The Molecular Mechanism of Lead Inhibition of Human Porphobilinogen Synthase
2001; Elsevier BV; Volume: 276; Issue: 2 Linguagem: Inglês
10.1074/jbc.m007663200
ISSN1083-351X
AutoresEileen K. Jaffe, Jacob Martins, Jian Li, Jukka Kervinen, Roland L. Dunbrack,
Tópico(s)Arsenic contamination and mitigation
ResumoHuman porphobilinogen synthase (PBGS) is a main target in lead poisoning. Human PBGS purifies with eight Zn(II) per homo-octamer; four ZnA have predominantly nonsulfur ligands, and four ZnB have predominantly sulfur ligands. Only four Zn(II) are required for activity. To better elucidate the roles of Zn(II) and Pb(II), we produced human PBGS mutants that are designed to lack either the ZnA or ZnB sites. These proteins, MinusZnA (H131A, C223A) and MinusZnB (C122A, C124A, C132A), each become purified with four Zn(II) per octamer, thus confirming an asymmetry in the human PBGS structure. MinusZnA is fully active, whereas MinusZnB is far less active, verifying an important catalytic role for ZnB and the removed cysteine residues. Kinetic properties of the mutants and wild type proteins are described. Comparison of Pb(II) inhibition of the mutants shows that ligands to both ZnA and ZnB interact with Pb(II). The ZnB ligands preferentially interact with Pb(II). At least one ZnA ligand is responsible for the slow tight binding behavior of Pb(II). The data support a novel model where a high affinity lead site is a hybrid of the ZnA and ZnB sites. We propose that the lone electron pair of Pb(II) precludes Pb(II) to function in PBGS catalysis. Human porphobilinogen synthase (PBGS) is a main target in lead poisoning. Human PBGS purifies with eight Zn(II) per homo-octamer; four ZnA have predominantly nonsulfur ligands, and four ZnB have predominantly sulfur ligands. Only four Zn(II) are required for activity. To better elucidate the roles of Zn(II) and Pb(II), we produced human PBGS mutants that are designed to lack either the ZnA or ZnB sites. These proteins, MinusZnA (H131A, C223A) and MinusZnB (C122A, C124A, C132A), each become purified with four Zn(II) per octamer, thus confirming an asymmetry in the human PBGS structure. MinusZnA is fully active, whereas MinusZnB is far less active, verifying an important catalytic role for ZnB and the removed cysteine residues. Kinetic properties of the mutants and wild type proteins are described. Comparison of Pb(II) inhibition of the mutants shows that ligands to both ZnA and ZnB interact with Pb(II). The ZnB ligands preferentially interact with Pb(II). At least one ZnA ligand is responsible for the slow tight binding behavior of Pb(II). The data support a novel model where a high affinity lead site is a hybrid of the ZnA and ZnB sites. We propose that the lone electron pair of Pb(II) precludes Pb(II) to function in PBGS catalysis. porphobilinogen synthase 5-aminolevulinic acid 2-mercaptoethanol extended x-ray absorption fine structure matrix-assisted laser desorption ionization time-of-flight 2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acid Porphobilinogen synthase (PBGS,1 EC 4.2.1.24, also known as 5-aminolevulinic acid dehydratase), an enzyme that functions in the first common step in tetrapyrrole biosynthesis (e.g.heme and chlorophyll), is a highly conserved protein throughout evolution but has significant phylogenetic variation in the number and types of metal ions that function in catalysis or at allosteric sites (1Jaffe E.K. Acta Crystallogr. Sect. D Biol. Crystallogr. 2000; 56: 115-128Crossref PubMed Scopus (95) Google Scholar). The human PBGS protein and its metal binding properties are of particular interest, because human PBGS is a primary target for the environmental toxin lead (2Warren M.J. Cooper J.B. Wood S.P. Shoolingin-Jordan P.M. Trends Biochem. Sci. 1998; 23: 217-221Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). Past studies using yeast PBGS as a model for human lead poisoning are limited because of a phylogenetic difference in the metal binding stoichiometries of yeast and human PBGS (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 4Senior N.M. Brocklehurst K. Cooper J.B. Wood S.P. Erskine P. Shoolingin-Jordan P.M. Thomas P.G. Warren M.J. Biochem. J. 1996; 320: 401-412Crossref PubMed Scopus (55) Google