Portal de Periódicos da CAPES

The Drosophila Nitric-oxide Synthase Gene (dNOS) Encodes a Family of Proteins That Can Modulate NOS Activity by Acting as Dominant Negative Regulators

2001; Elsevier BV; Volume: 276; Issue: 45 Linguagem: Inglês

10.1074/jbc.m105066200

1083-351X

Yuri Stasiv, Michael Regulski, Kuzin Ba, Tim Tully, Grigori Enikolopov,

Renin-Angiotensin System Studies

Nitric oxide (NO) is involved in organ development, synaptogenesis, and response to hypoxia in Drosophila. We cloned and analyzed the only gene in the fly genome that encodes Drosophila nitric-oxide synthase (dNOS). It consists of 19 exons and is dispersed over 34 kilobases of genomic DNA. Alternative transcription start sites and alternative splice sites are used to generate a remarkable variety of mRNAs from the dNOS gene. We identified eight new transcripts that are widely expressed throughout Drosophiladevelopment and encode a family of DNOS-related proteins. Alternative splicing affects both the 5′-untranslated region and the coding region of the dNOS primary transcript. Most of the splicing alterations in the coding region of the gene lead to premature termination of the open reading frame. As a result, none of the alternative transcripts encode an enzymatically active protein. However, some of these shorter DNOS protein products can effectively inhibit enzymatic activity of the full-length DNOS1 protein when co-expressed in mammalian cells, thus acting as dominant negative regulators of NO synthesis. Using immunoprecipitation, we demonstrate that these short DNOS protein isoforms can form heterodimers with DNOS1, pointing to a physical basis for the dominant negative effect. Our results suggest a novel regulatory function for the family of proteins encoded by the Drosophila NOS gene. Nitric oxide (NO) is involved in organ development, synaptogenesis, and response to hypoxia in Drosophila. We cloned and analyzed the only gene in the fly genome that encodes Drosophila nitric-oxide synthase (dNOS). It consists of 19 exons and is dispersed over 34 kilobases of genomic DNA. Alternative transcription start sites and alternative splice sites are used to generate a remarkable variety of mRNAs from the dNOS gene. We identified eight new transcripts that are widely expressed throughout Drosophiladevelopment and encode a family of DNOS-related proteins. Alternative splicing affects both the 5′-untranslated region and the coding region of the dNOS primary transcript. Most of the splicing alterations in the coding region of the gene lead to premature termination of the open reading frame. As a result, none of the alternative transcripts encode an enzymatically active protein. However, some of these shorter DNOS protein products can effectively inhibit enzymatic activity of the full-length DNOS1 protein when co-expressed in mammalian cells, thus acting as dominant negative regulators of NO synthesis. Using immunoprecipitation, we demonstrate that these short DNOS protein isoforms can form heterodimers with DNOS1, pointing to a physical basis for the dominant negative effect. Our results suggest a novel regulatory function for the family of proteins encoded by the Drosophila NOS gene. nitric oxide NO synthase(s) Drosophila NOS neuronal NOS endothelial NOS inducible NOS rapid amplification of cDNA ends polymerase chain reaction reverse transcription influenza hemagglutinin epitope 293 embryonic human kidney cells calmodulin kilobase(s) nucleotide(s) A. stephensi NOS untranslated region(s) open reading frame amino acid(s) base pair(s) Nitric oxide (NO)1 is involved in vasodilation, neurotransmission, and immunity in mammals (see Ref. 1Bredt D.S. Snyder S.H. Annu. Rev. Biochem. 