Activation of Multifarious Transcription of an Adhesion Protein ap65-1 Gene by a Novel Myb2 Protein in the Protozoan Parasite Trichomonas vaginalis
2007; Elsevier BV; Volume: 282; Issue: 9 Linguagem: Inglês
10.1074/jbc.m610484200
ISSN1083-351X
AutoresShiou-Jeng Ong, Hong‐Ming Hsu, Hsing-Wei Liu, Chien‐Hsin Chu, Jung-Hsiang Tai,
Tópico(s)Enzyme Structure and Function
ResumoMultifarious transcription of the adhesion protein ap65-1 gene in the human pathogen, Trichomonas vaginalis, is critically regulated by the coordination of two similar but opposite oriented DNA regulatory regions, MRE-1/MRE-2r and MRE-2f, both of which are binding sites for multiple Myb-like proteins. In the present study, MRE-1/MRE-2r was demonstrated to be composed of multiple overlapping promoter elements, among which the entire region is required for growth-related ap65-1 transcription, and the 5′-MRE-1 antagonizes the suppressive activity of the 3′-MRE-2r in iron-inducible transcription. The recombinant Myb2 protein derived from a previously identified myb2 gene was demonstrated to recognize distinct sequence contexts in MRE-2r and MRE-2f, whereas Myb2 in the nuclear lysate preferentially binds to MRE-2f to MRE-2r. Iron repletion resulted in persistent repression of the myb2 gene, and temporal activation/deactivation of Myb2 promoter entry, which was also activated by prolonged iron depletion. The hemagglutinintagged Myb2 when overexpressed during iron-depleted conditions facilitated basal and growth-related ap65-1 transcription to a level that was achieved in iron-replete cells, whereas ironinducible ap65-1 transcription was abolished with knockdown of Myb2. These findings demonstrated that Myb2 is involved in activation of growth-related and iron-inducible transcription of the ap65-1 gene, possibly through differential promoter selection in competition with other Myb proteins. Multifarious transcription of the adhesion protein ap65-1 gene in the human pathogen, Trichomonas vaginalis, is critically regulated by the coordination of two similar but opposite oriented DNA regulatory regions, MRE-1/MRE-2r and MRE-2f, both of which are binding sites for multiple Myb-like proteins. In the present study, MRE-1/MRE-2r was demonstrated to be composed of multiple overlapping promoter elements, among which the entire region is required for growth-related ap65-1 transcription, and the 5′-MRE-1 antagonizes the suppressive activity of the 3′-MRE-2r in iron-inducible transcription. The recombinant Myb2 protein derived from a previously identified myb2 gene was demonstrated to recognize distinct sequence contexts in MRE-2r and MRE-2f, whereas Myb2 in the nuclear lysate preferentially binds to MRE-2f to MRE-2r. Iron repletion resulted in persistent repression of the myb2 gene, and temporal activation/deactivation of Myb2 promoter entry, which was also activated by prolonged iron depletion. The hemagglutinintagged Myb2 when overexpressed during iron-depleted conditions facilitated basal and growth-related ap65-1 transcription to a level that was achieved in iron-replete cells, whereas ironinducible ap65-1 transcription was abolished with knockdown of Myb2. These findings demonstrated that Myb2 is involved in activation of growth-related and iron-inducible transcription of the ap65-1 gene, possibly through differential promoter selection in competition with other Myb proteins. Trichomonas vaginalis is a protozoan parasite that causes the most common sexually transmitted disease of nonviral origin in humans. The disease poses an imminent threat to public health as revealed by recent findings that transmission of the human immunodeficiency virus increases in patients with trichomoniasis (1Sorvillo F. Smith L. Kerndt P. Ash L. Emerg. Infect. Dis. 2001; 7: 927-932Crossref PubMed Scopus (200) Google Scholar). The parasite persistently inhabits the human urogenital tract without an alternating life stage outside of the host. Cytoadherence, which is crucial for T. vaginalis to establish an infection, has been shown to involve multiple surface adhesion proteins and lipophosphoglycans (2Alderete J.F. Milsap K.W. Lehker M.W. Benchimol M. Cell Microbiol. 