Scholar). There are two codominant alleles, ALAD1 and ALAD2, which encode the human PBGS variants at position 59, K59 and N59, respectively. Recent data on the isolated K59 and N59 proteins do not support the epidemiological data that has correlated these alleles with a differential susceptibility to lead poisoning (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 5Wetmur J.G. Lehnert G. Desnick R.J. Environ. Res. 1991; 56: 109-119Crossref PubMed Scopus (140) Google Scholar). All PBGS proteins appear to be homo-octamers, and there is evidence for and against half-sites reactivity, including cases where any one type of metal is bound at four per octamer (e.g. Refs. 6Cheh A. Neilands J.B. Biochem. Biophys. Res. Commun. 1973; 55: 1060-1063Crossref PubMed Scopus (59) Google Scholar, 7Bevan D.R. Bodlaender P. Shemin D. J. Biol. Chem. 1980; 255: 2030-2035Abstract Full Text PDF PubMed Google Scholar, 8Dent A.J. Beyersmann D. Block C. Hasnain S.S. Biochemistry. 1990; 29: 7822-7828Crossref PubMed Scopus (77) Google Scholar, 9Petrovich R.M. Litwin S. Jaffe E.K. J. Biol. Chem. 1996; 271: 8692-8699Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 10Frankenberg N. Jahn D. Jaffe E.K. Biochemistry. 1999; 38: 13976-13982Crossref PubMed Scopus (25) Google Scholar). Mammalian PBGS enzymes purify with Zn(II) bound at a stoichiometry of eight per octamer (6Cheh A. Neilands J.B. Biochem. Biophys. Res. Commun. 1973; 55: 1060-1063Crossref PubMed Scopus (59) Google Scholar, 7Bevan D.R. Bodlaender P. Shemin D. J. Biol. Chem. 1980; 255: 2030-2035Abstract Full Text PDF PubMed Google Scholar, 11Jaffe E.K. Salowe S.P. Chen N.T. DeHaven P.A. J. Biol. Chem. 1984; 259: 5032-5036Abstract Full Text PDF PubMed Google Scholar). Only four Zn(II) appear to be tightly bound and only four Zn(II) appear to be required for full catalytic activity of human PBGS (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar), consistent with data on bovine PBGS (6Cheh A. Neilands J.B. Biochem. Biophys. Res. Commun. 1973; 55: 1060-1063Crossref PubMed Scopus (59) Google Scholar, 7Bevan D.R. Bodlaender P. Shemin D. J. Biol. Chem. 1980; 255: 2030-2035Abstract Full Text PDF PubMed Google Scholar,11Jaffe E.K. Salowe S.P. Chen N.T. DeHaven P.A. J. Biol. Chem. 1984; 259: 5032-5036Abstract Full Text PDF PubMed Google Scholar, 12Jaffe E.K. Abrams W.R. Kaempfen H.X. Harris Jr., K.A. Biochemistry. 1992; 31: 2113-2123Crossref PubMed Scopus (46) Google Scholar). Preliminary data obtained on human PBGS show that Pb(II) can displace about half the enzyme-bound Zn(II) (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). There are two outstanding questions in the structure and mechanism of human PBGS: 1) Which of the two types of Zn(II) corresponds to the four Zn(II) that are essential for the activity of mammalian PBGS? and 2) What extent do the two Zn(II) sites play in the Pb(II) inhibition of enzyme activity? The crystal structure of yeast PBGS (Protein Data Bank code law5) revealed Zn(II) at two different sites with ligands that are consistent with prior chemical modification data (12Jaffe E.K. Abrams W.R. Kaempfen H.X. Harris Jr., K.A. Biochemistry. 1992; 31: 2113-2123Crossref PubMed Scopus (46) Google Scholar, 13Jaffe E.K. Volin M. Myers C.B. Abrams W.R. Biochemistry. 1994; 33: 11554-11562Crossref PubMed Scopus (28) Google Scholar). In the crystal structure, the two Zn(II) sites were not fully occupied (14Erskine P.T. Senior N. Awan S. Lambert R. Lewis G. Tickle I.J. Sarwar M. Spencer P. Thomas P. Warren M.J. Shoolingin-Jordan P.M. Wood S.P. Cooper J.B. Nat. Struct. Biol. 1997; 4: 1025-1031Crossref PubMed Scopus (133) Google Scholar). The most highly populated Zn(II) site shows the metal bound to a cluster of cysteine residues, which in the human protein correspond to Cys-122, Cys-124, and Cys-132. The Zn(II) that binds to this cysteine-rich site is defined as ZnB (8Dent A.J. Beyersmann D. Block C. Hasnain S.S. Biochemistry. 1990; 29: 7822-7828Crossref PubMed Scopus (77) Google Scholar). Although ZnB is 8 Å from an active site lysine, its coordination environment more closely resembles structural rather than catalytic Zn(II). A lesser-populated Zn(II) site of yeast PBGS was only seen in a difference map and shows Zn(II) with an incomplete coordination shell consisting of one histidine and one cysteine, which in the human protein correspond to His-131 and Cys-223. The Zn(II) that binds to this site is known as ZnA (8Dent A.J. Beyersmann D. Block C. Hasnain S.S. Biochemistry. 