1994; 63: 175-195Crossref PubMed Scopus (2121) Google Scholar for review). It is produced by a family of nitric-oxide synthases (NOS), which are encoded by three distinct genes in the mammalian genome. These genes are expressed throughout development as well as in the adult animal. Their transcriptional regulation is highly complex; a range of alternative promoters, splice sites, and polyadenylation signals is used to generate families of transcripts and proteins from each chromosomal gene (see Refs. 2Wang Y. Newton D.C. Marsden P.A. Crit. Rev. Neurobiol. 1999; 13: 21-43Crossref PubMed Scopus (165) Google Scholar, 3Forstermann U. Boissel J.P. Kleinert H. FASEB J. 1998; 12: 773-790Crossref PubMed Scopus (561) Google Scholar, 4Geller D.A. Billiar T.R. Cancer Metastasis Rev. 1998; 17: 7-23Crossref PubMed Scopus (273) Google Scholar for review). In Drosophila NO has been shown to be involved in imaginal disc development, synaptogenesis, formation of retinal projection pattern, response to hypoxia, and behavioral responses (see Ref. 5Enikolopov G. Banerji J. Kuzin B. Cell Death Differ. 1999; 6: 956-963Crossref PubMed Scopus (79) Google Scholar for review). The gene for Drosophila NO synthase,dNOS, is located on the second chromosome at cytological position 32B (6Regulski M. Tully T. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9072-9076Crossref PubMed Scopus (214) Google Scholar). The major product of the gene, dNOS1, encodes a protein that bears a strong resemblance to all three NOS isoforms of mammals, with the highest homology to neuronal NOS (nNOS) (6Regulski M. Tully T. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9072-9076Crossref PubMed Scopus (214) Google Scholar). Several attempts to clone putative orthologs of mammalian endothelial or inducible forms of NOS (eNOS or iNOS) from various Drosophila cDNA or genomic libraries have not revealed any other NOS loci in the fruit fly's genome. 2Y. Stasiv, M. Regulski, and G. Enikolopov, unpublished information.2Y. Stasiv, M. Regulski, and G. Enikolopov, unpublished information. The recently released complete sequence of the Drosophila genome (7Adams M.D. Celniker S.E. Holt R.A. Evans C.A. Gocayne J.D. et al.Science. 2000; 287: 2185-2195Crossref PubMed Scopus (4744) Google Scholar) has further confirmed our conclusion that the dNOS locus represents the only gene for NO synthase in Drosophila. To explore the role of NO in fruit fly physiology and development, we sought to determine the structure of the Drosophila NOS gene to search for alternative transcripts and proteins and to investigate the role of possible DNOS isoform diversity in NO signaling. This paper analyzes the Drosophila NOS locus and identifies multiple transcripts that code for a family of DNOS proteins. dNOSmRNA isoforms are expressed throughout Drosophiladevelopment. We have found that some of these mRNAs encode truncated DNOS polypeptides, and we have gone on to show that these truncated DNOS proteins can form heterodimers with the full-length DNOS1 and strongly inhibit its enzymatic activity when co-expressed in cultured cells. Together, our observations suggest that the diversity of products encoded by the dNOS gene may have a direct impact on NOS activity and NO signaling in Drosophila. A Drosophila λDASH genomic library (5 × 104 plaques) was screened with probes corresponding to different regions of the dNOS1 cDNA (6Regulski M. Tully T. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9072-9076Crossref PubMed Scopus (214) Google Scholar). The four longest overlapping phage clones covering the entire dNOSgene were isolated and mapped using HindIII and EcoRI restriction enzymes (New England Biolabs). Restriction fragments were subcloned into pBluescript II KS (Stratagene) and sequenced by the Cold Spring Harbor Laboratory DNA sequencing facility. Phage purification, hybridization, and cloning steps were performed using the standard methods (8Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Drosophila embryos from 0 to 24 h after fertilization were collected together as described previously (9Ashburner M. Drosophila: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar), dechorionated with 50% bleach, and subjected to total RNA isolation using TRIzol reagent (Life Technologies). Larvae enriched in 3rd instar were collected essentially as described (9Ashburner M. Drosophila: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Total RNA from larvae and adult flies was isolated with TRIzol. RNA samples were treated with DNase I (Roche Molecular Biochemicals) to remove traces of genomic DNA. Poly(A)+ RNA was isolated using oligo(dT)-cellulose columns (Amersham Pharmacia Biotech). The 5′-untranslated exons of the dNOSgene were identified by the 5′ rapid amplification of cDNA ends (5′-RACE) technique (10Frohman M.A. Methods Enzymol. 1993; 218: 340-356Crossref PubMed Scopus (460) Google Scholar). The first strand of cDNA was synthesized by murine leukemia virus RT (Applied Biosystems) using an exon 2-specific antisense oligonucleotide 5′-AATATCGATGTGAAATGCTGCGACATC-3′ and 1 μg of poly(A)+ RNA from Drosophilalarvae. cDNA was polyguanylated at the 3′-end using terminal transferase (Promega). The 5′ regions of different transcripts were amplified by PCR using Taq polymerase (Applied Biosystems), a poly(dC) sense oligonucleotide (5′-AGCTGGATCCCCCCCCCCCCC-3′) and an antisense oligonucleotide 5′-TTTCTGCGGCTCTCTTTTTCGG-3′ from exon 2 of the dNOS gene. PCR products were cloned into pCR2.1-TOPO (Invitrogen) and sequenced. To increase the sensitivity and specificity of RT-PCR experiments, two rounds of amplification were usually performed. The initial PCR of 30–35 cycles using one pair of primers (first round) was followed by a subsequent amplification of a 1-μl aliquot from the first round for additional 20–25 cycles (second round) using another pair of primers (nested), which were located within the initial (first round) amplicon. To eliminate false positive amplification products, negative (RT minus) controls were amplified by PCR together with the experimental (RT plus) samples. In addition, before subcloning, all RT-PCR and PCR products were size-fractionated by agarose gel electrophoresis and capillary transferred to Hybond-N+ membrane (Amersham Pharmacia Biotech). After transfer, the membranes were hybridized with γ-[32P]ATP-labeled oligonucleotides corresponding to the amplified regions. The following sense oligonucleotides from the very 5′-ends of novel dNOS exons were used with the antisense primers from exon 2 (as above) in RT-PCR experiments to confirm the 5′-RACE data: 5′-CTGTCTCTCTATTGTATACCTG-3′ and 5′-CGAACTACAACTGCAACGAG-3′ (nested) for exon 1a; 5′-TCAACGCGCGGCGTTCGAGTTCTTT-3′ and 5′-GTCAGTGAAGTGACCGAAAGAAG-3′ (nested) for exon 1b; and 5′-TGACGAATCGCGGGAGCTTT-3′ and 5′-TCAACGCGCGGCGTTCGAGTTCTTT-3′ (nested) for exon 1c. The dNOS3 cDNA was isolated using PCR-based screening (11Israel D.I. Nucleic Acids Res. 1993; 21: 2627-2631Crossref PubMed Scopus (143) Google Scholar) of a Drosophila 5′-STRETCH larval cDNA library in the bacteriophage vector λgt10 (CLONTECH). The PCR amplicon for this screen extended from exon 2 (sense primer 5′-GAACCTGCGATTCGTGAC-3′) to exon 5 (antisense primer 5′-GTTTCCATCGCGTCTCGTG-3′). Three positive clones were isolated and sequenced. The dNOS4 transcript was found after RT-PCR of a total RNA from larvae using a pair of oligonucleotides from exons 13 (sense, 5′-CACCTTTGGCAACGGTGA-3′) and 15 (antisense, 5′-CGAAGGCGCAGAAATTTGG-3′). Two additional