Portal de Periódicos da CAPES

Fibrillin-1 regulates mesangial cell attachment, spreading, migration and proliferation

2006; Elsevier BV; Volume: 69; Issue: 3 Linguagem: Inglês

10.1038/sj.ki.5000030

1523-1755

Markus Porst, Christian Plank, Beate Bieritz, E. Konik, Hans Fees, Jörg Dötsch, Karl F. Hilgers, Dieter P. Reinhardt, Andrea Hartner,

Cell Adhesion Molecules Research

The microfibrillar protein fibrillin-1 is present in many organs, including the vasculature, eye, and dermis, and is thought to convey structural anchorage and elastic strength. Fibrillin-1 is also a component of the mesangial matrix. To assess the functional relevance of fibrillin-1 for cell–matrix interactions in the glomerulus, we studied the attachment, spreading, migration and proliferation of mesangial cells on fibrillin-1 and the regulation of fibrillin-1 in experimental anti-Thy1.1 nephritis displaying mesangial cell migration and proliferation in vivo. During the acute phase of experimental Thy1.1 nephritis, glomerular fibrillin-1 messenger ribonucleic acid expression and protein immunoreactivity were significantly induced as compared to controls. In a hexosaminidase-based adhesion assay, mesangial cells showed concentration-dependent attachment to fibrillin-1, similar to what was observed for fibronectin. The cell attachment was Arg–Gly–Asp dependent. Further, fibrillin-1 significantly promoted spreading and focal contact formation detected by immunostaining for vinculin. Mesangial cell migration, assessed by a transmigration assay, and proliferation, measured by a 5-bromo-2′-deoxy-uridine incorporation assay, were augmented by fibrillin-1. In diabetic mice underexpressing fibrillin-1, glomerular cell proliferation, determined by counting proliferating cell nuclear antigen-positive cells in renal sections, was significantly lower than in diabetic control mice. We conclude that fibrillin-1 promotes mesangial cell attachment, spreading, migration, and proliferation. We speculate that fibrillin-1 may thus contribute to mesangial hypercellularity during glomerular disease. The microfibrillar protein fibrillin-1 is present in many organs, including the vasculature, eye, and dermis, and is thought to convey structural anchorage and elastic strength. Fibrillin-1 is also a component of the mesangial matrix. To assess the functional relevance of fibrillin-1 for cell–matrix interactions in the glomerulus, we studied the attachment, spreading, migration and proliferation of mesangial cells on fibrillin-1 and the regulation of fibrillin-1 in experimental anti-Thy1.1 nephritis displaying mesangial cell migration and proliferation in vivo. During the acute phase of experimental Thy1.1 nephritis, glomerular fibrillin-1 messenger ribonucleic acid expression and protein immunoreactivity were significantly induced as compared to controls. In a hexosaminidase-based adhesion assay, mesangial cells showed concentration-dependent attachment to fibrillin-1, similar to what was observed for fibronectin. The cell attachment was Arg–Gly–Asp dependent. Further, fibrillin-1 significantly promoted spreading and focal contact formation detected by immunostaining for vinculin. Mesangial cell migration, assessed by a transmigration assay, and proliferation, measured by a 5-bromo-2′-deoxy-uridine incorporation assay, were augmented by fibrillin-1. In diabetic mice underexpressing fibrillin-1, glomerular cell proliferation, determined by counting proliferating cell nuclear antigen-positive cells in renal sections, was significantly lower than in diabetic control mice. We conclude that fibrillin-1 promotes mesangial cell attachment, spreading, migration, and proliferation. We speculate that fibrillin-1 may thus contribute to mesangial hypercellularity during glomerular disease. Fibrillin-1 is an integral component of extracellular microfibrils, which are abundantly present in elastic and nonelastic tissues, such as the vasculature, skin, tendons, eye, and