Biochemical and Functional Characterization of Six SIX1 Branchio-oto-renal Syndrome Mutations
2009; Elsevier BV; Volume: 284; Issue: 31 Linguagem: Inglês
10.1074/jbc.m109.016832
ISSN1083-351X
AutoresAaron Patrick, Barbara J. Schiemann, Kui Yang, Rui Zhao, Heide L. Ford,
Tópico(s)Craniofacial Disorders and Treatments
ResumoBranchio-oto-renal syndrome (BOR) is an autosomal dominant developmental disorder characterized by hearing loss, branchial arch defects, and renal anomalies. Recently, eight mutations in the SIX1 homeobox gene were discovered in BOR patients. To characterize the effect of SIX1 BOR mutations on the EYA-SIX1-DNA complex, we expressed and purified six of the eight mutants in Escherichia coli. We demonstrate that only the most N-terminal mutation in SIX1 (V17E) completely abolishes SIX1-EYA complex formation, whereas all of the other mutants are able to form a stable complex with EYA. We further show that only the V17E mutant fails to localize EYA to the nucleus and cannot be stabilized by EYA in the cell. The remaining five SIX1 mutants are instead all deficient in DNA binding. In contrast, V17E alone has a DNA binding affinity similar to that of wild type SIX1 in complex with the EYA co-factor. Finally, we show that all SIX1 BOR mutants are defective in transcriptional activation using luciferase reporter assays. Taken together, our experiments demonstrate that the SIX1 BOR mutations contribute to the pathology of the disease through at least two different mechanisms that involve: 1) abolishing the formation of the SIX1-EYA complex or 2) diminishing the ability of SIX1 to bind DNA. Furthermore, our data demonstrate for the first time that EYA: 1) requires the N-terminal region of the SIX1 Six domain for its interaction, 2) increases the level of the SIX1 protein within the cell, and 3) increases the DNA binding affinity of SIX1. Branchio-oto-renal syndrome (BOR) is an autosomal dominant developmental disorder characterized by hearing loss, branchial arch defects, and renal anomalies. Recently, eight mutations in the SIX1 homeobox gene were discovered in BOR patients. To characterize the effect of SIX1 BOR mutations on the EYA-SIX1-DNA complex, we expressed and purified six of the eight mutants in Escherichia coli. We demonstrate that only the most N-terminal mutation in SIX1 (V17E) completely abolishes SIX1-EYA complex formation, whereas all of the other mutants are able to form a stable complex with EYA. We further show that only the V17E mutant fails to localize EYA to the nucleus and cannot be stabilized by EYA in the cell. The remaining five SIX1 mutants are instead all deficient in DNA binding. In contrast, V17E alone has a DNA binding affinity similar to that of wild type SIX1 in complex with the EYA co-factor. Finally, we show that all SIX1 BOR mutants are defective in transcriptional activation using luciferase reporter assays. Taken together, our experiments demonstrate that the SIX1 BOR mutations contribute to the pathology of the disease through at least two different mechanisms that involve: 1) abolishing the formation of the SIX1-EYA complex or 2) diminishing the ability of SIX1 to bind DNA. Furthermore, our data demonstrate for the first time that EYA: 1) requires the N-terminal region of the SIX1 Six domain for its interaction, 2) increases the level of the SIX1 protein within the cell, and 3) increases the DNA binding affinity of SIX1. Branchio-oto-renal syndrome (BOR; Mendelian Inheritance in Man (MIM) 113650) 5The abbreviations used are: BORbranchio-oto-renal syndromeEDEya domainHDhomeodomainSDSix domainWTwild typeHPLChigh pressure liquid chromatographyGSTglutathione S-transferaseTCEPtris(2-carboxyethyl)phosphine. is an autosomal dominant developmental disorder