alternatively spliced transcripts, dNOS5 and dNOS6, were identified by RT-PCR using primers specific to exons 12 (sense, 5′-GGCAAATCGGAGCAGTATGC3-′) and 14a (antisense, 5′-TTTCGGGTCATTAGAAGGCG-3′) in all three examined RNAs (isolated from embryos, larvae, and adult flies). The dNOS7 splice variant was identified by RT-PCR of a larval RNA using a pair of primers from exons 1a (as above) and 14a (as above). The dNOS9 transcript was found in all examined RNAs after RT-PCR with oligonucleotides specific to exons 14a (sense, 5′-AAATGTGAACTTTAACTTTTCGCCC-3′) and 18 (antisense, 5′-CCGCAGTGTTAGCAAAAATGTC-3′). Similarly, isoform dNOS10 was found in all examined RNA samples using RT-PCR and primers from exons 12 (sense, 5′-TCCTAGGGCACGCATTCAAT-3′) and 18 (as above). Linearized plasmid (1 μg) bearing exon 16 of the dNOS gene was used as a template for synthesis of a labeled antisense RNA probe using T7 RNA polymerase (Roche Molecular Biochemicals) in the presence of digoxygenin-11 UTP (Roche Molecular Biochemicals). Sense digoxygenin-labeled RNA probe from exon 16 was used as a negative control (data not shown). Imaginal discs isolation, fixation, hybridization, post-hybridization washes, and immunostaining were performed essentially as described (9Ashburner M. Drosophila: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). The amount of dNOS transcripts was quantified using the real-time RT-PCR method. cDNAs for quantitative analysis were generated by random hexamers (Applied Biosystems) and murine leukemia virus reverse transcriptase (Applied Biosystems) from 1 μg of total RNA isolated from Drosophila embryos, larvae, or adult flies. An amount of cDNA corresponding to 50 ng of a total RNA taken for the RT was used in PCR. dNOS transcripts were amplified with isoform-specific primers in the presence of fluorescent dye SYBR Green I (Applied Biosystems) using the ABI Prism 7700 sequence detection system (Applied Biosystems). Primers for PCR were designed using ABI Prism Primer Express software (version 1.0, Applied Biosystems). The dNOS1 transcript was amplified using a pair of primers from exon 13 (sense, 5′-TTGTTGTGGCCTCCACCTTT-3′) and exon 14 (antisense, 5′-CAATCCATGCTCGGAAGACTC-3′). For the detection of the dNOS5transcript, a pair of primers from exon 12a (sense, 5′-ACTTGCCGTAAAGGCCAGC-3′ and antisense, 5′-ACGGAACCAACCGGACACT-3′) was used. A pair of primers from exon 12 (sense, 5′-GCGCCTTATCGAAACGCATA-3′ and antisense, 5′-TTGATGCGTGCCCTAGGAGT-3′) was used for non-selective amplification of all dNOS transcripts. Each cDNA sample was amplified for 40 cycles by denaturation at 95 °C for 15 s and annealing/synthesis at 60 °C for 1 min. Amplification data were analyzed using the ABI Prism sequence detection system software (version 1.7, Applied Biosystems). Standard curves for the 10-fold serial dilutions of each examined amplicon were obtained using the above quantitative PCR approach. The resulting experimental data for each transcript were plotted on a corresponding standard curve to determine the amount of the specific dNOS isoform in a given RNA sample. Expression constructs for enzymatic activity assays contained the protein-coding regions of different dNOS cDNAs, each fused in-frame at the 3′-ends to the sequence of either the influenza virus hemagglutinin (HA) epitope (dNOS1-HA and dNOS3-HA constructs) or the FLAG epitope (dNOS4-FLAG, dNOS5-FLAG, and dNOS6-FLAG constructs) followed by a stop codon. These were subcloned into the mammalian expression vector pCG, which uses a strong cytomegalovirus promoter to direct transcription of the transgene (12Tanaka M. Herr W. Cell. 1990; 60: 375-386Abstract Full Text PDF PubMed Scopus (517) Google Scholar). 