kidney.1.Ramirez F. Pereira L. The fibrillins.Int J Biochem Cell Biol. 1999; 31: 255-259Crossref PubMed Scopus (92) Google Scholar, 2.Kielty C.M. Sherratt M.J. Shuttleworth C.A. Elastic fibres.J Cell Sci. 2002; 115: 2817-2828Crossref PubMed Google Scholar Fibrillin-1, together with other components of the microfibrillar and elastic fiber meshwork, contributes to the biomechanical properties of elastic organs.2.Kielty C.M. Sherratt M.J. Shuttleworth C.A. Elastic fibres.J Cell Sci. 2002; 115: 2817-2828Crossref PubMed Google Scholar Mutations in the fibrillin-1 gene lead to Marfan syndrome.3.Collod-Beroud G. Le Bourdelles S. Ades L. et al.Update of the UMD-FBN1 mutation database and creation of an FBN1 polymorphism database.Hum Mutat. 2003; 22: 199-208Crossref PubMed Scopus (252) Google Scholar, 4.Ramirez F. Fibrillin mutations in Marfan syndrome and related phenotypes.Curr Opin Genet Dev. 1996; 6: 309-315Crossref PubMed Scopus (106) Google Scholar In the glomerulus, fibrillin-1 is abundant in the mesangial matrix.5.Sterzel R.B. Hartner A. Schlotzer-Schrehardt U. et al.Elastic fiber proteins in the glomerular mesangium in vivo and in cell culture.Kidney Int. 2000; 58: 1588-1602Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar Its function in this context, however, is still unclear. Possibly, fibrillin-1 contributes to the mechanical stability and elasticity of the glomerular capillary tuft. However, it is also conceivable that fibrillin-1, like other extracellular matrix molecules, has an impact on the phenotype of cells that are in contact with this matrix component. Mesangial cells are able to express and secrete fibrillin-1.5.Sterzel R.B. Hartner A. Schlotzer-Schrehardt U. et al.Elastic fiber proteins in the glomerular mesangium in vivo and in cell culture.Kidney Int. 2000; 58: 1588-1602Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar Studies in cultured fibroblasts and smooth muscle cells revealed that fibrillin-1 contributes to the adhesion and spreading of cells via Arg–Gly–Asp (RGD) peptide-dependent integrins.6.Sakamoto H. Broekelmann T. Cheresh D.A. et al.Cell-type specific recognition of RGD- and non-RGD-containing cell binding domains in fibrillin-1.J Biol Chem. 1996; 271: 4916-4922Crossref PubMed Scopus (154) Google Scholar, 7.Pfaff M. Reinhardt D.P. Sakai L.Y. Timpl R. Cell adhesion and integrin binding to recombinant human fibrillin-1.FEBS Lett. 1996; 384: 247-250Abstract Full Text PDF PubMed Scopus (136) Google Scholar, 8.Kielty C.M. Whittaker S.P. Grant M.E. Shuttleworth C.A. Attachment of human vascular smooth muscles cells to intact microfibrillar assemblies of collagen VI and fibrillin.J Cell Sci. 1992; 103: 445-451PubMed Google Scholar, 9.Bax D.V. Bernard S.E. Lomas A. et al.Cell adhesion to fibrillin-1 molecules and microfibrils is mediated by alpha 5 beta 1 and alpha v beta 3 integrins.J Biol Chem. 2003; 278: 34605-34616Crossref PubMed Scopus (156) Google Scholar Whether or not fibrillin-1 can regulate cell migration or proliferation has not yet been clarified. Thus, we investigated the adhesion, spreading, migration, and proliferation of cultivated rat mesangial cells on fibrillin-1. Moreover, we studied expression of fibrillin-1 in the glomerulus of rats suffering from acute Thy1.1 glomerulonephritis. This disease is characterized by changes in the mesangial cell phenotype, that is, a transient increase in mesangial cell migration and proliferation.10.Jefferson J.A. Johnson R.J. Experimental mesangial proliferative glomerulonephritis (the anti-Thy-1.1 model).J Nephrol. 