1990; 29: 7822-7828Crossref PubMed Scopus (77) Google Scholar). Although these ligands are typical of catalytic Zn(II), the low occupancy and 12-Å distance from a Schiff base-forming lysine indicate ZnA to be of questionable significance in the PBGS reaction mechanism (14Erskine P.T. Senior N. Awan S. Lambert R. Lewis G. Tickle I.J. Sarwar M. Spencer P. Thomas P. Warren M.J. Shoolingin-Jordan P.M. Wood S.P. Cooper J.B. Nat. Struct. Biol. 1997; 4: 1025-1031Crossref PubMed Scopus (133) Google Scholar). Because yeast PBGS can bind 16 Zn(II) per octamer (4Senior N.M. Brocklehurst K. Cooper J.B. Wood S.P. Erskine P. Shoolingin-Jordan P.M. Thomas P.G. Warren M.J. Biochem. J. 1996; 320: 401-412Crossref PubMed Scopus (55) Google Scholar), which is twice as much as human PBGS (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar), a homology model for human PBGS must accommodate this difference in stoichiometry. Our current model contains ZnA and ZnB bound to each of four subunits, whereas the other four subunits contain no metal ions (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). A picture of the Zn(II) sites of the human PBGS model is presented in Fig.1, where adjacent amino acids are seen as ligands to ZnA (His-131) and ZnB (Cys-132). We propose that this is the basis for communication between the two metal sites. To test this model, the current work addresses the stoichiometry and function of ZnA and ZnB by use of mutagenesis to remove (or incapacitate) each of the two sites to create the mutants here called MinusZnA and MinusZnB. The former is designed to bind only four ZnB, and the latter is designed to bind only four ZnA. We present a kinetic characterization of MinusZnA in comparison to the wild type human PBGS proteins K59, N59, K59/C162A, and N59/C162A, the latter of which is the parent of MinusZnA and MinusZnB. The C162A mutation was introduced to avoid a non-native disulfide and is shown to be benign. Less comprehensive data are presented for the relatively inactive MinusZnB. This work shows that Pb(II) can interact with human PBGS in at least two different ways, consistent with the interpretation of the yeast PBGS crystal structure complexed with Pb(II). However, interaction of Pb(II) with a ZnA ligand could not have been predicted from the crystal structure. Most chemicals and buffers were obtained from Fisher Scientific or Sigma in the purest available form. 2-Mercaptoethanol (βME) was from Fluka and vacuum-distilled prior to use. High purity KOH was from Aldrich. Concentration devices, originally sold under the Amicon label, were obtained from Fisher as were Slide-A-Lyzer dialysis cassettes, originally sold under the Pierce label. Atomic absorption standards were SpecPure grade and obtained from Alfa AESAR. Human PBGS and mutants thereof were expressed and purified from an artificial gene as described previously (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). The mutations were achieved using the QuikChange technology of Stratagene. The sense strand primers were GCGTATGCTAAGGCAGGTGCACAGGTGGTAGCCCCTTCC (for C162A), CCTGTGACGTCGCCCTGGCTCCGTACACTTCTCACGGTCACGCCGGTCTCC (for C122A, C124A, C132A), CGTACACTTCTCACGGTGCCTGCGGTCTCCTGAGC (for H131A), and GGCGACCGCCGCGCCTATCAGCTGCC (for C223A). All resultant plasmids were sequenced throughout the artificial gene in both directions. For protein production, 6-liter growths of BLR(DE3)pMVhum (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar) (and mutants listed below) were started from single colonies of a fresh transformation at one colony per liter. The initial growth media was Luria Broth plus 0.4% glucose containing 12.5 μg ml−1tetracycline and 100 μg ml−1 ampicillin. After 16 h at 37 °C with shaking, the cells were harvested and resuspended in fresh broth without glucose to which tetracycline, ampicillin, and 20 μm Zn(II) had been added. Human PBGS induction was carried out at 15 °C with 100 μmisopropyl-1-thio-β-d-galactopyranoside and expression proceeded for an additional 