that is characterized by hearing loss, branchial fistulae, and renal anomalies. Although the penetrance of the syndrome is highly variable between and even within families (1Kochhar A. Fischer S.M. Kimberling W.J. Smith R.J.H. Am. J. Med. Genet. A. 2007; 143A: 1671-1678Crossref PubMed Scopus (103) Google Scholar), 70–93% of BOR patients exhibit hearing loss (1Kochhar A. Fischer S.M. Kimberling W.J. Smith R.J.H. Am. J. Med. Genet. A. 2007; 143A: 1671-1678Crossref PubMed Scopus (103) Google Scholar). This hearing loss can be conductive, sensorineural, or mixed and ranges in severity. In total, BOR affects an estimated 1 in 40,000 children and accounts for 2% of profoundly deaf children (2Fraser F.C. Sproule J.R. Halal F. Am. J. Med. Genet. 1980; 7: 341-349Crossref PubMed Scopus (188) Google Scholar). branchio-oto-renal syndrome Eya domain homeodomain Six domain wild type high pressure liquid chromatography glutathione S-transferase tris(2-carboxyethyl)phosphine. The most commonly mutated gene in BOR syndrome is EYA1 (3Abdelhak S. Kalatzis V. Heilig R. Compain S. Samson D. Vincent C. Levi-Acobas F. Cruaud C. Le Merrer M. Mathieu M. König R. Vigneron J. Weissenbach J. Petit C. Weil D. Hum. Mol. Genet. 1997; 6: 2247-2255Crossref PubMed Scopus (177) Google Scholar), with an estimated 40% of BOR patients exhibiting mutations in this gene (4Chang E.H. Menezes M. Meyer N.C. Cucci R.A. Vervoort V.S. Schwartz C.E. Smith R.J. Hum. Mutat. 2004; 23: 582-589Crossref PubMed Scopus (162) Google Scholar). EYA1 belongs to the EYA gene family of transcriptional co-factors. There are four mammalian members (EYA1–4), each containing an N-terminal transactivation domain (5Xu P.X. Cheng J. Epstein J.A. Maas R.L. Proc. Natl. Acad. Sci. U.S.A. 1997; 94: 11974-11979Crossref PubMed Scopus (151) Google Scholar), and a highly conserved ∼270-amino acid C-terminal Eya domain (ED), also referred to as the eya homologous region. The ED possesses phosphatase activity (6Rayapureddi J.P. Kattamuri C. Steinmetz B.D. Frankfort B.J. Ostrin E.J. Mardon G. Hegde R.S. Nature. 2003; 426: 295-298Crossref PubMed Scopus (198) Google Scholar, 7Tootle T.L. Silver S.J. Davies E.L. Newman V. Latek R.R. Mills I.A. Selengut J.D. Parlikar B.E. Rebay I. Nature. 2003; 426: 299-302Crossref PubMed Scopus (215) Google Scholar, 8Li X. Oghi K.A. Zhang J. Krones A. Bush K.T. Glass C.K. Nigam S.K. Aggarwal A.K. Maas R. Rose D.W. Rosenfeld M.G. Nature. 2003; 426: 247-254Crossref PubMed Scopus (505) Google Scholar) and is involved in protein-protein interactions with the SIX family of homeoproteins (9Kawakami K. Sato S. Ozaki H. Ikeda K. Bioessays. 2000; 22: 616-626Crossref PubMed Scopus (311) Google Scholar, 10Kawakami K. Ohto H. Ikeda K. Roeder R.G. Nucleic Acids Res. 1996; 24: 303-310Crossref PubMed Google Scholar, 11Chen R. Amoui M. Zhang Z. Mardon G. Cell. 1997; 91: 893-903Abstract Full Text Full Text PDF PubMed Scopus (329) Google Scholar, 12Pignoni F. Hu B. Zavitz K.H. Xiao J. Garrity P.A. Zipursky S.L. Cell. 1997; 91: 881-891Abstract Full Text Full Text PDF PubMed Scopus (494) Google Scholar). The SIX family of homeoproteins are characterized by a DNA-binding homeodomain (HD) and the protein-interaction Six domain (SD), which binds directly to the ED of EYA (9Kawakami K. Sato S. Ozaki H. Ikeda K. Bioessays. 2000; 22: 616-626Crossref PubMed Scopus (311) Google Scholar). As a complex, the SIX and EYA proteins are believed to form a bipartite transcription factor where SIX confers DNA binding and EYA confers transactivation activity. Recently, mutations in two SIX family members (SIX5 and SIX1) have also been identified in BOR syndrome (13Hoskins B.E. Cramer C.H. Silvius D. Zou D. Raymond R.M. Orten D.J. Kimberling W.J. Smith R.J. Weil D. Petit C. Otto E.A. Xu P.X. Hildebrandt F. Am. J. Hum. Genet. 