (plasminogen) and inhibitors (PAI-1 and PAI-2) (58Collen D. Lijnen H.R. Blood. 1991; 78: 3114-3124Crossref PubMed Google Scholar), and exhibit restricted substrate specificity. Recent elegant genetic studies using substrate phage display and substrate subtraction phage display identified peptide substrates that are cleaved with high efficiency as well as high selectivity by either uPA or tPA (59Ke S.H. Coombs G.S. Tachias K. Corey D.R. Madison E.L. J. Biol. Chem. 1997; 272: 20456-20462Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar, 60Ke S.H. Coombs G.S. Tachias K. Navre M. Corey D.R. Madison E.L. J. Biol. Chem. 1997; 272: 16603-16609Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). We used the amino acid sequences defined in that work to replace the furin cleavage site in PrAg to produce several mutated PrAg proteins susceptible to cleavage by uPA and tPA. These uPA- and tPA-targeted PrAg proteins were activated selectively on the surface of tumor cells and caused their killing by the recombinant cytotoxin FP59, as described below. FP59 and a soluble form of furin were prepared as described previously (61Gordon V.M. Benz R. Fujii K. Leppla S.H. Tweten R.K. Infect. Immun. 1997; 65: 4130-4134Crossref PubMed Google Scholar). Rabbit anti-PrAg polyclonal antiserum (serum no. 5308) was made in our laboratory. Reagents obtained from American Diagnostica Inc. (Greenwich, CT) included pro-uPA (single-chain uPA, no. 107), uPA (no. 124), tPA (no. 116), human urokinase amino-terminal fragment (ATF, no. 146), human Glu-plasminogen (no. 410), human PAI-1 (no. 1094), α2-antiplasmin (no. 4030), monoclonal antibody against human uPA B-chain (no. 394), and goat polyclonal antibody against human t-PA (no. 387). tPA not containing protein stabilizer was purchased from Calbiochem (San Diego, CA). Aprotinin and tranexamic acid were purchased from Sigma Chemical Co. (St. Louis, MO). The uPAR monoclonal antibody R3 was a gift from Dr. Gunilla Høyer Hansen (Finsen Laboratory, Copenhagen, Denmark). A modified overlap PCR method was used to construct the mutated PrAg proteins in which the furin site is replaced by: 1) the plasminogen-derived sequence PCPGRVVGG in PrAg-U1; 2) the preferred uPA substrate sequences PGSGRSA and PGSGKSA in PrAg-U2 and PrAg-U3, respectively; and 3) the preferred tPA sequence PQRGRSA in PrAg-U4 (Table I). Plasmid pYS5 (62Singh Y. Chaudhary V.K. Leppla S.H. J. Biol. Chem. 1989; 264: 19103-19107Abstract Full Text PDF PubMed Google Scholar) was used as both PCR template and expression vector. The nativePfu DNA polymerase (Stratagene, La Jolla, CA) was used in the PCR reactions. We used 5′-primer F,AAAGGAGAACGTATATGA (Shine-Dalgarno and start codons are underlined), and the phosphorylated reverse primer R1, pTGGTGAGTTCGAAGATTTTTGTTTTAATTCTGG (the first three nucleotides encodes P, the others anneal to the sequence corresponding to P154 to S163), to amplify a fragment designated "N." We used the mutagenic phosphorylated primer H1, pTGTCCAGGAAGAGTAGTTGGAGGAAGTACAAGTGCTGGACCTACGGTTCCAG, encoding CPGRVVGG and S168 to P176, and reverse primer R2, ACGTTTATCTCTTATTAAAAT, annealing to the sequence encoding I589 to R595, to amplify a mutagenic fragment "M1." We used a phosphorylated mutagenic primer H2, pGGAAGTGGAAGATCAGCAAGTACAAGTGCTGGACCTACGGTTCCAG, encoding GSGRSA and S168 to P176, and reverse primer R2, to amplify a mutagenic fragment "M2." We used a phosphorylated mutagenic primer H3, pGGAAGTGGAAAATCAGCAAGTACAAGTGCTGGACCTACGGTTCCAG, encoding GSGKSA and S168 to P176, and reverse primer R2, to amplify a mutagenic fragment "M3." We used a phosphorylated mutagenic primer H4, pCAGAGAGGAAGATCAGCAAGTACAAGTGCTGGACCTACGGTTCCAG, encoding QRGRSA and S168 to P176, and reverse primer R2, to amplify a mutagenic fragment "M4." Primers F and R2 were used to amplify the ligated products of N + M1, N + M2, N + M3, and N + M4, respectively, resulting in the mutagenized fragments U1, U2, U3, and U4 in which the coding sequence for the furin site (164RKKR167) is replaced by uPA or