45 h. The protein was purified from the soluble fraction of the lysed cells using a 25–45% ammonium sulfate fractionation, phenyl-Sepharose, DEAE-BioGel, and Sephacryl S300 columns as described previously (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). Care was taken to thoroughly regenerate all columns between preparations to prevent cross contamination of the proteins. Purifications of active and inactive human PBGS variants were carried out using two different batches of phenyl-Sepharose resin. Care was also taken to prevent contamination of the inactive proteins by chromosomally encoded Escherichia coli PBGS, the presence of which was determined by its ability to respond to Mg(II) as an allosteric activator (15Mitchell L.W. Jaffe E.K. Arch. Biochem. Biophys. 1993; 300: 169-177Crossref PubMed Scopus (52) Google Scholar, 16Jaffe E.K. Ali S. Mitchell L.W. Taylor K.M. Volin M. Markham G.D. Biochemistry. 1995; 34: 244-251Crossref PubMed Scopus (78) Google Scholar). The E. coli PBGS elutes from the DEAE column in the tail end of human PBGS peak (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). Protein was isolated in amounts varying from 150 to 400 mg for N59, N59/C162A, N59/C162A/H131A/C223A (hereafter called MinusZnA), and N59/C162A/C122A/C124A/C132A (hereafter called MinusZnB). The yield for K59 and K59/C162A was ∼50 mg of purified enzyme from 6 liters of growth. Purified proteins were concentrated to >5 mg/ml, aliquoted into portions, flash-frozen in liquid N2, and stored at −80 °C. Enzyme assays (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar), Zn(II) analysis by atomic absorption spectroscopy, and Zn(II) binding by equilibrium dialysis (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 12Jaffe E.K. Abrams W.R. Kaempfen H.X. Harris Jr., K.A. Biochemistry. 1992; 31: 2113-2123Crossref PubMed Scopus (46) Google Scholar) were carried out according to procedures described previously. For MinusZnB activity, assays contained as much as 2 mg ml−1 protein and were allowed to proceed for between 2 and 40 h. All enzyme assays were carried out in metal-free plastic test tubes at 37 °C. Continuous assays monitoring the formation of porphobilinogen at 236 nm (17Huckel D. Beyersmann D. Anal. Biochem. 1979; 97: 277-281Crossref PubMed Scopus (5) Google Scholar) were carried out using a Cary 50 spectrometer fitted with an epoxy dip probe. Matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectroscopy was performed on a PerSeptive Biosystems Voyager DE mass spectrometer in linear mode at an accelerating voltage of 20,000 V. To determine the stoichiometry of Zn(II) required for maximal activity, K59, N59, N59/C162A, and MinusZnA were dialyzed against 50 mm sodium acetate, pH 5.0, 10 mmβME overnight to prepare the Zn(II)-free apoenzyme (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). Following a brief (2 h) dialysis back into neutral pH buffer (0.1 mTES-KOH, 10 mm βME, pH 7.0), the proteins were analyzed for Zn(II) content by atomic absorption spectroscopy and assayed at 2 μm total subunit concentration in the presence of 0, 0.1, 0.2, 0.3, 0.4, and 0.5 μm Zn(II) added to the assay. For all data points, A555 values were ≥0.10 and thus of high confidence. The pH rate profiles were determined using buffers containing 0.1 m bis-tris propane-HCl (initial pH varied from 6 to 9), 10 mm βME, 10 μm Zn(II), and a fixed amount of recombinant human PBGS (K59 at 4.3 μg/ml, N59 at 10 μg/ml, N59/C162A at 15 μg/ml, K59/C162A at 15 μg/ml, MinusZnA at 15 μg/ml, and MinusZnB at 1.0 mg/ml). In all cases the enzyme-buffer mixture was preincubated for 10 min at 37 °C prior to the addition of ALA-HCl to a final concentration of 10 mm. The final pH was measured in mock assays at room temperature. The active proteins were assayed using a 5-min fixed time assay; MinusZnB was assayed for 5 h. For determination of Km and Vmaxvalues, the ALA-HCl concentrations were 10 μm, 30 μm, 100 μm, 300 μm, 1 mm, 3 mm, and 10 mm with stock dilutions made in 0.1 m HCl to keep the assay pH and ionic strength constant. All assays were terminated with a one-half volume of STOP reagent (20% trichloroacetic acid, 0.1 mHgCl2). Km and Vmax determinations for MinusZnB used 0.5 mg ml−1 and 18-h assays. Because the catalytic activity of MinusZnB was reduced by five orders of magnitude, Km and Vmax determinations were carried out in the presence and absence of Mg(II) to control for activity due to trace contamination by E. coli PBGS. Mg(II) causes a pH-dependent activation of the E. coli protein (16Jaffe E.K. Ali S. Mitchell L.W. Taylor K.M. Volin M. Markham G.D. Biochemistry. 