2007; 80: 800-804Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 14Ruf R.G. Berkman J. Wolf M.T. Nurnberg P. Gattas M. Ruf E.M. Hyland V. Kromberg J. Glass I. Macmillan J. Otto E. Nurnberg G. Lucke B. Hennies H.C. Hildebrandt F. J. Med. Genet. 2003; 40: 515-519Crossref PubMed Scopus (37) Google Scholar, 15Ruf R.G. Xu P.X. Silvius D. Otto E.A. Beekmann F. Muerb U.T. Kumar S. Neuhaus T.J. Kemper M.J. Raymond Jr., R.M. Brophy P.D. Berkman J. Gattas M. Hyland V. Ruf E.M. Schwartz C. Chang E.H. Smith R.J. Stratakis C.A. Weil D. Petit C. Hildebrandt F. Proc. Natl. Acad. Sci. U.S.A. 2004; 101: 8090-8095Crossref PubMed Scopus (330) Google Scholar). Four different heterozygous mis-sense mutations were found in SIX5 (13Hoskins B.E. Cramer C.H. Silvius D. Zou D. Raymond R.M. Orten D.J. Kimberling W.J. Smith R.J. Weil D. Petit C. Otto E.A. Xu P.X. Hildebrandt F. Am. J. Hum. Genet. 2007; 80: 800-804Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar), and functional analysis revealed that two of the mutations affect SIX5-EYA1 complex formation and the ability of SIX5 or the SIX5/EYA1 complex to activate transcription. In an independent study, Ruf et al. (14Ruf R.G. Berkman J. Wolf M.T. Nurnberg P. Gattas M. Ruf E.M. Hyland V. Kromberg J. Glass I. Macmillan J. Otto E. Nurnberg G. Lucke B. Hennies H.C. Hildebrandt F. J. Med. Genet. 2003; 40: 515-519Crossref PubMed Scopus (37) Google Scholar, 15Ruf R.G. Xu P.X. Silvius D. Otto E.A. Beekmann F. Muerb U.T. Kumar S. Neuhaus T.J. Kemper M.J. Raymond Jr., R.M. Brophy P.D. Berkman J. Gattas M. Hyland V. Ruf E.M. Schwartz C. Chang E.H. Smith R.J. Stratakis C.A. Weil D. Petit C. Hildebrandt F. Proc. Natl. Acad. Sci. U.S.A. 2004; 101: 8090-8095Crossref PubMed Scopus (330) Google Scholar) identified three mutations in the SIX1 gene, which, like the mutations in the SIX5 gene, were argued to inhibit SIX1-EYA1 binding. In addition, two of the three identified mutations also interfere with SIX1-DNA binding. Five additional novel SIX1 mutations have been subsequently identified, although the effect of these mutations on SIX1 function have not yet been determined (16Kochhar A. Orten D.J. Sorensen J.L. Fischer S.M. Cremers C.W. Kimberling W.J. Smith R.J. Hum. Mutat. 2008; 29: 565-576Crossref PubMed Scopus (72) Google Scholar). To better understand the molecular mechanism of BOR syndrome caused by SIX1 mutations, we attempted to analyze all eight of the SIX1 BOR mutations that have been identified to date. We report the effects of six of the eight SIX1 BOR mutations on a variety of biological functions including: protein expression, protein stability, protein-protein interaction, DNA binding, and transcriptional activation. Significantly, we found that only the most N-terminal mutation in SIX1 (V17E) is able to completely abolish the SIX1-EYA protein interaction, whereas the other five mutations appear to cause major deficiencies in the ability of SIX1 to bind DNA. Finally, we demonstrate that while residing in different regions of the protein, all six SIX1 mutations result in the inability of the complex to activate transcription. Mutations within the human SIX1 cDNA were generated using the QuikChange site-directed mutagenesis kit (Stratagene), using WT human SIX1 in pcDNA-3.1 as a template, and the following primers: V17E (gcaagtggcgtgcgAgtgcgaggttctg), H73P (gatcctggagagccCccagttctcgcctc), V106G (ccctgggcgccgGgggcaaatatcg), R110Q (gtgggcaaatatcAggtgcgccgaaaa), R110W (gtgggcaaatatTgggtgcgccgaaaa), R112C (gcaaatatcgggtgTgccgaaaatttcc), Y129C (gaggagaccagctGctgcttcaaggagaag), and del133E (cagctactgcttcaagaagtcgaggggtgtc). Generation of all mutants was confirmed by sequencing. Bacterial expression plasmids were generated by