tPA substrate sequence. The 670-bp HindIII/PstI fragments from the digests of U1, U2, U3, and U4 were cloned between the HindIII and PstI sites of pYS5. The resulting mutated PrAg proteins were accordingly named PrAg-U1, PrAg-U2, PrAg-U3, and PrAg-U4. We also constructed a mutated PrAg protein, PrAg-U7, in which 164RKKR167 is replaced by the sequence PGG. This protein is expected to be resistant to all cell surface proteases. DNA sequencing analyses confirmed the sequences of the mutated PrAg constructs.Table IPredicted and observed properties of mutated PA proteinsProteinSequence at the "furin loop"kcat/Kmfor sequenceaData from Ref. 59, which was obtained from the studies on the peptides underlined in column 2.uPA:tPA selectivityaData from Ref. 59, which was obtained from the studies on the peptides underlined in column 2.Protease expected to cleaveToxicity to cultured cells, EC50bAssays on HeLa, A2058, and 293 cells were done in the presence of 100 ng/ml pro-uPA and 1 μg/ml Glu-plasminogen. Assays on HUVEC and Bowes cells were done without these additions. Arrows indicate the cleavage sites.uPAtPAHeLaA2058293HUVECBowesng/mlPrAgNS RKKR↑ STSAGPTVFurin121015 1000>1000>1000PrAg-U2NSPGSGR↑SA STSAGPTV12006020uPA1413>1000>1000600PrAg-U3NSPGSGK↑SA STSAGPTV1931.6121uPA3018>1000>1000>1000PrAg-U4NSPORGR↑SA STSAGPTV7.36700.005tPA20050>10002512PrAg-U7NSPGG STSAGPTVNonea Data from Ref. 59Ke S.H. Coombs G.S. Tachias K. Corey D.R. Madison E.L. J. Biol. Chem. 1997; 272: 20456-20462Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar, which was obtained from the studies on the peptides underlined in column 2.b Assays on HeLa, A2058, and 293 cells were done in the presence of 100 ng/ml pro-uPA and 1 μg/ml Glu-plasminogen. Assays on HUVEC and Bowes cells were done without these additions. Arrows indicate the cleavage sites. Open table in a new tab Plasmids encoding the constructs described above were transformed into the non-virulent strain Bacillus anthracisUM23C1-1, and transformants were grown in FA medium (62Singh Y. Chaudhary V.K. Leppla S.H. J. Biol. Chem. 1989; 264: 19103-19107Abstract Full Text PDF PubMed Google Scholar) with 20 μg/ml kanamycin for 16 h at 37 °C. The mutated PrAg proteins were concentrated from the culture supernatants and purified by chromatography on a MonoQ column (Amersham Pharmacia Biotech, Piscataway, NJ) by the methods described previously (63Varughese M. Chi A. Teixeira A.V. Nicholls P.J. Keith J.M. Leppla S.H. Mol. Med. 1998; 4: 87-95Crossref PubMed Google Scholar). Reaction mixtures of 50 μl containing 5 μg of the PrAg proteins were incubated at 37 °C with 5 μl of soluble furin or 0.5 μg of uPA or tPA. Furin cleavage was done as described previously (55Liu S. Netzel-Arnett S. Birkedal-Hansen H. Leppla S.H. Cancer Res. 2000; 60: 6061-6067PubMed Google Scholar). Cleavage with uPA or tPA was done in 150 mm NaCl, 10 mm Tris-HCl (pH 7.5). Aliquots withdrawn at intervals were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) using 4–20% gradient Tris-glycine gels (Novex, San Diego, CA), and proteins were either visualized by Coomassie Blue staining or were electroblotted to a nitrocellulose membrane (Novex). Membranes were blocked with 5% (w/v) non-fat milk, incubated sequentially with rabbit anti-PrAg polyclonal antibody (no. 5308) and horseradish peroxidase-conjugated goat anti-rabbit antibody (sc-2004, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), and visualized by detection of horseradish peroxidase by SuperSignal West Pico chemiluminescent substrate (Pierce, Rockford, IL). To verify the cleavage sites, digestions of native PrAg by furin, PrAg-U2 and-U3 by uPA, and PrAg-U4 by tPA (Calbiochem) were performed for 3 h at 37 °C as described above. Then the resulting PrAg63s were separated by SDS-NuPAGE electrophoresis (Novex), and the proteins were transferred onto Immobilon-P polyvinylidene difluoride membranes (Millipore, Bedford, MA) and visualized by Coomassie Blue staining. The protein bands were cut out and sequenced by the Protein and