Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

The Cytoplasmic Loops between Domains II and III and Domains III and IV in the Skeletal Muscle Dihydropyridine Receptor Bind to a Contiguous Site in the Skeletal Muscle Ryanodine Receptor

1998; Elsevier BV; Volume: 273; Issue: 45 Linguagem: Inglês

10.1074/jbc.273.45.29958

ISSN

1083-351X

Autores

Peng Leong, David H. MacLennan,

Tópico(s)

Insect and Pesticide Research

Resumo

Excitation-contraction coupling in skeletal muscle is a result of the interaction between the Ca2+ release channel of skeletal muscle sarcoplasmic reticulum (ryanodine receptor or RyR1) and the skeletal muscle L-type Ca2+ channel (dihydropyridine receptor or DHPR). Interactions between RyR1 and DHPR are critical for the depolarization-induced activation of Ca2+ release from the sarcoplasmic reticulum, enhancement of DHPR Ca2+ channel activity, and repolarization-induced inactivation of RyR1. The DHPR III–IV loop was fused to glutathione S-transferase (GST) or His-peptide and used as a protein affinity column for35S-labeled, in vitro translated fragments from the N-terminal three-fourths of RyR1. RyR1 residues Leu922–Asp1112 bound specifically to the DHPR III–IV loop column, but the corresponding fragment from the cardiac ryanodine receptor (RyR2) did not. Construction of chimeras between RyR1 and RyR2 showed that amino acids Lys954–Asp1112 retained full binding activity, whereas Leu922–Phe1075 had no binding activity. The RyR1 sequence Arg1076–Asp1112, previously shown to interact with the DHPR II–III loop (Leong, P., and MacLennan, D., H. (1998) J. Biol. Chem. 273, 7791–7794), bound to DHPR III–IV loop columns, but with only half the efficiency of binding of the longer RyR1 sequence, Lys954–Asp1112. These data suggest that the site of DHPR III–IV loop interaction contains elements from both the Lys954–Phe1075 and Arg1076–Asp1112 fragments. The presence of 4 ± 0.4 μm GST-DHPR II–III or 5 ± 0.1 μm His-peptide-DHPR III–IV was required for half-maximal co-purification of 35S-labeled RyR1 Leu922–Asp1112 on glutathione-Sepharose or Ni2+-nitrilotriacetic acid. Dose-dependent inhibition of 35S-labeled RyR1 Leu922–Asp1112 binding to GST-DHPR II–III and GST-DHPR III–IV by His10-DHPR II–III and His-peptide-DHPR III–IV was observed. These studies indicate that the DHPR II–III and III–IV loops bind to contiguous and possibly overlapping sites on RyR1 between Lys954 and Asp1112. Excitation-contraction coupling in skeletal muscle is a result of the interaction between the Ca2+ release channel of skeletal muscle sarcoplasmic reticulum (ryanodine receptor or RyR1) and the skeletal muscle L-type Ca2+ channel (dihydropyridine receptor or DHPR). Interactions between RyR1 and DHPR are critical for the depolarization-induced activation of Ca2+ release from the sarcoplasmic reticulum, enhancement of DHPR Ca2+ channel activity, and repolarization-induced inactivation of RyR1. The DHPR III–IV loop was fused to glutathione S-transferase (GST) or His-peptide and used as a protein affinity column for35S-labeled, in vitro translated fragments from the N-terminal three-fourths of RyR1. RyR1 residues Leu922–Asp1112 bound specifically to the DHPR III–IV loop column, but the corresponding fragment from the cardiac ryanodine receptor (RyR2) did not. Construction of chimeras between RyR1 and RyR2 showed that amino acids Lys954–Asp1112 retained full binding activity, whereas Leu922–Phe1075 had no binding activity. The RyR1 sequence Arg1076–Asp1112, previously shown to interact with the DHPR II–III loop (Leong, P., and MacLennan, D., H. (1998) J. Biol. Chem. 273, 7791–7794), bound to DHPR III–IV loop columns, but with only half the efficiency of binding of the longer RyR1 sequence, Lys954–Asp1112. These data suggest that the site of DHPR III–IV loop interaction contains elements from both the Lys954–Phe1075 and Arg1076–Asp1112 fragments. The presence of 4 ± 0.4 μm GST-DHPR II–III or 5 ± 0.1 μm His-peptide-DHPR III–IV was required for half-maximal co-purification of 35S-labeled RyR1 Leu922–Asp1112 on glutathione-Sepharose or Ni2+-nitrilotriacetic acid. Dose-dependent inhibition of 35S-labeled RyR1 Leu922–Asp1112 binding to GST-DHPR II–III and GST-DHPR III–IV by His10-DHPR II–III and His-peptide-DHPR III–IV was observed. These studies indicate that the DHPR II–III and III–IV loops bind to contiguous and possibly overlapping sites on RyR1 between Lys954 and Asp1112. excitation-contraction ryanodine receptor dihydropyridine receptor Ni2+-nitrilotriacetic acid polymerase chain reaction glutathioneS-transferase polyacrylamide gel electrophoresis bovine serum albumin. Excitation-contraction (E-C)1 coupling describes the events leading from electrical stimulation of muscle to the release of Ca2+ from the sarcoplasmic reticulum. Closure of the Ca2+ release channel and activation of the sarco(endo)plasmic reticulum Ca2+ATPase (SERCA) return intracellular Ca2+ to resting levels (1Lytton J. MacLennan D.H. Fozzard H.A. Haber E. Jennings R.B. Katz A.M. Morgan H.E. The Heart and Cardiovascular System: Scientific Foundations. 