2001; 3: 359-370Crossref PubMed Scopus (43) Google Scholar, 3Moreno-Brito V. Yanez-Gomez C. Meza-Cervantez P. Avila-Gonzalez L. Rodriguez M.A. Ortega-Lopez J. Gonzalez-Robles A. Arroyo R. Cell Microbiol. 2005; 7: 245-258Crossref PubMed Scopus (54) Google Scholar, 4Bastida-Corcuera F.D. Okumura C.Y. Colocoussi A. Johnson P.J. Eukaryot. Cell. 2005; 4: 1951-1958Crossref PubMed Scopus (71) Google Scholar). The iron supply, which undergoes periodic fluctuations in the human vagina, is one of the principle determinants modulating cytoadherence of the parasite toward human vaginal epithelial cells (5Garcia A.F. Chang T.H. Benchimol M. Klumpp D.J. Lehker M.W. Alderete J.F. Mol Microbiol. 2003; 47: 1207-1224Crossref PubMed Scopus (83) Google Scholar, 6Alderete J.F. Nguyen J. Mundodi V. Lehker H.W. Microb. Pathog. 2004; 36: 263-271Crossref PubMed Scopus (27) Google Scholar), possibly through transcriptional regulation of some of the adhesion protein (ap) 2The abbreviations used are: ap, adhesion protein; ChIP, chromatin immunoprecipitation; EMSA, electrophoretic mobility shift assay; HA, hemagglutinin; IFA, immunofluorescence assay; MRE, Myb-recognition element; MRE-1-BP, MRE-1-binding protein; MRE-2-BP, MRE-2-binding protein; RT-PCR, reverse transcriptase-polymerase chain reaction; utr, untranslated region.2The abbreviations used are: ap, adhesion protein; ChIP, chromatin immunoprecipitation; EMSA, electrophoretic mobility shift assay; HA, hemagglutinin; IFA, immunofluorescence assay; MRE, Myb-recognition element; MRE-1-BP, MRE-1-binding protein; MRE-2-BP, MRE-2-binding protein; RT-PCR, reverse transcriptase-polymerase chain reaction; utr, untranslated region. genes, especially those in the ap65 family (7Mundodi V. Kucknoor A.S. Klumpp D.J. Chang T.H. Alderete J.F. Mol. Microbiol. 2004; 53: 1099-1108Crossref PubMed Scopus (28) Google Scholar, 8Kucknoor A.S. Mundodi V. Alderete J.F. BMC Mol. Biol. 2005; 6: 5Crossref PubMed Scopus (21) Google Scholar), which encode proteins identical to malic enzymes (9Alderete J.F. O'Brien J.L. Arroyo R. Engbring J.A. Musatovova O. Lopez O. Lauriano C. Nguyen J. Mol. Microbiol. 1995; 17: 69-83Crossref PubMed Scopus (76) Google Scholar, 10Hrdy I. Muller M. J. Eukaryot Microbiol. 1995; 42: 593-603Crossref PubMed Scopus (65) Google Scholar). Iron has also been implicated in modulating phenotypic variation of the parasite as well as its resistance to complement lysis (11Alderete J.F. Provenzano D. Lehker H.W. Microb. Pathog. 1995; 19: 93-103Crossref PubMed Scopus (79) Google Scholar, 12Alderete J.F. Infect. Immun. 1999; 67: 4298-4302Crossref PubMed Google Scholar). These observations underscore the importance of iron in modulating expression of parasite virulence. Gene transcription in T. vaginalis is monocistronic with only a few intron-containing genes capable of undergoing RNA splicing (13Vanacova S. Yan W. Calton J.M. Johnson P. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 4430-4435Crossref PubMed Scopus (73) Google Scholar). Transcription initiation by RNA polymerase II is thus a key step in controlling expression of the protein coding genes in the parasite. Using transcription of the ap65-1 gene as a model system, we have been studying transcription machinery that controls parasitic gene expression in coping with rapid changes in the growth environment (14Tsai C.D. Liu H.W. Tai J.H. J. Biol. Chem. 2002; 277: 5153-5162Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar, 16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). The ap65-1 promoter was demonstrated to comprise a simple core promoter that only contains a ubiquitous initiator element spanning the transcription initiation site (+1) (14Tsai C.D. Liu H.W. Tai J.H. J. Biol. Chem. 2002; 277: 5153-5162Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 17Liston D.R. Johnson P.J. Mol. Cell. Biol. 1999; 19: 2380-2388Crossref PubMed Scopus (77) Google