subcloning the PCR products into the BamHI and XhoI sites of the pGEX-6P1 (GE Healthcare) vector and were sequenced. pGEX-6P1 vectors were transformed into the Escherichia coli strain XA-90. Two independent clones for each mutant were used for small scale expression tests by inoculating 1 ml of LB medium with an overnight culture and grown at 37 °C for 2 h. Protein expression was induced by 1 mm isopropyl β-d-thiogalactopyranoside for 2 h at 37 °C. Protein expression was analyzed by electrophoresis of cell lysates on a 12% SDS-PAGE and visualized by Coomassie Blue staining. All SIX1 proteins were expressed in E. coli at room temperature by inducing protein expression for 4 h at an A600 value of 0.8–1.0 with 1 mm isopropyl β-d-thiogalactopyranoside. Cell pellets were lysed by sonication in precooled lysis buffer (50 mm Tris-HCl, pH 8.0, 250 mm NaCl, 1 mm TCEP) containing the protease inhibitors phenylmethylsulfonyl fluoride, pepstatin, and leupeptin. The supernatant was then treated with 0.4% polyethyleneimine to precipitate out contaminating DNA, which was pelleted by centrifugation. The resultant supernatant was then purified on glutathione-Sepharose 4B resin (GE Healthcare), and the fusion proteins were cleaved with PreScission protease. The SIX1 protein was further purified by ion exchange using a RESOURCE S column (GE Healthcare) and the following buffer A (100 mm Tris-HCl, pH 8.8, 100 mm NaCl, 0.5 mm TCEP) and buffer B (same as buffer A but with 1 m NaCl). Purified proteins were adjusted to 5 mm TCEP, pH 8.0, and stored at −80 °C. For EYA2 ED, after PreScission protease cleavage, the protein preparation was purified using a Superdex 200 (GE Healthcare) size exclusion column in 50 mm Tris-HCl, pH 8.0, 200 mm NaCl, 0.5 mm TCEP. Purified protein was adjusted to 5 mm TCEP and stored at −80 °C. The secondary structure contents of the purified proteins was assessed by CD spectroscopy using a Jasco 810 spectropolarimeter (Jasco, Inc). CD measurements were carried out in a 1-mm cuvette at 18 °C with a protein concentration of 0.25 mg/ml. Each spectrum was the average of six wavelength scans collected from 196–250 nm in 5 mm Tris-HCl, pH 8.0, 100 mm NaCl, 0.5 mm TCEP. Molar ellipticity was calculated using the following equation,[0]=0obs*/(CIn)(Eq. 1) where 0obs is the observed ellipticity (mdeg), C is protein concentration (m), l is the cuvette path length (mm), and n is the number of residues in the protein. Protein thermal stability was determined by monitoring the CD signal at 222 nm with increasing temperature. CD data points were obtained at a scan rate of 2 °C/min for the temperature range of 5–85 °C and plotted as the fraction of protein folded versus temperature. All SIX1 protein preparations were run alone or in the presence of the ED on an analytical Superdex 200 in 50 mm Tris-HCl, pH 8.0, 200 mm NaCl, 0.5 mm TCEP. The proteins were run alone at 30 μm or mixed at the same concentration with the ED in a 1:1 molar ratio and incubated together on ice for 15 min prior to loading on the column. The gel filtration profiles were overlaid to reveal the elution volumes of the proteins alone, and the complex. SDS-PAGE analysis and Coomassie staining was carried out on the "complex" peak fractions to demonstrate the presence of both proteins. Reverse phase HPLC was used to confirm the presence of both proteins in the complex peak. Analytical reverse phase HPLC was performed with a linear gradient of eluents A (0.2% trifluoroacetic acid in water) and B (0.2% trifluoroacetic acid in acetonitrile) on a Zorbax SB300-C18 (2.1 × 150 mm) column. Prior to loading, the peak fraction was diluted 10-fold with eluent A. MCF7 cells were cultured onto 10-cm dishes and allowed to adhere overnight. The cells were