2. Raven Press, New York1992: 1203-1222Google Scholar). Extracellular Ca2+ is not necessary for E-C coupling in skeletal muscle, but is required in cardiac muscle, distinguishing the mechanism of E-C coupling in these muscles (2Catterall W.A. Cell. 1991; 64: 871-874Abstract Full Text PDF PubMed Scopus (148) Google Scholar). E-C coupling in RYR1 knockout mice can be restored in primary cultures of myotubes isolated from these mice by injection with RYR1 cDNA (3Nakai J. Dirksen R.T. Nguyen H.T. Pessah I.N. Beam K.G. Allen P.D. Nature. 1996; 380: 72-75Crossref PubMed Scopus (398) Google Scholar). During E-C coupling, Ca2+ release from the Ca2+ release channel of skeletal muscle sarcoplasmic reticulum (ryanodine receptor or RyR1) is activated by the L-type Ca2+ channel of skeletal muscle (dihydropyridine receptor or DHPR) (4Rios E. Brum G. Nature. 1987; 325: 717-720Crossref PubMed Scopus (650) Google Scholar). A retrograde signal from RyR1, but not from the cardiac ryanodine receptor (RyR2), enhances DHPR Ca2+ channel activity (3Nakai J. Dirksen R.T. Nguyen H.T. Pessah I.N. Beam K.G. Allen P.D. Nature. 1996; 380: 72-75Crossref PubMed Scopus (398) Google Scholar, 5Nakai J. Ogura T. Protasi F. Franzini-Armstrong C. Allen P.D. Beam K.G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 1019-1022Crossref PubMed Scopus (91) Google Scholar). In addition, skeletal DHPR is critical for terminating Ca2+ release through RyR1 upon membrane repolarization (6Suda N. Penner R. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 5725-5729Crossref PubMed Scopus (29) Google Scholar, 7Suda N. J. Physiol. (Lond.). 1995; 486: 105-112Crossref Scopus (11) Google Scholar, 8Suda N. Heinemann C. Pfluegers Arch. Eur. J. Physiol. 1996; 432: 948-951Crossref PubMed Scopus (3) Google Scholar). Regions of RyR1 important for interactions with DHPR, leading to activation of Ca2+ release during E-C coupling and for retrograde enhancement of DHPR Ca2+ channel activity by RyR1, have been identified through the study of RyR1/RyR2 chimeras in RYR1 knockout mice (9Nakai J. Sekiguchi N. Rando T.A. Allen P.D. Beam K.G. J. Biol. Chem. 1998; 273: 13403-13406Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar). The complex physiology involving the multiple interactions between RyR1 and DHPR suggests that the structural interaction between RyR1 and DHPR may involve more than one site in the two proteins. The importance of the DHPR II–III loop in E-C coupling has been demonstrated by Tanabe et al. (10Tanabe T. Beam K.G. Powell J.A. Numa S. Nature. 1988; 336: 134-139Crossref PubMed Scopus (582) Google Scholar, 11Tanabe T. Beam K.G. Adams B.A. Niidome T. Numa S. Nature. 1990; 346: 567-569Crossref PubMed Scopus (492) Google Scholar) through the study of dysgenic myotubes lacking DHPR. Skeletal-type E-C coupling can be reconstituted in these myotubes by injecting cDNA encoding chimeras between skeletal and cardiac DHPRs with only the II–III loop retaining the skeletal sequence. The DHPR II–III loop has been shown to activate the skeletal muscle ryanodine receptor in studies measuring Ca2+ currents across planar lipid bilayer carried by RyR1 (12Lu X. Xu L. Meissner G. J. Biol. Chem. 1994; 269: 6511-6516Abstract Full Text PDF PubMed Google Scholar, 13Lu X. Xu L. Meissner G. J. Biol. Chem. 1995; 270: 18459-18464Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). Ca2+ release has also been elicited from muscle triad vesicle preparations by the addition of the DHPR II–III loop peptide (14el-Hayek R. Antoniu B. Wang J. Hamilton S.L. Ikemoto N. J. Biol. Chem. 1995; 270: 22116-22118Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). A protein affinity chromatography approach was used to identify an interaction site on RyR1 for the DHPR II–III loop (15Leong P. MacLennan D.H. J. Biol. Chem. 1998; 273: 7791-7794Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Malignant hyperthermia is an abnormality of Ca2+ regulation that is linked to RYR1 on human chromosome 19 in at least 50% of cases (16MacLennan D.H. Phillips M.S. Science. 1992; 256: 789-794Crossref PubMed Scopus (417) Google Scholar). A mutation in the DHPR III–IV loop has also been linked to susceptibility to malignant hyperthermia (17Monnier N. Procaccio V. Stieglitz P. Lunardi J. Am. J. Hum. Genet. 1997; 60: 1316-1325Abstract Full Text PDF PubMed Scopus (356) Google Scholar). Thus, the DHPR III–IV loop may play a role in E-C coupling, and a mutation in this loop could modify the interaction between the dihydropyridine and ryanodine receptors, mimicking the effects of mutations of RyR1 previously found to be causal for malignant hyperthermia susceptibility. The studies in dysgenic mice (11Tanabe T. Beam K.G. Adams B.A. Niidome T. Numa S. Nature. 1990; 346: 567-569Crossref PubMed Scopus (492) Google Scholar) that identify the DHPR II–III loop as being critical for RyR1 activation neither rule out nor implicate the III–IV loop in E-C coupling. In this study, we used protein affinity chromatography to demonstrate that the DHPR III–IV loop can interact with RyR1. All chemicals were of molecular biology grade. Ni2+-NTA resin was purchased from QIAGEN Inc., and glutathione-Sepharose 4B and translational grade [35S]Met were from Amersham Pharmacia Biotech. The coupled in vitro transcription and translation kit (TNT Quick) was from Promega. Rabbit skeletal and cardiac muscle cDNAs were purified from λ phage cDNA libraries (18Zorzato F. Fujii J. Otsu K. Phillips M. Green N.M. Lai F.A. Meissner G. MacLennan D.H. J. Biol. Chem. 1990; 265: 2244-2256Abstract Full Text PDF PubMed Google Scholar, 19Otsu K. Willard H.F. Khanna V.K. Zorzato F. Green N.M. MacLennan D.H. J. Biol. Chem. 1990; 265: 13472-13483Abstract Full Text PDF PubMed Google Scholar) using mediprep columns from QIAGEN Inc. The rat N-type Ca2+ channel α1B-subunit III–IV loop in pTrcHis-C (Invitrogen) was a gift from Dr. W. A. Catterall (University of Washington). The full-length ryanodine receptor cDNA clone (pBS-SRR10) has been described previously (20Chen S.R. Vaughan D.M. Airey J.A. Coronado R. MacLennan D.H. Biochemistry. 