Scholar), a proximal promoter (-132 to -37) that controls iron-inducible as well as growth-related promoter activities (14Tsai C.D. Liu H.W. Tai J.H. J. Biol. Chem. 2002; 277: 5153-5162Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar), and a distal regulatory region (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). The proximal promoter region contains eight closely spaced promoter elements (15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar), among which three Myb recognition elements (MRE), MRE-1/MRE-2r which overlap, and MRE-2f, are the binding sites for several Myb-like DNA binding transcription factors (14Tsai C.D. Liu H.W. Tai J.H. J. Biol. Chem. 2002; 277: 5153-5162Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar, 16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). The promoter distal region, which is essential for optimal promoter activity, 3J. H. Tai, unpublished observations.3J. H. Tai, unpublished observations. also contains two additional clusters of MRE-1/MRE-2r- and MRE-2f-like DNA sequences (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). The MRE-1/MRE-2r and MRE-2f regions share similar but opposite oriented DNA sequences, ATAACGATA and TATCGTC, respectively, each of which is also the binding site for multiple nuclear DNA-binding proteins (15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar). Both DNA regions are required for optimal growth-related transcription, but MRE-1/MRE-2r counteracts MRE-2f positive action on iron-inducible transcription (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). Southwestern screening of a T. vaginalis cDNA expression library revealed two MRE-2f-binding protein genes, myb1 and myb2, which encode 24-kDa and 21-kDa open reading frames, respectively (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). The Myb1 protein displays dual DNA binding specificity with higher affinity binding to MRE-1/MRE-2r than to MRE-2f. Myb1, when overexpressed in the transgenic parasite to a level similar to endogenous Myb1, can differentially select three defined sites, each of which contains a cluster of MRE-1/MRE-2r- and MRE-2f-like elements (see Fig. 7A), in the ap65-1 promoter in a growth-related manner, and repress basal or iron-inducible, but enhance growth-related, ap65-1 transcription (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). In the present study, we found that the MRE-1/MRE-2r regulatory region is composed of multiple overlapping promoter elements, and that the entire region is required for growth-related activity, while 5′-MRE-1 antagonizes the suppressive activity of 3′-MRE-2r on iron-inducible activity of the ap65-1 promoter. The Myb2 protein encoded by the myb2 gene was found to interact with specific sequence contexts spanning MRE-2r and MRE-2f and which are distinct from those recognized by Myb1. Further biochemical and functional studies suggested that Myb2 is involved in activation of both iron-inducible and growth-related transcription of the ap65-1 gene. Information derived from the current study will be useful for further elucidating signaling pathways and regulatory circuits potentially leading to iron-inducible gene regulation in T. vaginalis. Cultures—T. vaginalis T1 cells were maintained as previously described (14Tsai C.D. Liu H.W. Tai J.H. J. Biol. Chem. 2002; 277: 5153-5162Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). Iron repletion or depletion was achieved with the addition of 250 μm ferrous ammonium sulfate or 50 μm of an iron-chelator, 2, 2′-dipyridyl, respectively, in growth medium. A WT-13 cell line harboring a reporter plasmid, pAP65-1luc+/TUBneo, for the activity assay of the ap65-1 promoter was obtained from a previous study (15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar). DNA Transfection and Selection for Stable Transfectants—Plasmid DNA was electroporated into T. vaginalis for paromomycin selection of stable transfectants as previously described (15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar). Promoter