293 embryonic human kidney cells (293 cells) were grown in Dulbecco's modified Eagle's medium (Life Technologies) supplemented with 10% calf serum (Life Technologies) in the presence of 100 units/ml penicillin and 100 units/ml streptomycin. For transient expression, 5 × 106 cells were mixed with a CsCl-purified plasmid DNA in a 0.4-cm electroporation cuvette (Bio-Rad) and electroporated at 200 V, 960 microfarads using Gene Pulser (Bio-Rad). In all co-transfection experiments a 10-fold molar excess of a truncated dNOS construct (dNOS3-HA, dNOS4-FLAG,dNOS5-FLAG, or dNOS6-FLAG) over the full-length dNOS1-HA construct (2 μg/transfection) was used. The total amount of DNA used for each transfection was kept constant at 25 μg by the addition of vector DNA. Cells were collected 40 h after transfection, and protein extracts were prepared as follows. After harvesting, cells were washed with the phosphate-buffered saline (pH 7.4), resuspended in the extraction buffer (20 mm Hepes (pH 7.4) supplemented with protease inhibitors leupeptin (1 μg/ml), aprotinin (1 μg/ml), pepstatin (1 μg/ml), 1 mmphenylmethylsulfonyl fluoride), and subjected to three rounds of freezing and thawing. After centrifugation at 12,000 ×g for 5 min at 4 °C, the cleared extracts were used for the NOS activity assay as described (13Bredt D.S. Snyder S.H. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 682-685Crossref PubMed Scopus (3111) Google Scholar) with modifications. 3V. Scheinker, personal communication. A 150-μl reaction mixture containing 20 μl (20–50 μg) of a soluble protein extract, 50 mm Hepes (pH 7.4), 2 mmCaCl2, 2.5 μml-arginine, 1 mm NADPH, 20 μmtetrahydro-l-biopterin, 10 μg/ml calmodulin (CaM), 2 μl of l-[3H]arginine (2.04 TBq/mmol, 55.0 Ci/mmol) (Amersham Pharmacia Biotech) was incubated for 30 min at 25 °C. The reaction was stopped and processed to determine the extent of conversion of [3H]arginine to [3H]citrulline. Protein concentration in the extracts was determined using BCA reagent system (Pierce), and the results were used to normalize the assays. To compare the expression of the dNOS1-HA construct across the co-transfection experiments, equal amounts of protein extracts from the transfected cells were analyzed by SDS-polyacrylamide gel electrophoresis followed by immunoblotting as described (14Harlow E. Lane D. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1988: 488-501Google Scholar) using the 12CA5 monoclonal antibody (15Field J. Nikawa J. Broek D. MacDonald B. Rodgers L. Wilson I.A. Lerner R.A. Wigler M. Mol. Cell. Biol. 1988; 8: 2159-2165Crossref PubMed Scopus (726) Google Scholar) against HA epitope at a final concentration of 10 μg/ml. The same antibody was used to detect the expression of the dNOS3-HA construct. The M2 monoclonal antibody against FLAG epitope (Stratagene) was used at a final concentration of 1 μg/ml to check the expression levels of dNOS4-FLAG,dNOS5-FLAG, and dNOS6-FLAG constructs. Immunoblots were developed using the ECL system (Amersham Pharmacia Biotech). 293 cells transfected with various dNOS constructs were harvested 40 h after transfection by scraping into phosphate-buffered saline. Cells were pelleted by centrifugation and then resuspended in 10 volumes of the lysis buffer containing 50 mm Tris-HCl (pH 8.0), 150 mmNaCl, 1 mm EDTA, 1% Triton X-100, 5 μmtetrahydro-l-biopterin, 1 mml-arginine, and protease inhibitors (as above). Cells were lysed for 30 min at 4 °C. Cell lysates were centrifuged for 10 min at 12,000 × g. Duplicate aliquots of the cleared supernatants (200 μg of total protein) were pre-incubated with protein G-Sepharose beads (Amersham Pharmacia Biotech). After 1 h at room temperature, either 20 μl of the anti-FLAG M2-agarose affinity gel (Sigma) or 25 μl of the protein G-Sepharose