1993; 32: 3743-3753Crossref PubMed Scopus (49) Google Scholar). Nucleotides 1990–2381, encoding the rabbit skeletal muscle DHPR II–III loop, were amplified and cloned using the polymerase chain reaction (PCR) as described previously (15Leong P. MacLennan D.H. J. Biol. Chem. 1998; 273: 7791-7794Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Nucleotides 3198–3351, encoding Val1066–Ser1117 of the DHPR III–IV loop, were amplified using PCR, with the skeletal muscle cDNA library as template, and cloned; nucleotides 3492–3861 of the cardiac DHPR III–IV loop (Pro1164–Leu1287) were amplified, with the cardiac cDNA library as template, and cloned. Oligonucleotide primers flanking the cDNA sequence for the respective loops were designed with exterior BamHI and EcoRI restriction endonuclease sites for in-frame cloning into the pTrcHis-C vector or the pGEX3X vector (Amersham Pharmacia Biotech). Flanking BamHI and EcoRI restriction endonuclease sites for in-frame cloning of the RYR1 sequence encoding amino acid residues 922–1112 into the pTrcHis-C vector were added to oligonucleotide primers used in PCR amplification of RyR1 nucleotides 2766–3335. All cloned fragments were verified by DNA sequence analysis. The modified pGEX vector, which encodes glutathioneS-transferase (GST) with 10 His residues added to its C-terminal end, has been described (15Leong P. MacLennan D.H. J. Biol. Chem. 1998; 273: 7791-7794Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). The oligonucleotide attgaattccaccaccaccaccaccaccaccaccaccacaagcttgaattcata and its complementary oligonucleotide were used to add 10 His residues to the C-terminal end of the DHPR II–III loop in the GST-DHPR II–III fusion protein by self-annealing of the two oligonucleotides, endonuclease restriction digestion at the EcoRI sites flanking the His10 sequence, and ligation into the EcoRI site of pGEX3X-DHPR II–III. Escherichia coli strain DH5α (Life Technologies, Inc.) was used for the expression of all fusion proteins. His-peptide (Invitrogen) fusion proteins, in 20 mm imidazole (pH 7.0) and protease inhibitors, were purified with Ni2+-NTA resin, and GST fusion proteins were purified with glutathione-Sepharose 4B following standard procedures (21Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology.in: Chanda V.B. John Wiley & Sons, Inc., New York1997Google Scholar). After washing, the His-peptide fusion proteins were eluted with 0.5 m imidazole (pH 7.0) in phosphate-buffered saline. GST fusion proteins were eluted with 10 mm reduced glutathione and dialyzed against phosphate-buffered saline overnight. Eluted proteins were analyzed by SDS-PAGE and Coomassie Blue staining and by dynamic light scattering (DynaPro-807, ProteinSolutions, Inc). Data analysis was performed with Dynamics (ProteinSolutions, Inc.). Protein yield was determined by the Bradford assay (Bio-Rad). GST-His10-DHPR II–III was purified by binding to 200 μl of Ni2+-NTA resin. GST was cleaved from GST-His10-DHPR II–III by overnight incubation in the presence of 10 μg of Factor Xa (Sigma) His10-DHPR II–III was then eluted from Ni2+-NTA by 0.5 m imidazole in phosphate-buffered saline. His10-DHPR II–III, which had not been cleaved from GST, was then removed by incubation with glutathione-Sepharose. Fragments F1–F10 (see Fig. 1 A) for in vitro transcription and translation were prepared from pBS-SRR10 (20Chen S.R. Vaughan D.M. Airey J.A. Coronado R. MacLennan D.H. Biochemistry. 1993; 32: 3743-3753Crossref PubMed Scopus (49) Google Scholar) downstream of a Kozak consensus start sequence (22Kozak M. Shatkin A.J. Methods Enzymol. 1979; 60: 360-375Crossref PubMed Scopus (16) Google Scholar) and an ATG for translation initiation (15Leong P. MacLennan D.H. J. Biol. Chem. 1998; 273: 7791-7794Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). pBS-RYR1 F3a, containing RyR1 nucleotides 2766–3335, and pBS-RYR2 F3a, containing RyR1 nucleotides 2797–3378, were amplified by PCR from RYRcDNA. Chimeras between RyR1 and RyR2 were made using pBS-RYR1 F3a and pBS-RYR2 F3a through the introduction of restriction endonuclease sites by PCR-based mutagenesis (QuikChange kit, Stratagene) (see Fig. 2 A) as described previously (15Leong P. MacLennan D.H. J. Biol. Chem. 1998; 273: 7791-7794Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). The chimeric constructs are as follows with all numbering based on RYR1, notRYR2: pBS-RYR1-(923–1075)/RYR2-(1076–1112), pBS-RYR2-(923–1075)/RYR1-(1076–1112), and pBS-RYR2-(922–953)/RYR1-(954–1112). [35S]Methionine-labeled RyR1 fragments were synthesized by coupled in vitro transcription and translation (TNT Quick) and quantified by trichloroacetic acid precipitation and scintillation