Assay—Stable cell lines harboring the mutated reporter plasmid, pAPm(MRE-1) or pAPm(MRE-2r) (see below), are referred to as m(MRE-1) or m(MRE-2r), respectively. Luciferase activity in stable cells conferred by the expression of the luc+ reporter gene was measured as previously described (14Tsai C.D. Liu H.W. Tai J.H. J. Biol. Chem. 2002; 277: 5153-5162Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). In the promoter assay, relative amounts of respective plasmids in cells from individual cell lines were determined by dot hybridization as previously described (15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar), and their promoter activities were normalized accordingly. Oligonucleotides—Sequences of the oligonucleotides used in the present study are either listed in Table 1 or were reported in a previous study (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar).TABLE 1Sequences of oligonucleotides used in this studyNameSequence (5′- to 3′)For RT-PCRmyb2-173fAAATGCTCAAGCGTGCTGTCGCTCmyb2-3′utrTTTTTTCTAAAAGCTCCAAAAAAATACAGTFor plasmid constructionaThe sequence of the restriction enzyme site as indicated in the name is underlined.tub-90fGAATGCCGTCCGTTAAGACm(−95/−94)-5′CCATTTTTGAAGGAAGACGACGATATTTAAAAGm(−95/−94)-3′CTTTTAAATATCGTCGTCTTCCTTCAAAAATGGm(−89/−88)-5′GAAGGAAGATAACGAGCTTTAAAAGAATTATTGm(−89/−88)-3′CAATAATTCTTTTAAAGCTCGTTATCTTCCTTCap65-2.1-5′sac2ACCGCGGACTTCGATAATCAATTCTGAAGap65-2-3′nde1ACATATGCATCTTTAATCTGAAATGAAATGha-myb2-5′nde1ACATATGTACCCATACGATGTTCCAGATTACGCTCTTATGACTGGATATGAAAAAGGTCCmyb2-3′bgl2AAGATCTTTATTGTGATTCTTGCTTCATCαs-myb2-5′bgl2AAGATCTATGACTGGATATGAAAAAGGTCCαs-myb2-3′nde1ACATATGTTATTGTGATTCTTGCTTCATCap65-1-3′utr-bgl2ACCAGATCTCAAGTACCTCATCGACAACGAGCap65-1-3′utr-nsi1ACCAATGCATACTAGTGATTTAAATTAAGAAAGClic-myb2-5′GACGACGACAAGATGACTGGATATGAAAAAGGTClic-myb2-3′GAGGAGAAGCCCGGTTTATTGTGATTCTTGCTTCATFor ChIPtub-1fTGATCACAAAACATTCATTCtub-1rAACGATTTCACGAACCATGAAGtub-2fTACAGCTTAAATGAAATTTATATTCCTGATtub-2rGAATGAATGTTTTTGTGATCAtub-3fATTGCCGTTTTTGGCAGAAGAACAAAATGGtub-3rATCAGGAATATAAATTTCATTTAAGCTGTAa The sequence of the restriction enzyme site as indicated in the name is underlined. Open table in a new tab Cloning of the Genomic myb2 Gene—A T. vaginalis T1 genomic DNA library and a partial cDNA sequence of the myb2 gene were obtained from a previous study (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). The sequence flanking 5′-end of the myb2 gene was amplified from the genomic DNA library by a polymerase chain reaction (PCR) using the primer pair, T3 and myb2-3′-2. The amplified DNA was then cloned into pGEM_Teasy for DNA sequencing as described by the supplier (Promega). Construction of Plasmids—The plasmid, pAP65-1luc+/TUBneo (Fig. 1A), was obtained from a previous study (15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar). A 5′-PCR product was amplified from pAP65-1luc+/TUBneo using tub90f as the 5′-primer and a 3′-antisense primer, m(-95/-94)-3′ or m(-89/-88)-3′, at the target site to create mutations in MRE-1 or MRE-2r, respectively. A 3′-PCR product was amplified from pAP65-1luc+/TUBneo using a 5′-primer, m(-95/-94)-5′ or m(-89/-88)-5′, at the target site and luc344r as the 3′-primer. The 5′ and 3′ PCR products were purified and mixed as templates for second round of the PCR using the primer pair tub90f and luc344r. The mutated plasmid, pAPm(MRE-1) or pAPm(MRE-2r), was obtained by replacing the SacII/HindIII fragment in pAP65-1luc+/TUB-neo with the final PCR product predigested with SacII and HindIII. To construct a gene overexpression system, a DNA fragment spanning the coding region of the myb2 gene was amplified from genomic DNA by PCR using the primer pair ha-myb2-5′nde1 and myb2-3′bgl2, and was then cloned into pGEM_Teasy to generate pTA-ha-myb2. A DNA fragment spanning the 5′-untranslated region (-324/+22) of the ap65-2 gene (9Alderete J.F. O'Brien J.L. Arroyo R. Engbring J.A. Musatovova O. Lopez O. Lauriano C. Nguyen J. Mol. Microbiol. 