co-transfected with 8 μg/dish of the indicated Six1 mutant construct and pcDNA3.1 FLAG-Eya2 using FuGENE 6 transfection reagent (Roche Applied Science). For the EYA1 nuclear localization experiments, the pCMVTag2-FLAG-Eya1 construct was used. After 48 h nuclear and cytoplasmic extracts were generated using the NE-PER nuclear/cytoplasmic kit (Thermo Scientific). Equal protein amounts were run out on 10% SDS-PAGE gels, transferred to polyvinylidene difluoride membranes, and probed with anti-FLAG M2 antibodies (Sigma). SIX1 expression levels were assessed by reprobing membranes with anti-SIX1 antibodies (Affinity Bioreagents). To demonstrate equal loading, the membranes were then probed with either anti-HDAC1 (Santa Cruz) or anti-α-actin antibodies (Sigma). 8 × 104 MCF7 cells/well were plated in 12-well plates. The cells were transfected with 250 ng of pcDNA3.1-Six1 and 250 ng of FLAG vector or 250 ng of pcDNA3.1-Six1 and 250 ng of FLAG-Eya2 using the FuGENE transfection method. After 48 h the cell lysates and RNA were isolated. The cell lysates were obtained using lysis buffer PLB (Promega). 40 μg of lysate were electrophoresed on a 10% SDS-PAGE and transferred to polyvinylidene difluoride membrane. The membrane was probed with an anti-SIX1 antibody (Affinity Bioreagents) and to ensure that equal loading the membrane was reprobed with an anti-α-actin antibody (Sigma). To examine alterations in the message level, RNA was isolated using the TRIzol reagent (Invitrogen). 2 μg of RNA were used for cDNA synthesis using the SuperScript III First-Strand kit (Invitrogen). Real time PCR was carried out for Six1 and cyclophilin B (control) using TaqMan gene expression assays on demand (Applied Biosystems) (Six1 Hs00195590_m1, cyclophilin B Hs01018503_m1). The reactions were carried out in triplicate using the Bio-Rad CFX96 real time system. Six1 expression levels were normalized to cyclophilin B. All of the oligonucleotides (Operon) were ordered HPLC-purified. The oligonucleotides used were a fragment of the myogenin promoter containing the SIX1 binding MEF3 site (GGGGGCTCAGGTTTCTGTGGC) and a second oligonucleotide with this MEF3 site scrambled (GGGGGCATGCTGCTCTGTGGC). The oligonucleotides were labeled using T4 polynucleotide kinase and [γ-32P]ATP and purified using CENTRI-SEP columns (Princeton Separations). The reactions were assembled on ice in 50 mm HEPES, pH 8.0, 75 mm KCl, 200 ng/μl bovine serum albumin, 1 mm TCEP, pH 7.0, 5% glycerol. 4 fmol of oligonucleotide was used along with 750 fmol of protein. For the reactions that include the ED, 750 fmol of the SIX1 protein was mixed with 750 fmol of the ED before the addition of DNA. For the Kd determination, varied quantities of SIX1 or SIX1 and ED were used (7500, 3750, 1500, 750, 375, 150, 75, 37.5, and 15 fmol) while holding the DNA quantity constant at 4 fmol/reaction. For competition reactions the wild type oligonucleotide or the scrambled version at 200× concentration (800 fmol/reaction) was used. Electrophoresis was carried out for 90 min at 60 volts at 4 °C using a 6% nondenaturing polyacrylamide gel. The gels were then dried and exposed to a phosphorimaging plate and visualized using a Storm phosphorimager (GE Healthcare). MCF7 cells were seeded onto 24-well plates at 25,000 cells/well and allowed to adhere overnight. The following day, the cells were transfected with 300 ng/well pGL3–6×MEF3, 70 ng/well Renilla luciferase, 100 ng/well of the indicated pcDNA3.1 Six1 mutant construct, and 150 ng/well of either pcDNA3.1 FLAG-Eya2 or empty vector using FuGENE 6 (Roche Applied Science) transfection reagent. The cells were lysed 48 h later with passive lysis buffer, and the resulting extracts were analyzed for luciferase and Renilla activities. To ensure