counting (21Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology.in: Chanda V.B. John Wiley & Sons, Inc., New York1997Google Scholar).Figure 2Binding of chimeric RyR1/RyR2 constructs to the skeletal DHPR III–IV loop. A, chimeric RyR1/RyR2 constructs prepared as described previously (15Leong P. MacLennan D.H. J. Biol. Chem. 1998; 273: 7791-7794Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). The first line represents a region in RyR1 containing two repeat sequences and defines their respective boundaries. Amino acid numbering refers to RyR1 residues in the chimeric constructs. B, autoradiogram of in vitro translated chimeric RyR1/RyR2 fragments representing 5% of input and 20% of fragments eluted from 0.5-mg/ml GST-His10 (G) and skeletal DHPR III–IV loop (D) affinity columns. C, percent specific binding of in vitro translated chimeric RyR1/RyR2 fragments to the skeletal DHPR loop affinity columns, quantified by densitometry and expressed as the mean ± S.E. from at least four separate experiments. Specific binding was defined as total binding to His-peptide-DHPR III–IV fusion protein columns less nonspecific binding to GST-His10.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The binding assay was unchanged from that of Leong and MacLennan (15Leong P. MacLennan D.H. J. Biol. Chem. 1998; 273: 7791-7794Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Briefly, purified His-peptide fusion protein, GST fusion protein, or GST-His10 was bound to 40 μl of fresh Ni2+-NTA or glutathione-Sepharose to achieve the desired concentration of fusion protein (milligrams/ml of Sepharose). The amount of protein bound to affinity matrices was confirmed by eluting a sample of the protein-bound affinity matrix with SDS, separating the eluted protein by SDS-PAGE, and staining with Coomassie Blue. Each stained fusion protein band was quantified by densitometry (Molecular Analyst, Bio-Rad). Resins to which fusion proteins were bound were washed with 1 ml of phosphate-buffered saline and blocked with 1 mg of BSA in 200 μl of column buffer (10 mm Tris-HCl (pH 7.5), 0.15 m KCl, 20 μm CaCl2, 0.25 mmMgCl2, 20 mm imidazole, and 0.1% Tween 20) and then with 0.4 mg of BSA in 400 μl of column buffer. [35S]Methionine-labeled fragments of RyR, synthesized by coupled in vitro transcription and translation (TNT Quick), were diluted 10-fold into 200 μl of column buffer and then passed three times through affinity columns by gravity flow. The columns were washed with 600 μl of column buffer. Proteins retained on the affinity columns were eluted with 100 μl of SDS sample buffer. SDS-PAGE (15% gel) was used to analyze 1 μl of the in vitro translation product (5% of the total column input) and 20 μl of the eluate (20% of the total column eluate). The gels were fixed three times in 6 volumes of 10% methanol and 12% acetic acid for 20 min each time. The radioactive signal was enhanced with Entensify (NEN Life Science Products), and the gels were dried and exposed to autoradiogram film (BioMax AR, Eastman Kodak Co.). Radioactive signals of bands corresponding to the expected molecular mass of the RyR1 fragments were quantified by a Molecular Imager (Bio-Rad). Specific binding was defined as total binding less nonspecific binding to GST-His10 or GST columns. Glutathione-Sepharose or Ni2+-NTA resin (40 μl) was blocked with 1 mg of BSA in 200 μl of column buffer and then with 0.4 mg of BSA in 400 μl of column buffer. Purified GST-DHPR II–III or His-peptide-DHPR III–IV fragments at a concentration of 0.05–20 μm in 200 μl of column buffer were mixed for 1 h with 20 μl of [35S]methionine-labeled, coupledin vitro transcribed and translated RyR1 fragments and then passed once through the 40-μl blocked glutathione-Sepharose or Ni2+-NTA column. The columns were washed with 600 μl of column buffer. RyR1 fragment-DHPR loop complexes retained on the resin were eluted with 100 μl of SDS sample buffer and analyzed by SDS-PAGE, and the 35S-labeled RyR1 fragments were quantified using a Molecular Imager as described above. The concentration of DHPR loop fusion protein required for half-maximal saturation of co-purification of RyR1 fragments was estimated using curve-fitting software (CA Cricket GraphIII). GST-DHPR II–III and GST-DHPR III–IV affinity columns were prepared as described under "Column Binding Assay" and blocked with 1 mg of BSA in 200 μl of column buffer and then with 0.4 mg of BSA in 400 μl of column buffer. The [35S]methionine-labeled RyR1 F3a fragment (20 μl) was mixed for 1 h with 0.05–10 μm purified His10-DHPR II–III or 0.05–25 μmHis-peptide-DHPR III–IV in 200 μl of column buffer and then passed three times through 40 μl of GST-DHPR II–III and GST-DHPR III–IV affinity columns. The columns were washed with 600 μl of column buffer. 