1999; 12: 297-307PubMed Google Scholar In the acute phase of experimental Thy1.1 nephritis in the rat (day 6), an increase in matrix deposition and in the number of mesangial cells was observed compared to vehicle-injected controls, as described before.11.Hartner A. Hilgers K.F. Bitzer M. et al.Dynamic expression patterns of transforming growth factor-beta(2) and transforming growth factor-beta receptors in experimental glomerulonephritis.J Mol Med. 2003; 81: 32-42Crossref PubMed Scopus (29) Google Scholar At this time point, the expression of fibrillin-1 messenger ribonucleic acid (mRNA) in the renal cortex and in pooled isolated glomeruli was significantly higher in diseased animals, as determined by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) (Figure 1a and b). Immunofluorescent stainings for fibrillin-1 on renal cryostat sections showed a defined mesangial staining in the glomeruli of control rats (Figure 2a) and a more intense staining in the glomeruli at day 6 of disease (Figure 2b). Densitometric evaluation of fibrillin-1 staining in the glomerulus revealed significant differences in fibrillin-1 expression in control and diseased kidneys (Figure 2c). Tubulointerstitial fibrillin-1 staining was not significantly increased in Thy1.1 nephritic rats compared to controls (4.1±0.6% stained area per cortical view in Thy1.1 nephritic kidneys versus 3.2±0.6% in control kidneys, NS).Figure 2Expansion of fibrillin-1 staining in the mesangial matrix of the glomerulus. (a) Photomicrograph of a glomerulus in the kidney of a control rat. (b) Photomicrograph of a glomerulus in the kidney of a Thy1.1 nephritic rat. (c) Densitometric evaluation of glomerular fibrillin-1 staining. Data are means±s.e.m. (*P 250 mg/dl were included in the study. Blood glucose was followed daily (at 0800 h) for 5 weeks. Then animals were killed and kidney tissue was fixed in methyl-Carnoy solution (60% methanol, 30% chloroform, and 10% glacial acetic acid). Tissues were dehydrated by bathing in increasing concentrations of methanol, followed by 100% iso-propanol. After embedding in paraffin, 3 μm sections were cut with a Leitz SM 2000 R microtome (Leica Instruments, Nussloch, Germany). Staining of cryostat sections was performed as described elsewhere.27.Hartner A. Schocklmann H. Prols F. et al.Alpha8 integrin in glomerular mesangial cells and in experimental glomerulonephritis.Kidney Int. 1999; 56: 1468-1480Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar The primary rabbit antibody to fibrillin-128.Tiedemann K. Batge B. Muller P.K. Reinhardt D.P. Interactions of fibrillin-1 with heparin/heparan sulfate, implications for microfibrillar assembly.J Biol Chem. 2001; 276: 36035-36042Crossref PubMed Scopus (133) Google Scholar was used at a dilution 1:500. CY3-labeled anti-rabbit immunoglobulin G (IgG) (DAKO Diagnostica, Hamburg, Germany) was used as secondary antibody. Stained sections were evaluated in a Leitz Aristoplan microscope (Leica Instruments, Nussloch, Germany) as described previously.29.Hartner A. Cordasic N. Klanke B. et al.The alpha8 integrin chain affords mechanical stability to the glomerular capillary tuft in hypertensive glomerular disease.Am J Pathol. 2002; 160: 861-867Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar Glomerular fibrillin-1 staining was measured by Metaview in every glomerulus per cross section of frozen kidney (25–42 cross sections analyzed) and was expressed as percent of stained area per glomerular tuft. For evaluation of interstitial fibrillin-1 staining, the average area staining positive for fibrillin-1 in 10 high-power cortical views per kidney section was calculated as a percentage of the total cortical area. Semiquantification of proliferating glomerular cells was performed by immunohistochemistry, with a 1:50 diluted monoclonal antibody detecting proliferating cell nuclear antigen (DAKO, Hamburg, Germany), after deparaffinizing renal sections and blocking endogenous peroxidase activity with 3% H2O2 in methanol for 20 min at room temperature.30.Haas C.S. Amann K. Schittny J. et al.Glomerular and renal vascular structural changes in alpha8 integrin-deficient mice.J Am Soc Nephrol. 