beads, which were pre-absorbed for 1 h with 10 μl of the HA polyclonal antibody (Upstate Biotechnology), were added to the duplicate samples. After a further incubation for 3 h at room temperature, bound immune complexes were washed three times with a buffer containing 50 mm Tris-HCl (pH 8.0) and 150 mm NaCl. Immunoprecipitated proteins were eluted from the agarose or Sepharose beads by boiling and then analyzed by SDS-polyacrylamide gel electrophoresis and immunoblotting. We used the dNOS1 hybridization probe to isolate several overlapping bacteriophage clones from a Drosophila λDASH genomic library. These clones encompass a continuous 50-kilobase (kb) region of genomic DNA and contain the entire dNOS1 coding sequence (Fig. 1). Four overlapping genomic clones were mapped, and their restriction maps were found to correspond to the maps of the dNOS gene in the Drosophila genome as determined by probing Southern blots with dNOS1 cDNA fragments. Drosophila genomic blots were hybridized under both high and low stringency conditions, and no other NOS-like genes were revealed (data not shown). We searched for other NOS-related genes in Drosophila using PCR with degenerate primers corresponding to a variety of conserved regions of mammalian NOS cDNAs (data not shown). This search failed to identify novel NOS-related genes when tested on genomic DNA or cDNAs from various developmental stages. After we deposited the dNOS gene sequence into the GenBankTM data base, the total Drosophila genome sequence was released (7Adams M.D. Celniker S.E. Holt R.A. Evans C.A. Gocayne J.D. et al.Science. 2000; 287: 2185-2195Crossref PubMed Scopus (4744) Google Scholar), analysis of which confirmed our conclusion that there is only one chromosomal locus encoding dNOS. The major functional product of the dNOS gene, the full-length protein DNOS1, reveals structural motifs similar to those of mammalian NOS enzymes (6Regulski M. Tully T. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9072-9076Crossref PubMed Scopus (214) Google Scholar). It consists of an oxygenase domain at the amino terminus and a reductase domain at the carboxyl terminus, connected by a CaM binding region. We mapped the exons in genomic DNA and determined precise exon-intron boundaries by hybridization and sequencing of the overlapping genomic subclones using oligonucleotides from different parts of the dNOS1 cDNA. Introns were also sequenced in their entirety except for introns 1b, 3, 5–11, and 14. Our estimates of intron sizes (based on restriction mapping, Southern blot analysis, and PCR amplification of genomic DNA) (TableI) were confirmed by analysis of the complete Drosophila genome sequence (7Adams M.D. Celniker S.E. Holt R.A. Evans C.A. Gocayne J.D. et al.Science. 2000; 287: 2185-2195Crossref PubMed Scopus (4744) Google Scholar). The dNOSgene is composed of 19 exons dispersed over 34 kb of Drosophila genomic DNA. The location and size of exons and introns are shown in Fig. 1 and in Table I. Exons range in size from 67 to 1142 base pairs (bp), and introns range from 0.1 to 6.0 kb. The exon-intron boundaries of the dNOS gene are shown in TableII. All of them conform to the known GT/AG donor/acceptor rule (16Mount S.M. Burks C. Hertz G. Stormo G.D. White O. Fields C. Nucleic Acids Res. 1992; 20: 4255-4262Crossref PubMed Scopus (341) Google Scholar). Translation initiation and termination sites for the dNOS1 are located in exons 2 and 19, respectively. The potential polyadenylation signals AATAAA were found 148 nucleotides (nt) and 226 nt downstream of the stop codon TAA in exon 19. The distribution of the coding sequences among dNOSexons reveals a striking similarity with the human nNOS gene as well as with the mosquito Anopheles stephensi