1995; 17: 69-83Crossref PubMed Scopus (76) Google Scholar) was amplified using the primer pair, ap65-2.1-5′sac2 and ap65-2-3′nde1, and was then cloned into pGEM_Teasy to generate pTA-AP65-2.1. A DNA fragment spanning the 3′-untranslated region of the ap65-1 gene was amplified by PCR from genomic DNA using the primer pair, ap65-1-3′utr-blg2 and ap65-1-3′utr-nsi1. The DNA fragment was cloned into pGEM_Teasy to generate pTA-AP65-1-3′utr. The SacII/NdeI fragment from pTA-AP65-2.1, the NdeI/BglII fragment from pTA-ha-myb2, and the BglII/NsiI fragment from pTA-AP65-1-3′utr were cloned into pAP65-1luc+/TUBneo predigested with SacII and NsiI to generate the HA-Myb2 expression plasmid, pAP65-2.1-ha-myb2/TUBneo (Fig. 5A). To construct an antisense gene knockdown system, a DNA fragment spanning the coding region of the myb2 gene was amplified from genomic DNA by PCR using a forward primer, αs-myb2-3′nde1 and a reverse primer, αs-myb2-5′bgl2, and was then cloned into pGEM_Teasy to generate pTAαs-myb2. The plasmid, pAP65-2.1-αs-myb2/TUBneo, was generated by replacing the NdeI/BglII fragment in pAP65-2.1-ha-myb2/TUBneo with the NdeI/BglII fragment from pTAαs-myb2 (Fig. 6A). To express recombinant protein, the coding region of the myb2 gene was amplified from genomic DNA by PCR using the primer pair lic-myb2-5′ and lic-myb2-3′. The plasmid, pET30/Myb2, was generated by ligation of the PCR product with pET30 using a pET30EK/LIC vector kit as suggested by the supplier (Novagen). Northern Hybridization—Cellular RNA was extracted from T. vaginalis using the TRIzol reagent (Invitrogen), and mRNA was purified using oligo(dT) cellulose chromatography. Probe labeling and Northern hybridization were performed as previously described (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). The [α-32P]dCTP-labeled myb2 DNA probe was synthesized from a pTAha-myb2 template. Reverse Transcriptase-PCR (RT-PCR)—A semiquantitative RT-PCR assay was performed to examine expression levels of ap65-1, β-tubulin, and myb2 transcripts in total RNA as previously described (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). The myb2 cDNA was amplified using the primer pair myb2-173f and myb2-3′utr, and was annealed at 55 °C. Expression of the Recombinant Myb2 Protein (rMyb2)—The rMyb2 protein expression vector, pET30/Myb2, was transformed into the Escherichia coli BL21-Codon Plus DE3-RIL strain (Stratagene) for the production of rMyb2. E. coli transformed with pET30/Myb2 in shaking cultures was incubated at 37 °C until the A600 reached 0.6. The induction was performed with the addition of 1 mm isopropylthio-β-d-galactoside for 2 h. Under these conditions, the majority of rMyb2 was determined to be in the inclusion bodies (see Fig. 4A). Soluble rMyb2 was purified using a His-bind nickel column as described by the supplier (Novagen). Antibody Production—Purified rMyb2 was used for rabbit immunization by a standard protocol (18Harlow E. Land D. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1988: 92-119Google Scholar), and antiserum was purified by protein A affinity chromatography as described by the supplier (Sigma). Western Blotting—Cytoplasmic and nuclear fractions of T. vaginalis total lysate were prepared for the Western blotting and DNA binding assay described below using a cellular fractionation kit, NE-PER™, as described by the supplier (Pierce). In some of the experiments, a semiquantitative Western blot assay using serially diluted protein samples from lysate equivalent to 105 ∼ 106 cells was performed as previously described (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). The ECL system was used for signal detection as instructed by the supplier (Pierce). Reaction conditions for antibodies from commercial sources, including the mouse monoclonal anti-α-tubulin antibody (5,000×) (DM1A, Sigma), rat monoclonal anti-HA antibody (2,000×) (3F10, Roche Applied Science), and His6 monoclonal antibody (10,000×) (Clontech), were as described by the supplier. The Myb2 and AP65 proteins were detected using a rabbit anti-Myb2 antibody (2,000×) and mouse monoclonal anti-malic enzyme antibody 15D7 (19Brugerolle G. Bricheux G. Coffe G. Parasitol. Res. 2000; 86: 30-35Crossref PubMed Scopus (23) Google Scholar) (10,000×), respectively. Immunofluorescence Assay (IFA)—Subcellular localization of HA-Myb2 or the NEO selective marker was performed by IFA using a mouse anti-HA monoclonal antibody (200×) (HA-7, Sigma) or rabbit anti-NPT-II antibody (800×) (Upstate) as previously described (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar). Electrophoretic Mobility Shift Assay (EMSA)—Probe labeling and EMSA were performed as previously described (14Tsai C.D. Liu H.W. Tai J.H. J. Biol. Chem. 2002; 277: 5153-5162Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar), except that in some of the binding reactions, the serially diluted anti-Myb2 antibody or normal rabbit serum was included. Signal intensity of the 32P isotope was measured using a Typhoon 9410 Variable Mode Imager (Amersham Biosciences). Chromatin Immunoprecipitation Assay (ChIP)—A ChIP assay was performed as previously described (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar, 20Liu Y. Kung C. Fishburn J. Ansari A.Z. Shokat K.M. Hahn S. Mol. Cell. Biol. 2004; 24: 1721-1735Crossref PubMed Scopus (144) Google Scholar). In some of the reactions, an aliquot of supernatant recovered from the DNA shearing step was reacted with 20 μl of the anti-Myb2 antibody or normal rabbit serum followed by immunoprecipitation with protein A-agarose (Sigma). The DNA fragment spanning region I, II, or III of the β-tubulin promoter was amplified by PCR using primer pairs tub-1f and tub-1r, tub-2f and tub2-r, or tub-3f and tub-3r, respectively. Overlapping DNA Elements in MRE-1/MRE-2r—The DNA sequence, ATAACGATA, spanning the MRE-1/MRE-2r overlap was found to be composed of three distinct nuclear protein-binding sites, ANAACGAT for Myb1 (16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar), and TAACGA (MRE-1) and CGATA (MRE-2r) for the reputed MRE-1-binding protein (MRE-1-BP) and MRE-2r-binding protein, respectively (15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar). To study whether MRE-1/MRE-2r comprises multiple, functionally distinct promoter elements in vivo, site-directed mutagenesis of the ap65-1 promoter was conducted using a reporter plasmid, pAP65-1luc+/TUBneo, and two related mutant plasmids (Fig. 1). The mutation of MRE-1 that retains intact MRE-2r resulted in diminished growth-related ap65-1 promoter activity from the original 15-fold to 2-fold, but without an effect on basal activity. The iron-inducible activity was also diminished from the original 6-fold to 2-fold. By contrast, only ∼20% of the original basal as well as growth-related ap65-1 promoter activity was detected in the mutation of MRE-2r that retains intact MRE-1, and the iron-inducible activity was activated to 24-fold from the original 6-fold. Consistent with the nuclear protein binding specificities (15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar, 16Ong S.J. Hsu H.M. Liu H.W. Chu C.H. Tai J.H. Eukaryot Cell. 2006; 5: 391-399Crossref PubMed Scopus (41) Google Scholar), these results suggest that the MRE-1/MRE-2r region is composed of multiple overlapping promoter elements, which display intricate relationship in regulating multifarious ap65-1 transcription. Iron Repressive Expression of the myb2 Gene—The myb2 gene encodes an open reading frame of 176 amino acid residues, with a size estimated to be 21 kDa and a PI value of 8.01. Myb2 shares little homology with Myb1 in the protein sequence outside of the conserved R2R3 DNA-binding domain (Fig. 2A). Even in this conserved domain (∼60% similarity), only three out of eight base-contacting amino acid residues identified in the mammalian cMyb (21Ogata K. Morikawa S. Nakamura H. Sekikawa A. Inoue T. Kanai H. Sarai A. Ishii S. Nishimura Y. Cell. 1994; 79: 639-648Abstract Full Text PDF PubMed Scopus (427) Google Scholar) were identical between the protein sequences of Myb1 and Myb2 (Fig. 2B). The myb2 gene was expressed as a 0.6-kb mRNA species in T. vaginalis as revealed by