2003; 14: 2288-2296Crossref PubMed Scopus (55) Google Scholar As a negative control, we used equimolar concentrations of preimmune goat or mouse IgG. Each slide was counterstained with hematoxylin. To evaluate mRNA expression levels of fibrillin-1, total RNA was obtained from the renal cortex by extraction with RNeasy® Mini columns (Quiagen, Hilden, Germany) and from isolated glomeruli as described elsewhere.11.Hartner A. Hilgers K.F. Bitzer M. et al.Dynamic expression patterns of transforming growth factor-beta(2) and transforming growth factor-beta receptors in experimental glomerulonephritis.J Mol Med. 2003; 81: 32-42Crossref PubMed Scopus (29) Google Scholar First-strand cDNA was synthesized with TaqMan reverse transcription reagents (Applied Biosystems, Weiterstadt, Germany) using random hexamers as primers. The final RNA concentration in the reaction mixture was adjusted to 0.1 ng/μl. Reactions without Multiscribe reverse transcriptase were used as negative controls for genomic DNA contamination. PCR was performed with an ABI PRISM 7000 Sequence Detector System and SYBR Green reagents (Applied Biosystems) according to the manufacturer's instructions. The relative amount of specific mRNA was normalized with respect to 18S rRNA. Primers used for amplification of 18S cDNA were forward 5′TTGATTAAGTCCCTGCCCTTTGT3′ and reverse 5′CGATCCGAGGGCCTCACTA3′. For amplification of the rat fibrillin-1 cDNA, the forward primer was 5′TGCTCTGAAAGGACCCAATGT3′ and the reverse primer was 5′CGGGACAACAGTATGCGTTATAAC3′. All samples were run in triplicates. Mesangial cells were isolated from kidneys of Sprague–Dawley rats by the sieving method, as described previously.31.Lovett D.H. Sterzel R.B. Kashgarian M. Ryan J.L. Neutral proteinase activity produced in vitro by cells of the glomerular mesangium.Kidney Int. 1983; 23: 342-349Abstract Full Text PDF PubMed Scopus (113) Google Scholar Cultured mesangial cells showed a typical vascular smooth muscle-like morphology, positive immunostaining for smooth muscle α-actin and α8 integrin, and negative staining for markers of other cell types. Mesangial cells were grown in Dulbecco's modified Eagle's medium (PAA Laboratories GmbH, Linz, Austria) containing 10% fetal calf serum (FCS), 5 μg/ml insulin, 5 μg/ml plasmocin (TEBU, Frankfurt, Germany) and 2 mM L-glutamine (Sigma, Deisenhofen, Germany) in a 95% air–5% CO2 humidified atmosphere at 37°C. Mesangial cells were used for experiments in passages 5–15. Two fibrillin-1 fragments were used for coating: rF6H containing an RGD site and rF16 without an RGD site as depicted in Figure 3.32.Jensen S.A. Reinhardt D.P. Gibson M.A. Weiss A.S. Protein interaction studies of MAGP-1 with tropoelastin and fibrillin-1.J Biol Chem. 2001; 276: 39661-39666Crossref PubMed Scopus (116) Google Scholar In addition, correctly folded full-length recombinant fibrillin-1 was isolated as described,15.Lin G. Tiedemann K. Vollbrandt T. et al.Homo- and heterotypic fibrillin-1 and -2 interactions constitute the basis for the assembly of microfibrils.J Biol Chem. 2002; 277: 50795-50804Crossref PubMed Scopus (120) Google Scholar and was used for coating to further validate the data obtained with fragment rF6H. Coating concentrations and times were as indicated in the results. FN was used as a positive control and BSA as a negative control. For spreading, focal contact formation and proliferation experiments, 0.01% poly-L-lysine was added to the matrices for coating to assure a similar amount of cell adhesion on FN-, rF6H-, rF16-, and BSA-coated plates. An attachment assay was used based on the determination of the number of adherent cells by measuring the activity of the lysosomal enzyme hexosaminidase, as described by Gauer et al.33.Gauer S. Schulze-Lohoff E. Schleicher E. Sterzel R.B. Glomerular basement membrane-derived perlecan inhibits mesangial cell adhesion to fibronectin.Eur J Cell Biol. 1996; 70: 233-242PubMed Google Scholar Cells were allowed to attach for 1 h. For inhibition of adhesion, cyclic RGD or RAD peptides were obtained from Bachem, Switzerland, and used for preincubation of cells in the concentrations indicated in the results. Attachment on full-length