35S-Labeled RyR1 F3a-DHPR loop fusion protein retained on the resin were eluted with 100 μl of SDS sample buffer and analyzed by SDS-PAGE, and the 35S-labeled RyR1 F3a fragment was quantified using a Molecular Imager as described under "Column Binding Assay." The concentration of DHPR loop required for half-maximal inhibition of RyR1 fragment binding was estimated using curve-fitting software (CA Cricket GraphIII). We scanned 35S-labeled, in vitro translated RyR1 fragments for interactions with the DHPR III–IV loop immobilized on a Ni2+ column as a His-peptide fusion protein (Fig. 1). We found that 18 ± 4.3% of in vitro translated fragment F3 (amino acids 922–1220) was retained on the DHPR III–IV loop affinity column (Fig. 1, B and C). When the RyR1 fragment was reduced in size to 191 amino acids, spanning residues 922–1112, the proportion of the in vitro translated fragment retained on DHPR III–IV loop columns remained high at 13 ± 1.3% (Fig. 2). We observed that the nonspecific binding to GST-His10 of35S-labeled RyR1 F5, F8, and F9 fragments was >15% of column input compared with <5% for the other RyR1 fragments (Fig. 1 B). This raised the possibility that some in vitro transcribed/translated fragments may form nonspecific aggregates with the affinity matrix and/or other proteins. To determine whether DHPR II–III loop, DHPR III–IV loop, or RyR1-(922–1112) fusion proteins form aggregates, we analyzed their dynamic light scattering characteristics. Assuming the proteins to be globular in nature, software-based conversion of hydrodynamic radii measurements to molecular mass (Dynamics) showed that 99% of the fusion proteins did not form high molecular mass aggregates. GST-DHPR II–III was estimated to be 94.8 kDa, which corresponds to the predicted molecular mass of a dimer of two 49.5-kDa GST-DHPR II–III fusion proteins, and similarly, GST-DHPR III–IV was estimated to be 65.2 kDa, which corresponds to the predicted molecular mass of a dimer of two 33.1-kDa GST-DHPR III–IV fusion proteins. GST fusion proteins are known to dimerize in solution (23Walker J. Crowley P. Moreman A.D. Barrett J. Mol. Biochem. Parasitol. 1993; 61: 255-264Crossref PubMed Scopus (112) Google Scholar). Therefore, dimerization of the DHPR II–III and III–IV loop fusion proteins was expected. His-peptide-RyR1-(922–1112) was estimated to be 26.9 kDa, which corresponds to its predicted molecular mass of 24.5 kDa. In addition, no high molecular mass aggregates were observed when GST-DHPR II–III and His-peptide-RyR1-(922–1112) or GST-DHPR III–IV and His-peptide RyR1-(922–1112) were mixed together in a 1:1 ratio. To test the isoform specificity of the RyR1 interaction with DHPR, we passed 35S-labeled, in vitro translated fragments of RyR2 over the affinity column. We did not detect specific binding of RyR2-(933–1126) (corresponding to RyR1-(922–1112)) to the skeletal DHPR III–IV loop affinity column (Fig. 2). Because further reduction in the size of the RyR1 fragment resulted in loss of synthesis of the in vitro translated product, we reduced the size of the RyR1 sequence that binds to the DHPR III–IV loop by making chimeras between RyR1 and RyR2, as illustrated in Fig. 2 A. The RyR1-(922–1075)/RyR2-(1076–1112) (C1) chimera did not bind to the III–IV loop, but 13 ± 1.7% of the RyR2-(922–953)/RyR1-(954–1112) (C3) chimera and 6 ± 1.1% of the RyR2-(922–1075)/RyR1-(1076–1112) (C2) chimera were retained on a 0.5-mg/ml DHPR III–IV loop affinity column (Fig. 2, B and C). These results indicate that the 37 RyR1 amino acids Arg1076–Asp1112, previously shown to interact with the DHPR II–III loop (15Leong P. MacLennan D.H. J. Biol. Chem. 1998; 273: 7791-7794Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar), do not by themselves form the binding site for both the DHPR II–III and III–IV loops, but do not rule out the possibility that they might contribute to the binding site for the DHPR III–IV loop. Clearly, RyR1 residues between Lys954and Val1075 contribute to the binding site for the DHPR III–IV loop. Greater than 6% of two adjacent RyR1 fragments, 1220–1614 (F4) and 1614–1861 (F5), was also retained on the His-peptide-DHPR III–IV column compared with <2% for any of the other fragments of RyR1 lying between amino acids 1 and 3724 (Fig. 1). A complementary test of protein/protein interactions is to mix two potentially interacting proteins in solution and to then purify complexes containing the two proteins. We found that 16 ± 2.6% of 35S-labeled RyR1-(922–1112) co-purified with His-peptide-DHPR III–IV loops on Ni2+-NTA, whereas <2% of 35S-labeled RyR1 F4 and <5% of 35S-labeled RyR1 F5 co-purified under similar conditions (Fig. 3). We also observed that 54 ± 1.0% of 35S-labeled RyR1-(922–1112) co-purified with GST-DHPR II–III-His10 on Ni2+-NTA, but <5% of 35S-labeled RyR1 F4 and35S-labeled RyR1 F5 co-purified with GST-DHPR II–III-His10. We mixed 35S-labeled RyR1-(922–1112) with the DHPR II–III and III–IV loops to determine the concentration of DHPR loops in solution required for half-maximal co-purification of picomolar concentrations of 35S-labeled, in vitrotranscribed/translated RyR1-(922–1112) (Fig. 4). Half-maximal purification of RyR1-(922–1112)·GST-DHPR II–III complexes on glutathione-Sepharose was at 4 ± 0.4 μm GST-DHPR II–III fusion protein. Half-maximal purification of RyR1-(922–1112)·His-peptide-DHPR III–IV complexes on Ni2+-NTA was at 5 ± 0.1 μm His-peptide-DHPR III–IV fusion protein.35S-Labeled RyR1-(922–1112) that did not associate with DHPR loops was found in the flow-through fraction (data not shown). Given the low affinity, it was not possible to use dynamic light scattering to detect complexes forming between His-peptide-RyR1-(922–1112) and GST-DHPR loop fusion proteins in a 1:1 mixture of the two proteins. Binding of