expression of exogenous SIX1 protein, equal amounts of protein were run out on 10% SDS-PAGE gels and transferred to polyvinylidene difluoride membranes, which were probed with an anti-SIX1 antibody (Affinity Bioreagents), and to ensure equal loading the membranes were reprobed with anti-α-actin (Sigma). All eight identified SIX1 BOR mutations, including seven mis-sense mutations and one in-frame deletion, reside in either the SD or the HD (Fig. 1). To precisely define the molecular mechanism(s) by which these mutations compromise SIX1 function, we generated the eight mutations using site-directed mutagenesis. Wild type human SIX1 and the eight SIX1 mutants were then subcloned into a GST fusion vector in an effort to express these proteins in E. coli for biochemical analyses. Expression tests in E. coli were first performed using GST fusion proteins to determine whether all of the mutant proteins could be expressed effectively. Two independent clones for each mutant were treated with isopropyl β-d-thiogalactopyranoside to induce protein expression. Protein expression was analyzed by SDS-PAGE and Coomassie staining. The expression tests demonstrated that the H73P and R110Q mutants failed to express in E. coli, whereas all of the other six mutants were expressed efficiently (Fig. 2A). Therefore, all subsequent data presented will focus on wild type SIX1 and the six SIX1 mutants that were efficiently expressed in E. coli.FIGURE 2Expression and purification of human wild type SIX1 and BOR mutants. A, SDS-PAGE analysis of whole cell lysates from expression tests using two independent clones for each of the various mutants. The proteins were expressed as GST fusions. Note that H73P and R110Q were unable to be stably expressed. B, SDS-PAGE analysis of large scale preparations of the proteins purified by glutathione affinity chromatography with cleavage from the GST tag by PreScission protease. UC, uncut column, referring to the glutathione resin before PreScission digestion; CC, cut column, referring to the glutathione resin after PreScission digestion. C, further protein purification was achieved by ion exchange chromatography. A representative profile is shown along with a representative SDS-PAGE of the peak fractions (SIX1 WT). D, SDS-PAGE analysis of the purified protein preparations. 3 μg of protein was analyzed by SDS-PAGE to assure equal purity and quantities for biochemical characterization.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Subsequent large scale purification of wild type SIX1 and the six SIX1 mutants using glutathione affinity chromatography was carried out, and the GST moiety was removed using PreScission protease (Fig. 2B). The proteins were further purified by ion exchange chromatography to near homogeneity, as shown by SDS-PAGE and Coomassie analysis of the peak fractions (Fig. 2C). All of the purified protein preparations used for subsequent analyses were analyzed using SDS-PAGE and Coomassie staining, which demonstrated similar concentrations and purity (Fig. 2D). To evaluate the impact of the mutations on overall protein structure, we first examined protein secondary structure using CD spectroscopy. In CD spectra, α-helical secondary structure is characterized by strong ellipticity minima at 222 and 208 nm. In highly α-helical proteins, the ellipticity minima at 222 and 208 nm are similar, as is observed with wild type SIX1 (Fig. 3A). Interestingly, the R112C and delE133 mutations cause a reduction in α-helical structure, whereas the rest of the mutations do not considerably alter the α-helical content of SIX1. To further measure protein stability, CD spectroscopy was used to record the thermal denaturation profiles of wild type SIX1 and the six SIX1 mutant proteins. Both