fibrillin-1 was assessed after seeding 5000 mesangial cells per chamber slide. After washing, and staining with hematoxylin, adhered cells were counted in nine medium-power views per chamber slide. Spreading was determined in glass eight-well chamber slides 1 h after seeding by counting hematoxylin–eosin-stained cells that were attached and additionally clearly showed a cytoplasmatic area surrounding the nucleus. Focal contacts were visualized by staining cells with an antibody to vinculin (Sigma, Deissenhofen, Germany) 3 h after seeding as described.27.Hartner A. Schocklmann H. Prols F. et al.Alpha8 integrin in glomerular mesangial cells and in experimental glomerulonephritis.Kidney Int. 1999; 56: 1468-1480Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar Cell proliferation was estimated by using a BrdU incorporation assay into cellular DNA with a BrdU Labeling and Detection Kit (#1299964; Roche, Mannheim, Germany). Mesangial cells were washed two times with phosphate-buffered saline and serum-starved for 48 h in medium containing 0.1% FCS. After trypsinating and washing, they were seeded into culture slides (Falcon Becton Dickinson, Heidelberg, Germany), which had been coated with matrix proteins and blocked with 2% BSA. After a 2 h resting time for mesangial cells to attach to the matrix, mesangial cells were incubated with bFGF (10 ng/ml) or medium containing 2% FCS and BrdU for 48 h at 37°C. Mesangial cells were then fixed with 70% ethanol (50 mM glycine buffer, pH 2.0) and processed following the manufacturer's instructions. Incorporated BrdU was detected by an alkaline phosphatase-conjugated secondary antibody reacting with an NBT/X-phosphate substrate. Nuclei with a positive staining for BrdU were counted in a Leitz Aristoplan microscope (Leica Instruments, Nussloch, Germany). A transmigration assay was applied as described recently.34.Bieritz B. Spessotto P. Colombatti A. et al.Role of alpha8 integrin in mesangial cell adhesion, migration, and proliferation.Kidney Int. 2003; 64: 119-127Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar FluoroBlok Inserts (Falcon HTS, Becton Dickinson, Heidelberg, Germany), containing a proprietary light-opaque PET membrane to absorb visible light within the 490–700 nm range with 8 μm pores, were coated with different matrix proteins and saturated in FCS-free medium containing 1% BSA. Trypsinized mesangial cells were washed twice, labeled with 50 μg/ml DiI (Molecular Probes, Leiden, The Netherlands), a vital lipophilic carbocyanine, for 10 min at 37°C and seeded into inserts in a volume of 150 μl at a density of 1 × 106 cells/ml. The inserts were then incubated in 24 multiwell plates (Becton Dickinson, Heidelberg, Germany), each well filled with 700 μl medium containing 0.1% BSA for several hours. Measurements were performed within 0 (starting point) and 48 h incubation to observe transmigration. Transmigrated mesangial cells were detected with a SPECTRAFluor fluorometer (Tecan). Two-way analysis of variance, followed by the post hoc Newman–Keuls test with adjustment for multiple comparisons, was used to test the significance of differences between groups. A P-value <0.05 was considered significant. The procedures were carried out using SPSS software (SPSS Inc., Chicago, IL, USA). Values are displayed as means±s.e.m. for evaluation of fibrillin-1 mRNA expression and tissue protein expansion. Values are displayed as means±s.d. for cell assays. The expert technical assistance of Miroslava Kupraszewicz-Hutzler, Andrea Lüdke, Gudrun Hülsmann, Rainer Wachtveitl, and Martina Alexander is gratefully acknowledged. We thank Dr F Ramirez for kindly providing the fibrillin-1-underexpressing (mgR) mouse strain. This study was supported by a grant from the Deutsche Forschungsgemeinschaft, Bonn, Germany (STE 196/4-1), an ELAN grant from the Faculty of Medicine, University of Erlangen-Nürnberg and a grant from the Canadian Institutes of Health Research (MOP-68836).