picomolar concentrations of35S-labeled RyR1 to a GST-DHPR II–III affinity column was inhibited in a dose-dependent manner by both His10-DHPR II–III and His-peptide-DHPR III–IV at a concentration of 0.05–25 μm (Fig. 5 A). Similarly, binding of35S-labeled RyR1 to a GST-DHPR III–IV affinity column was inhibited in a dose-dependent manner by 0.05–25 μm His10-DHPR II–III or His-peptide-DHPR III–IV (Fig. 5 B). The concentration of His10-DHPR II–III required to inhibit binding of RyR1-(922–1112) to GST-DHPR II–III and GST-DHPR III–IV was comparable (Fig. 5 C), as was the concentration of His-peptide-DHPR III–IV required to inhibit binding to GST-DHPR II–III and GST-DHPR III–IV (Fig. 5 D). A GST fusion protein affinity column of the skeletal muscle DHPR III–IV loop (skDHPR) retained 13 ± 1.1% of the input of thein vitro translated RyR1 fragment; the corresponding cardiac muscle DHPR III–IV loop (cdDHPR) retained 13 ± 0.2%; and the N-type Ca2+ channel III–IV loop (NCa) retained 5 ± 1.4% (Fig. 6,A and B). Skeletal and cardiac muscle DHPR III–IV loops are identical in 46 of 54 amino acids. The fact that only 24 of 54 amino acids are identical between the N-type Ca2+channel III–IV loop and the skeletal DHPR III–IV loop is consistent with the reduced binding of RyR1-(922–1112) to N-type Ca2+channel III–IV loop-GST. In this study, we localized a binding site for the skeletal muscle DHPR III–IV loop to F3-(922–1112), a 191-amino acid sequence between Leu922 and Asp1112 in in vitrotranscribed and translated fragments of RyR1 (Figs. 1 and 2). About 13% of this fragment applied to a DHPR III–IV loop affinity column was bound specifically. We also noted binding of ∼6–7% of fragments F4 and F5 to the same column. If complexes between the DHPR II–III or III–IV loop and radioactive fragment F3-(922–1112), F4, or F5 were made in solution and then passed over columns that would bind the DHPR loops, co-purification of F3 was observed for both the II–III and III–IV loops (Fig. 3), but very little co-purification of F4 or F5 was observed under comparable conditions. Thus, RyR1 fragments F4 and F5 may have been retained on His-peptide-DHPR III–IV columns due to nonspecific interactions with high matrix concentrations of His-peptide-DHPR III–IV (Fig. 3). RyR1 F5 was observed to interact with proteins unrelated to DHPR, including GST, supporting the view that RyR1 F5 can interact nonspecifically with proteins. The interaction between F3-(922–1112) and DHPR loops is not due to the formation of large aggregates since analysis of dynamic light scattering determined that high molecular mass aggregates made up <1% by mass of His-peptide-RyR1-(922–1112), GST-DHPR II–III, and GST-DHPR III–IV fusion protein preparations, either alone or in combination with each other. Decreasing the size of the RyR1-(922–1112) fragment resulted in loss of in vitro translation, and His-peptide fusion proteins of RyR1 fragments shorter than 191 amino acids were unstable, suggesting that the complete sequence might form a stable structural domain. We made use of repeat domain boundaries in RyR (18Zorzato F. Fujii J. Otsu K. Phillips M. Green N.M. Lai F.A. Meissner G. MacLennan D.H. J. Biol. Chem. 1990; 265: 2244-2256Abstract Full Text PDF PubMed Google Scholar, 19Otsu K. Willard H.F. Khanna V.K. Zorzato F. Green N.M. MacLennan D.H. J. Biol. Chem. 1990; 265: 13472-13483Abstract Full Text PDF PubMed Google Scholar, 24Hakamata Y. Nakai J. Takeshima H. Imoto K. FEBS Lett. 1992; 312: 229-235Crossref PubMed Scopus (351) Google Scholar) to create three RyR1/RyR2 chimeras (Fig. 2 A). Chimera C2, which retained partial binding to the DHPR III–IV loop column, and chimera C3, which retained full binding, both contained the 37-amino acid sequence Arg1076–Asp1112, previously identified as being important for interaction with the DHPR II–III loop (15Leong P. MacLennan D.H. J. Biol. Chem. 1998; 273: 7791-7794Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). However, the sequence Arg1076–Asp1112 was absent from chimera C1, which did not bind the DHPR III–IV loop. The RyR1 repeat sequence 2, which is included in chimera C3, contributes to the DHPR III–IV loop interaction site and may form part of a structural domain and be important for proper folding. An estimate of the affinity for RyR1-(922–1112) of the DHPR II–III and III–IV loops can be derived from the concentration of DHPR loops required for half-maximal co-purification of picomolar35S-labeled RyR1-(922–1112) with GST-DHPR II–III on glutathione-Sepharose and with His-peptide-DHPR III–IV on Ni2+-NTA (Fig. 4). The concentration of the DHPR II–III loop required was 4 ± 0.4 μm, and the concentration of the DHPR III–IV loop was 5 ± 0.1 μm. Unfortunately, the affinity was not high enough to permit resolution of RyR1·DHPR complexes using dynamic light scattering. We attempted to verify that the RyR1 region that we identified as interacting with the DHPR II–III loop also constituted part of the interaction site of the DHPR III–IV loop (Fig. 2) through the use of a competition binding assay (Fig. 5). As expected, the complex between the DHPR II–III loop and RyR1-(922–1112) was inhibited from binding to a DHPR II–III loop affinity column, and the complex between the DHPR III–IV loop and RyR1-(922–1112) was inhibited from