Northern hybridization (Fig. 3A). The expression level of myb2 mRNA under iron-replete conditions was 2-fold lower than that under iron-depleted conditions as examined by semiquantitative RT-PCR (Fig. 3B). The expression level slightly varied in an 18-h period. The expression level of β-tubulin mRNA remained constant under all test conditions. A major 27-kDa band and several faster migrating minor bands with sizes between 21 and 25 kDa were detected in cell lysate from T. vaginalis by Western blotting using the anti-Myb2 antibody (Fig. 3, C and D). The 27-kDa band was distributed in both the cytoplasmic and nuclear fractions to similar extents, but those faster migrating ones were only detected in the cytoplasmic fractions even when samples were overloaded to increase detection sensitivity (Fig. 3C). The purity of these cellular fractions was examined using an antibody against a cytosolic malic enzyme (22Dolezal P. Vanacova S. Tachezy J. Hrdy I. Genes. 2004; 329: 81-92Google Scholar) or α-tubulin that detected a 50-kDa band only in the cytoplasmic fractions or a 55-kDa band only in the nuclear fractions, respectively. None of these protein bands was detected on a duplicate blot either using preimmune serum or the anti-Myb2 antibody that had been pre-adsorbed with purified rMyb2 (data not shown). The cellular distribution of Myb2 as examined by semiquantitative Western blotting only slightly varied under our test conditions (Fig. 3D). Consistent with the RNA analysis (Fig. 3B), the signal intensity of the 27-kDa protein in samples from iron-replete cells was also 2-fold lower than that in samples from iron-depleted cells. DNA Binding Specificity of Myb2—The rMyb2 protein was purified (Fig. 4A) for use in EMSA. rMyb2 at as little as 2.5 ng was sufficient to form a major complex with the MRE-1/MRE-2r-containing [32P]IR probe (Fig. 4B, left panel), and two discernible DNA-protein complexes with the MRE-2f-containing [32P]IR3′ probe (Fig. 4B, right panel), with similar activities. The DNA binding specificity of rMyb2 against [32P]IR was then tested in competition assays using a 250× molar excess of the cold IR or mutated sequences of the mIR series (Fig. 4C) as previously described (15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar). The DNA-protein complex was incompletely competed to various degrees with various mutant competitors. Similar results were observed in the reactions with [32P]IR3′ in the competition assays (Fig. 4D). The signal intensity of the DNA-protein complexes in individual reactions was measured, revealing that CGATA, which resembles the target site of the reputed MRE-2r-binding proteins (15Ong S.J. Huang S.C. Liu H.W. Tai J.H. Mol. Microbiol. 2004; 52: 1721-1730Crossref PubMed Scopus (20) Google Scholar), and tAtCGTc spanning MRE-2f are the primary binding sites (upper and lowercase letters indicate strong or weak contact sites, respectively) of rMyb2. The DNA binding activity of Myb2 in the nuclear lysate was then examined. Two DNA-protein complexes (I and II) were detected in the binding reactions including 10 μg of nuclear proteins and either [32P]IR or [32P]IR3′ (Fig. 4, E and F, respectively). Co-incubation with the serially diluted anti-Myb2 antibody only resulted in disruption of complex I in each binding reaction to a level dependent on the serum concentration, indicating that Myb2 is only one of the nuclear proteins targeting MRE-1/MRE-2r or MRE-2f. This interference effect was not observed with co-incubation of serially diluted normal rabbit serum. The signal intensity of the Myb2-DNA complex in the binding reactions revealed that nuclear Myb2 bound 6-fold as much [32P]IR as [32P]IR3′ (Fig. 4G), suggesting that nuclear Myb2 preferentially binds MRE-2f over MRE-2r. HA-Myb2 Overexpression—The HA-Myb2 expression plasmid, pAP65-2.1ha-myb2/TUBneo (Fig. 5A), was used to overexpress a HA-tagged Myb2 protein in T. vaginalis. The HA signal was primarily detected in nuclei of more than 95% of transfected cells, but in none of the non-tra
Referência(s)