the V106G and R112C mutants demonstrated a significantly decreased melting temperature (Tm) when compared with wild type SIX1 (Tm = 28.2 and 26.8 °C for V106G and R112C, respectively, versus Tm = 34.5 °C for wild type SIX1) (Fig. 3B). These data suggest that the V106G and R112C mutants are less stable than wild type SIX1 and the other SIX1 mutants. The decrease in protein stability is not surprising for R112C because it is consistent with the decrease in α-helical content. Although V106G did not disrupt the α-helical content noticeably, it nonetheless appears to have an overall destabilizing effect on the protein in vitro. Following our assessment of the stability of the SIX1 BOR mutants, we evaluated the ability of the same mutants to bind to the EYA co-factor using size exclusion gel filtration chromatography. Consistent with previous reports (8Li X. Oghi K.A. Zhang J. Krones A. Bush K.T. Glass C.K. Nigam S.K. Aggarwal A.K. Maas R. Rose D.W. Rosenfeld M.G. Nature. 2003; 426: 247-254Crossref PubMed Scopus (505) Google Scholar, 17Mutsuddi M. Chaffee B. Cassidy J. Silver S.J. Tootle T.L. Rebay I. Genetics. 2005; 170: 687-695Crossref PubMed Scopus (38) Google Scholar), we had difficulty expressing functional recombinant EYA1 in E. coli. However, we were able to easily express and purify the ED of human EYA2. Both mammalian EYA1 and EYA2 can complement Drosophila eya mutations with comparable efficiency (18Bonini N.M. Bui Q.T. Gray-Board G.L. Warrick J.M. Development. 1997; 124: 4819-4826PubMed Google Scholar, 19Bui Q.T. Zimmerman J.E. Liu H. Bonini N.M. Genetics. 2000; 155: 709-720PubMed Google Scholar), and the EYA2 ED, which contains the SIX1-binding region, shares over 90% sequence similarity with the ED of EYA1. Therefore, we used the EYA2 ED (hereafter referred to as ED), for all subsequent in vitro analyses. The elution profiles of wild type SIX1 and the ED alone from an analytical S200 size exclusion column were very similar, with peaks in close proximity, consistent with their similar molecular mass. When wild type SIX1 and the ED were mixed and incubated to allow complex formation prior to analysis on the S200 column, a shifted elution peak corresponding to the SIX1-ED complex was observed, suggesting that the two proteins can form a stable complex. Indeed, examination of the protein content in the complex peak by SDS-PAGE and Coomassie staining revealed what appeared to be the presence of both wild type SIX1 and the ED (Fig. 4A). Because the molecular weights of the two proteins are similar, making it difficult to resolve them using SDS-PAGE, the complex peak fraction was also analyzed by analytical reverse phase chromatography to confirm the above finding. This analysis demonstrated that both SIX1 and the ED are present, and importantly, that they bind in a 1:1 molar ratio (Fig. 4B). We next analyzed the six SIX1 mutants for their ability to bind to the ED. Interestingly, we found that all of the mutants could successfully form a protein complex with the ED except the V17E mutant (Fig. 4C). Surprisingly, the R110W, Y129C, and delE133 mutants that were previously shown to be deficient in EYA1 binding using yeast two-hybrid analysis (15Ruf R.G. Xu P.X. Silvius D. Otto E.A. Beekmann F. Muerb U.T. Kumar S. Neuhaus T.J. Kemper M.J. Raymond Jr., R.M. Brophy P.D. Berkman J. Gattas M. Hyland V. Ruf E.M. Schwartz C. Chang E.H. Smith R.J. Stratakis C.A. Weil D. Petit C. Hildebrandt F. Proc. Natl. Acad. Sci. U.S.A. 2004; 101: 8090-8095Crossref PubMed Scopus (330) Google Scholar) were able to bind the ED in our assay. Although the R112C-ED complex formation appears reduced, this is likely due to the large amount of R112C protein that is lost in the void volume, which is consistent with its decreased secondary structure content and stability. Together, these results indicate that only the V17E mutation abolishes SIX1-ED binding in vitro. Previous reports have demonstrated that EYA, which is localized in the cytoplasm in the absence of SIX1, is translocated to the nucleus by SIX1 (20Ohto H. Kamada S. Tago K. Tominaga S.I. Ozaki H. Sato S. Kawakami K. Mol. Cell. Biol. 1999; 19: 6815-6824Crossref PubMed Scopus (279) Google Scholar, 21Buller C. Xu X. Marquis V. Schwanke R. Xu P.X. Hum. Mol. Genet. 