Nucleic Acid Laboratory, Center for Biologics Evaluation and Research, FDA using an ABI model 494A protein sequencer. Human 293 kidney cells, human cervix adenocarcinoma HeLa cells, human melanoma A2058 cells, and human melanoma Bowes cells were obtained from American Type Culture Collection (Manassas, VA). Mouse Lewis lung carcinoma cell line LL3 was kindly provided by Dr. Michael S. O'Reilly (Boston, MA). These cells were grown in Dulbecco's modified Eagle's medium (DMEM) with 0.45% glucose, 10% fetal bovine serum (FCS), 2 mm glutamine, and 50 μg/ml gentamicin. Human umbilical vein endothelial cells (HUVEC) were obtained from Clonetics Corp. (Walkersville, MD) and were grown in RPMI 1640 containing 20% defined and supplemented bovine calf serum (HyClone Laboratories, Inc, Logan, UT), 5 units/ml heparin (Fisher Scientific, Pittsburgh, PA), 100 units/ml penicillin, and 0.2 mg/ml endothelial cell growth supplement (Collaborative Research), 100 μg/ml streptomycin, 50 μg/ml gentamicin, and 2.5 μg/ml amphotericin B (Life Technologies, Rockville, MD). Cells were maintained at 37 °C in a 5% CO2 environment. Cells were cultured in 96-well plates to ∼50% confluence and washed twice with serum-free DMEM to remove residual serum. Then the cells were preincubated for 30 min with serum-free DMEM containing 100 ng/ml pro-uPA and 1 μg/ml Glu-plasminogen with or without PAI-1, aprotinin, α2-antiplasmin, ATF, or the uPAR blocking antibody R3. PrAg proteins (0–1000 ng/ml) combined with FP59 (50 ng/ml) were added to the cells to give a total volume of 200 μl/well. Cells were incubated with the toxins for 6 h, after which the medium was replaced with fresh DMEM supplemented with 10% fetal calf serum. Cell viability was assayed by adding 50 μl of 2.5 mg/ml MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) at 48 h. The cells were incubated with MTT for 45 min at 37 °C, the medium was removed, and the blue pigment produced by viable cells was dissolved in 100 μl/well of 0.5% (w/v) SDS, 25 mmHCl, in 90% (v/v) isopropanol. The plates were vortexed and the oxidized MTT was measured as A570 using a microplate reader. Cells were cultured in 24-well plates to confluence, washed, and incubated in serum-free DMEM with 1 μg/ml pro-uPA, 1 μg/ml PrAg-U2, and 1 μg/ml Glu-plasminogen, and 2 mg/ml bovine serum albumin (BSA) at 37 °C for various lengths of times. The cells were washed five times to remove unbound pro-uPA and PrAg-U2. When PAI-1 was tested, it was incubated with cells for 30 min prior to the addition of pro-uPA and PrAg-U2. When tranexamic acid was tested, cells were preincubated with serum-free DMEM containing 2 mg/ml BSA, 1 mm tranexamic acid, without plasminogen, for 30 min before the addition of pro-uPA and PrAg-U2. Cells were lysed in 100 μl/well of modified radioimmune precipitation lysis buffer (50 mmTris-HCl, pH 7.4, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mm NaCl, 1 mm EDTA, 1 mmphenylmethylsulfonyl fluoride, 1 μg/ml each of aprotinin, leupeptin, and pepstatin) on ice for 10 min. Equal amounts of protein from cell lysates and equal volumes of the conditioned media were separated by PAGE using 4–20% gradient Tris-glycine gels (Novex). Western blotting was performed as described above to detect pro-uPA and PrAg-U2 and their cleavage products by using the monoclonal antibody against human uPA B-chain (no. 394) and anti-PrAg polyclonal antibody (no. 5308). A co-culture model like that described previously (55Liu S. Netzel-Arnett S. Birkedal-Hansen H. Leppla S.H. Cancer Res. 2000; 60: 6061-6067PubMed Google Scholar) was employed to determine whether PrAg-U2 killed uPAR-overexpressing tumor cells without affecting bystander, uPAR non-expressing cells. Briefly, HeLa and 293 cells were co-cultured in separate compartments of eight-chamber slides. With the partitions removed, the culture slides were incubated for 6 h with native PrAg or PrAg-U2 (each 300 ng/ml) combined with FP59 (50 ng/ml) in serum-free DMEM containing 100 ng/ml pro-uPA and 1 μg/ml Glu-pla
Referência(s)