NOS(AsNOS) gene (17Hall A.V. Antoniou H. Wang Y. Cheung A.H. Arbus A.M. Olson S.L. Lu W.C. Kau C.L. Marsden P.A. J. Biol. Chem. 1994; 269: 33082-33090Abstract Full Text PDF PubMed Google Scholar, 18Luckhart S. Rosenberg R. Gene. 1999; 232: 25-34Crossref PubMed Scopus (81) Google Scholar). Seven dNOS exons (exons 5–9 and 12–13) are identical in size to exons 6–10 and 14–15, respectively, of the human nNOS gene and are followed by introns of the same type (as determined by the position of a splice junction within a codon) (Table I). Similarly, seven dNOS exons (exons 4–7, 10, 12, and 13) have the same size as the homologous mosquito AsNOS exons (exons 2–5, 7, 10, and 11, respectively), with the intron type being conserved as well (Table I). Evolutionary conservation is found mainly in the region extending from the heme-binding site to beyond the CaM-binding site. This region in mammalian nNOS is responsible for homodimerization and for catalytic conversion of l-arginine intol-citrulline and NO (19Klatt P. Pfeiffer S. List B.M. Lehner D. Glatter O. Bachinger H.P. Werner E.R. Schmidt K. Mayer B. J. Biol. Chem. 1996; 271: 7336-7342Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar). In contrast, much of the reductase domain of the Drosophila enzyme is encoded by a single 1142-nt-long exon 16 (Table I), whereas the homologous region in the human nNOS gene is dispersed among eight exons (exons 19–26).Table ILocation and size of exons/introns in the Drosophila NOS geneExonSizeAmino acidsFeaturesIntronSizeTypeHuman nNOSMosquito AsNOSExonIntronExonIntronntkb1a3435′-UTR, dNOS7 1a6.0 1b2325′-UTR, dNOS1, dNOS4- dNOS6 1b5.2 1c2545′-UTR, dNOS8 1c5.31d2985′-UTR, dNOS3—— 27712015′-UTR, poly(Gln) 20.6II 311538Spliced out in dNOS3 34.5O 413746 40.1II 2 (137)2 (II) 516354Heme 51.8O6 (163)6 (O) 3 (163)3 (O) 69231 60.7II7 (92)7 (II) 4 (92)4 (II) 714247 70.7O8 (142)8 (O) 5 (142)5 (O) 814047Spliced out in dNOS2 83.5II9 (140)9 (II) 917558Spliced out in dNOS2 91.3O10 (175)10 (O) 6 (315)6 (O)1018261100.7II 7 (182)7 (II)1121070CaM112.6II1214548CaM120.7O14 (145)14 (O)10 (145)10 (O)13a7324dNOS513b31546dNOS61310535130.1O15 (105)15 (O)11 (105)11 (O)14a10921dNOS4-dNOS7, dNOS9146823144.7II15334111FMN, spliced out in dNOS9 and dNOS10150.2O161142381FAD, NADPH-Rib, spliced out in dNOS9 and dNOS10160.2II1712642NADPH-Ade, spliced out in dNOS9 and dNOS10170.7II186722180.2O1935835NADPH, 3′-UTRIntron type O indicates a splice junction between codons, type I indicates a spice junction after the first nucleotide of a codon, and type II indicates a spice junction after the second nucleotide. Amino acids with interrupted codons were assigned to the exon containing two of the three nucleotides in a given codon. Homologous exons (exon number and size in bp) and intronic splice junction locations (intron number and phase) are shown for the human nNOS and for the mosquito AsNOS genes. Alternatively spliced exons not present in the dNOS1 mRNA are shown in italic. Open table in a new tab Table IISplice junction sequences in the Drosophila NOS geneIntronExon5′ Donor3′ AcceptorExon 1aATTTGTAAGCTTTTTCAATCCTCAGTGAA 1bAAAGGTACGCGTTTTCAATCCTCAGTGAA 1cTATTGTCAGTGTTTTCAATCCTCAGTGAA 2GCAGGTAAGGATTTCCAAATTGCAGCTTT 3CGAGGTGAGTCTCTATTCCCATCAGATTC 4AGCGGTGAGCCTATCTCGATTGCAGTACA 5GCAGGTGGGTGACTGTATTTTGCAGGTCT 6TGAGGTAATTGATTTCATATTTCAGATCG 7AGAGGTAAATTCCTCCATCCATCAGGTCT 8CCAAGTGAGTACTCTCCCATTGCAGATTC 9GGAGGTAAGTTTTAACTAACCGCAGACGG10TCAGGTGAGTTGTGTTTCTCCATAGGAAT11CTAGGTAAGTATTACTTCGTTGCAGGGCT12ACAGGTGAGTCGTTAATTCATTTAGATAT12bACAGGTGAGTCTTTTGCCGGCATAGTGTC13CGAGGTAAGTACCCCTGCCACGCAGCTTT14CCAGGTGAGTCGCCCACCCAAACAGCATT15CAAGGTGAGTTATATATTTTCTTAGTTGG16CGAAGTAAGTTCCCGTGCATTGCAGGACA17TCAGGTAAGCTTTTCTCTTTGACAGGAAG18GCGGGTAAGTATCGATTTTCCACAGGACGConsensus