2001; 10: 2775-2781Crossref PubMed Scopus (89) Google Scholar). Thus, we analyzed the intracellular distribution of full-length FLAG-tagged EYA2 after transfection into MCF7 cells in the presence of either wild type SIX1 or each of the six SIX1 BOR mutants to assess whether proper complex formation is taking place within the cell. Using nuclear and cytoplasmic fractionation, we observed cytoplasmic EYA2 localization in the absence of SIX1 (Fig. 5A, no SIX1). In contrast, the addition of wild type SIX1 led to predominantly nuclear localization of EYA2 as expected (Fig. 5A, WT). Similarly, the V106G, R110W, R112C, Y129C, and delE133 mutants were all able to localize the majority of EYA2 in the nucleus (Fig. 5A, V106G, R110W, R112C, Y129C, and delE133). However, when the SIX1 V17E mutant was co-expressed with EYA2, no detectable level of EYA2 could be found in the nucleus, similar to the control lane that lacked SIX1 expression (Fig. 5a, V17E and no SIX1). Instead, all visible EYA2 was localized in the cytoplasm. These data further suggest that V17E is the only mutation that abolishes the interaction between SIX1 and EYA. Because EYA1, not EYA2, is implicated in BOR syndrome and because previous studies had shown, in contrast to ours, that R110W, Y129C, and delE133 were deficient in EYA1 binding, we tested the ability of wild type SIX1 and the six SIX1 BOR mutants to specifically translocate full-length FLAG-tagged EYA1 to the nucleus. Again, using nuclear and cytoplasmic fractionation, we observed that in the absence of SIX1, EYA1 was localized in the cytoplasm (Fig. 5B, no SIX1). However, in the presence of wild type SIX1, EYA1 was localized in the nucleus (Fig. 5B, WT). Likewise, V106G, R110W, R112C, Y129C, and delE133 were all able to localize the majority of EYA1 in the nucleus (Fig. 5B, V106G, R110W, R112C, Y129C, and delE133). In contrast, V17E was unable to localize EYA1 in the nucleus (Fig. 5B, V17E). Because these results are consistent with the results obtained with EYA2, our data strongly suggest that V17E is the only mutation that abolishes the interaction between SIX1 and the EYA proteins. In the EYA2 nuclear localization experiments, we observed that co-transfection of EYA2 with wild type SIX1 increases the intracellular quantity of both the SIX1 and EYA2 proteins compared with levels when either protein is expressed alone (data not shown and Fig. 5A). We thus examined whether the levels of the various SIX1 BOR mutants were affected by the presence of EYA2. Interestingly, the levels of all the SIX1 BOR mutants as well as wild type SIX1 are increased with the addition of EYA2, with the exception, again, of the V17E mutant (Fig. 5C). To test whether the increase in SIX1 protein was due to an increase in SIX1 transcription by the SIX1-EYA2 complex increasing SIX1 expression or EYA2 teaming up with endogenous SIX1 (or another SIX family member) to stimulate SIX1 expression, we performed a Western blot in conjunction with quantitative reverse transcription-PCR analysis of SIX1 transcript levels. When EYA2 is expressed alone, endogenous SIX1 protein levels are not increased to detectable levels (Fig. 5D, right panel). When SIX1 is exogenously expressed, the addition of EYA2 doe
Referência(s)