binding to the DHPR III–IV loop affinity column. We also observed the inhibition of binding of the complex between soluble His-peptide-DHPR III–IV and RyR1-(922–1112) to a GST-DHPR II–III affinity column, and the inhibition of binding of the complex between His10-DHPR II–III and RyR1-(922–1112) to a DHPR III–IV loop column. These results can be interpreted in two ways. One possibility is that the DHPR II–III loop binds to a site on RyR1-(922–1112) that overlaps with the binding site for the DHPR III–IV loop. Alternatively, the accessibility of a GST-DHPR loop on protein affinity columns to its binding site on RyR1 bound to a DHPR loop in solution may be restricted by the size of the fusion proteins already bound to RyR1-(922–1112). This is particularly relevant considering that the GST portion of the fusion contains ∼250 amino acids. The close relationship between the concentration of the DHPR II–III loop required for half-maximal inhibition of RyR1-(922–1112) binding to GST-DHPR II–III or GST-DHPR III–IV (Fig. 5 C) suggests that soluble complexes form in solution between the DHPR II–III loop and RyR1-(922–1112). These concentrations are equivalent to the 4 μm DHPR II–III loop required for half-maximal saturation of binding to RyR1 in the RyR1-(922–1112) co-purification studies (Fig. 4, A and B). The concentration of the DHPR III–IV loop required for half-maximal inhibition of RyR1-(922–1112) binding to GST-DHPR II–III and GST-DHPR III–IV affinity columns was also similar (Fig. 5 D). These concentrations are also equivalent to the 5 μm DHPR III–IV loop required for half-maximal saturation of formation of soluble complexes between the DHPR III–IV loop and RyR1-(922–1112) (Fig. 4, C and D). Since skeletal and cardiac DHPR III–IV loops are highly conserved, it was not surprising that RyR1-(922–1112) bound to GST fusion protein affinity columns made up from both the skeletal and cardiac DHPR III–IV loops (Fig. 6). The decrease in binding to a GST fusion protein of the loop linking domains III and IV of the rat N-type Ca2+ channel corresponds to the decrease in amino acid identity with the DHPR III–IV loop. Yamazawa et al. (25Yamazawa T. Takeshima H. Shimuta M. Iino M. J. Biol. Chem. 1997; 272: 8161-8164Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar) reported that deletion of RyR1-(1303–1406) abolishes the ability of RyR1 to mediate skeletal E-C coupling, although E-C coupling is preserved when the RyR1-(1303–1406) sequence is converted to the RyR2 sequence. The deletion of RyR1-(1303–1406) may alter the structure of RyR and thus disrupt interactions with DHPR. This is consistent with the finding that the conversion of the RyR1-(1303–1406) sequence to the corresponding RyR2 sequence does not disrupt E-C coupling since the homology between RyR1 and RyR2 is likely sufficient to preserve native RyR structure (25Yamazawa T. Takeshima H. Shimuta M. Iino M. J. Biol. Chem. 1997; 272: 8161-8164Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Nakai et al. (9Nakai J. Sekiguchi N. Rando T.A. Allen P.D. Beam K.G. J. Biol. Chem. 1998; 273: 13403-13406Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar) used chimeras between RyR1 and RyR2 to show that RyR1-(1635–2636) is sufficient for skeletal-typeversus cardiac muscle-type E-C coupling and that RyR1-(1635–2636) and RyR1-(2659–3720) are sufficient for enhancement of DHPR Ca2+ channel activity. It is possible that the sites defined in these studies of RyR1/RyR2 chimeras may reflect an interaction resulting from the folding of RyR that brings together amino acids that are very distant in the linear sequence. Thus, the comparatively short sequences that we used to test for interactions may not contain all of the amino acids required for a high affinity interaction site. The high levels of nonspecific binding of some RyR1 fragments to GST-His10, including RyR1 F4 and RyR1 F5, may mask weaker binding interactions with DHPR loops. The possibility that some RyR1 fragments may aggregate, thereby preventing their interaction with DHPR, may also mask weaker binding interactions. Monnier et al. (17Monnier N. Procaccio V. Stieglitz P. Lunardi J. Am. J. Hum. Genet. 1997; 60: 1316-1325Abstract Full Text PDF PubMed Scopus (356) Google Scholar) have demonstrated that an A1086H mutation in the loop linking DHPR domains III and IV in the α1-subunit of skeletal muscle DHPR can be linked to susceptibility to malignant hyperthermia. A mutation in DHPR that disrupts the termination of Ca2+ release through RyR1 upon repolarization (7Suda N. J. Physiol. (Lond.). 1995; 486: 105-112Crossref Scopus (11) Google Scholar, 26Melzer W. Rios E. Schneider M.F. Biophys. J. 1987; 51: 849-863Abstract Full Text PDF PubMed Scopus (101) Google Scholar, 27Schneider M.F. Simon B.J. J. Physiol. (Lond.). 1988; 405: 727-745Crossref Scopus (139) Google Scholar, 28Rios E. Pizarro G. Physiol. Rev. 1991; 71: 849-908Crossref PubMed Scopus (496) Google Scholar) might display the same clinical phenotype as a mutation in RyR1 that alters the regulation of Ca2+release (29Mickelson J.R. Louis C.F. Physiol. Rev. 1996; 76: 537-592Crossref PubMed Scopus (263) Google Scholar, 30Otsu K. Nishida K. Kimura Y. Kuzuya T. Hori M. Kamada T. Tada M. J. Biol. Chem. 1994; 269: 9413-9415Abstract Full Text PDF PubMed Google Scholar, 31Treves S. Larini F. Menegazzi P. Steinberg T.H. Koval M. Vilsen B. Andersen J.P. Zorzato F. Biochem. J. 1994; 301: 661-665Crossref PubMed Scopus (63) Google Scholar, 32Tong J. Oyamada H. Demaurex N. Grinstein S. McCarthy T.V. MacLennan D.H. J. Biol. Chem. 1997; 272: 26332-26339Abstract Full Text Full Text PDF PubMed Scopus (219) Google Scholar). The Ca2+ flux through wild-type DHPR is slow and of small magnitude (10Tanabe T. Beam K.G. Powell J.A. Numa S. Nature. 