1995; 34: 244-251Crossref PubMed Scopus (78) Google Scholar), but not the human protein. Porphobilinogen formed was determined by absorbance at 555 nm about 8 min after the addition of a one and one-half volume of modified Ehrlich's reagent. The extinction coefficient of the pink complex formed (ε555) was 62,000 cm−1m−1. Fixed-time lead inhibition assays included the holoenzymes as purified and were carried out with no added metals, with 20 μm Pb(II), and with both 10 μm Zn(II) and 20 μm Pb(II) added to the assay preincubation mixture. Because of the ability of phosphate to buffer metal ions, these assays were carried out in TES-KOH at an initial pH of 7.0. Free Pb(II) is 1 mm. The high Km at below optimal pH may be related to a pH-dependent decrease in enzyme-bound Zn(II) (3Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack Jr., R.L. Kervinen J. Martins J. Quinlan J.F. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar), because Zn(II) has been shown to be essential for binding and reactivity of the ALA substrate that is not involved in Schiff base formation to Lys-252 (22Jaffe E.K. Hanes D. J. Biol. Chem. 1986; 261: 9348-9353Abstract Full Text PDF PubMed Google Scholar). At pH 7, the reciprocal relationships were again linear over three orders of magnitude variation in [ALA] and the Km values, which are all on the order of 0.1 mm, resembled those previously published for all PBGS at their optimum pH when their divalent metal ion requirements are met. However, above the optimal pH, at pH 8, the reciprocal relationships deviate from linearity and reveal what might be interpreted as a substrate activation phenomenon. Fig. 2 A, which shows the kinetic data at pH 6, 7, and 8 for N59, illustrates the magnitude of this phenomenon. The apparent Km at pH 8, considering only [ALA] below 300 μm, was in the range of 15–50 μm and is reported in Table I. However, above 300 μm ALA all the active human PBGS showed pronounced downward curvature at pH 8 (for N59, triangles in Fig.2A), and the apparent Km values were about twice that seen at pH 7. The human PBGS mutant MinusZnA shows a relatively unremarkable pH dependence for the Km and Vmax values with the exception of the 3- to 6-fold elevated Km for ALA at pH 6. This may indicate a role for ZnA, His-131, or Cys-223 in substrate binding. The comparable Vmax values of MinusZnA relative to wild type PBGS suggest that ZnA, His-131, and Cys-223 do not function in a rate-determining step of catalysis.Table IKinetic parameters for variants of human PBGS in 0.1 mbis-tris propane-HCl, 10 mm β-ME, 10 μmZn(II)pHK59N59K59/C162AN59/C162AN59/C162AMinusZnAMinusZnBK mV maxK mV maxK mV maxK mV maxK mV maxK mV max61.4431.2262.6322.6207.718NA1-aNA, not assayed.NA70.09440.18210.17360.17280.101920.41-bValues adjusted for trace contamination with E. coli PBGS as determined by a second set of assays done in the presence of 1 mm Mg(II) (raw data Km = 8.5 mm and Vmax= 0.004).0.00680.041-cSubstrate activation was observed at [ALA] > 300 μm.230.0141-cSubstrate activation was observed at [ALA] > 300 μm.50.041-cSubstrate activation was observed at [ALA] > 300 μm.250.051-cSubstrate activation was observed at [ALA] > 300 μm.140.039NANAKm values are in units of mm;Vmax values are in units of μmol h−1mg−1. Linear regression R values were uniformly 0.99.1-a NA, not assayed.1-b Values adjusted for trace contamination with E. coli PBGS as determined by a second set of assays done in the presence of 1 mm Mg(II) (raw data Km = 8.5 mm and Vmax= 0.004).1-c Substrate activation was observed at [ALA] > 300 μm. Open table in a new tab Km values are in units of mm;Vmax values are in units of μmol h−1mg−1. Linear regression R values were uniformly 0.99. Determination of kinetic constants for MinusZnB, which exhibits very low activity, required 0.5 mg ml−1 enzyme and assay times of ∼18 h. The observed a
Referência(s)