for the Drosophila splice junctionsMAGGTRAGTWTTTTTYYYTTNCAGG Open table in a new tab Intron type O indicates a splice junction between codons, type I indicates a spice junction after the first nucleotide of a codon, and type II indicates a spice junction after the second nucleotide. Amino acids with interrupted codons were assigned to the exon containing two of the three nucleotides in a given codon. Homologous exons (exon number and size in bp) and intronic splice junction locations (intron number and phase) are shown for the human nNOS and for the mosquito AsNOS genes. Alternatively spliced exons not present in the dNOS1 mRNA are shown in italic. In the original report on the cloning of the dNOS cDNA, two transcripts, dNOS1 and dNOS2, were identified (6Regulski M. Tully T. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9072-9076Crossref PubMed Scopus (214) Google Scholar). dNOS1 encodes a full-length protein, whereas dNOS2 has an in-frame deletion of 315 nt. To investigate the variety of alternative isoforms of dNOS mRNA, we screened cDNA libraries from Drosophila adult heads and larvae and performed 5′-RACE with RNA from embryos, larvae, and adult flies. This search resulted in identification of eight novel dNOS transcripts, which differ both in their 5′-untranslated regions (UTRs) and in their coding regions. We have termed these isoforms dNOS3-dNOS10. We observed four different 5′-ends of the dNOS transcripts (Fig. 2 A), designated as exons 1a, 1b, 1c, and 1d. Each variant of exon 1 splices to the common exon 2, which contains the translation initiation codon ATG (preceded by stop codons in all three translation reading frames). None of these alternative exons contain the optimal consensus sequence for the initiation of translation, suggesting that all dNOS isoforms encode proteins with identical amino termini. Isoforms dNOS1, dNOS4, dNOS5, and dNOS6 start with 232-nt-long exon 1b. The dNOS8transcript starts 141 nt upstream of the exon 1b. It utilizes an alternative donor splice site within exon 1b (located 119 nt upstream of a donor splice site for exon 1b), thus generating a 254-nt-long exon 1c (Table II). Isoform dNOS7 starts with 343-nt-long exon 1a spliced to exon 2. Finally, the 5′-end of the dNOS3 isoform, which carries exon 1d, starts 298 nt upstream of exon 2 and continues without splicing into the common exon 2 (Fig. 2 B). All of the presumptive donor/acceptor splice sites conformed to the GT/AG consensus (Table II). Numerous attempts to extend the various cDNA sequences farther upstream using 5′-RACE with the series of primers specific to different variants of exon 1 did not identify any novel 5′-ends other than those described above. This indicates that these exons may represent true transcription initiation sites, suggesting that the dNOS gene may contain at least four alternative promoters. Importantly, the variations in exon 1 do not appear to affect the amino termini of the encoded proteins. Furthermore, alternative splicing of the primary transcript changes the coding capacity of several dNOS isoforms. These changes include single and multiple exon deletions, single and multiple exon insertions, and alternative usage of splicing sites within an exon (Fig. 3 B). Isoform dNOS3 was isolated from a Drosophila 3rd instar larvae cDNA library. It is an example of a single exon deletion within the protein-coding region; dNOS3 lacks the 115-nt-long exon 3 (Fig. 3 B). This creates a frameshift in the mRNA and introduces a stop codon TGA 40 nt downstream of the new splice junction between exons 2 and 4. The resulting open reading frame (ORF) is 642 nt long (each of three cDNA clones examined contained the entire ORF of dNOS3 plus the 5′- and 3′-UTRs) and codes for a