1988; 336: 134-139Crossref PubMed Scopus (582) Google Scholar), and the mutant is unlikely to be different. A mutation in the DHPR III–IV loop is unlikely to alter Ca2+ conductance since this loop does not form part of the channel pore and has not been identified as being important for either regulation or inactivation of DHPR (33Catterall W.A. J. Bioenerg. Biomembr. 1996; 28: 219-230Crossref PubMed Scopus (78) Google Scholar). The DHPR mutation does not lead to other symptoms of ion channel disease, suggesting that it does not affect L-type Ca2+ channel function (17Monnier N. Procaccio V. Stieglitz P. Lunardi J. Am. J. Hum. Genet. 1997; 60: 1316-1325Abstract Full Text PDF PubMed Scopus (356) Google Scholar). The chimera studies in dysgenic mice (11Tanabe T. Beam K.G. Adams B.A. Niidome T. Numa S. Nature. 1990; 346: 567-569Crossref PubMed Scopus (492) Google Scholar) identifying the II–III loop as being critical to E-C coupling were not used either to rule out or to implicate the III–IV loop in E-C coupling. Thus, we propose that a possible function arising from the interaction between RyR1-(954–1112) and the DHPR III–IV loop is to terminate Ca2+ release through RyR1 during repolarization. A C-terminal peptide from amino acids 1487 to 1506 of skeletal DHPR has been shown to inhibit the Ca2+ release function of RyR1 (34Slavik K.J. Wang J.P. Aghdasi B. Zhang J.Z. Mandel F. Malouf N. Hamilton S.L. Am. J. Physiol. 1997; 272: C1475-C1481Crossref PubMed Google Scholar), but the RyR1 interaction site is not known. It is possible that amino acids 1487–1506 in the C-terminal end of skeletal DHPR act in conjunction with amino acids in the DHPR III–IV loop. The region we have identified may be important in the DHPR interaction with RyR1 at the junction between T-tubules and the terminal cisternae of the sarcoplasmic reticulum. In skeletal muscle, but not cardiac muscle, DHPRs are clustered in groups of four and are positioned in exact correspondence with RyR1 tetramers so that each DHPR is located immediately opposite to one of the RyR1 subunits (35Block B.A. Imagawa T. Campbell K.P. Franzini-Armstrong C. J. Cell Biol. 1988; 107: 2587-2600Crossref PubMed Scopus (594) Google Scholar, 36Franzini-Armstrong C. Protasi F. Physiol. Rev. 1997; 77: 699-729Crossref PubMed Scopus (593) Google Scholar). Structural studies of mice with a targeted disruption of the skeletal muscleRYR1 gene have shown that the arrangement of DHPRs into groups of four is dependent on the presence of RyR1 (37Takekura H. Bennett L. Tanabe T. Beam K.G. Franzini-Armstrong C. Biophys. J. 1994; 67: 793-803Abstract Full Text PDF PubMed Scopus (86) Google Scholar). Thus, another possible function for the interaction between RyR1-(954–1112) and the DHPR III–IV loop that we have identified might be clustering of DHPRs into groups of four in skeletal muscle. The absence of interaction with DHPR that we observed with the RyR2 sequence corresponding to RyR1-(922–1112) would be in line with this proposal (Fig. 2). Alignment of inositol triphosphate and ryanodine receptor sequences reveals that the Ca2+ channel-forming domain and the domains that are important for regulation of channel opening are conserved between inositol triphosphate receptors and RyR. The region that we have identified as an interaction site between RyR1 and both the DHPR II–III and III–IV loops is not present on inositol triphosphate receptors (38Furuichi T. Yoshikawa S. Miyawaki A. Wada K. Maeda N. Mikoshiba K. Nature. 1989; 342: 32-38Crossref PubMed Scopus (825) Google Scholar, 39Loke J. MacLennan D.H. Am. J. Med. 1998; 104: 470-486Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar) and is therefore a domain unique to RyR that might be important for E-C coupling. Site-directed mutagenesis of residues between Leu954 and Asp1112 that differ between RyR1 and RyR2 is likely to yield information on the amino acids that constitute the interaction site between the two proteins. Generation of antibodies against these sequences or high resolution structural studies of RyR1·DHPR complexes should yield detailed information concerning these interactions. The introduction of RyR1/RyR2 chimeras into myoblasts lacking RyR1 will define the functional importance of the interaction of the DHPR II–III loop with RyR1-(1076–1112) and of the DHPR III–IV loop with RyR1-(954–1112). The introduction of RyR/inositol triphosphate receptor chimeras into myoblasts lacking RyR1 will allow characterization of a domain unique to RyR. We thank Dr. A. Edwards (University of Toronto) for advice concerning the assay of protein/protein interactions, B. Nagar for assistance with light scattering, and S. de Leon for expert technical assistance. We are grateful to Dr. W. A. Catterall for the gift of the N-type Ca2+ channel cDNA clone.

Referência(s)