Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Kinetic Analysis of Translesion Synthesis Opposite Bulky N2- and O6-Alkylguanine DNA Adducts by Human DNA Polymerase REV1

2008; Elsevier BV; Volume: 283; Issue: 35 Linguagem: Inglês

10.1074/jbc.m801686200

ISSN

1083-351X

Autores

Jeong‐Yun Choi, F. Peter Guengerich,

Tópico(s)

Carcinogens and Genotoxicity Assessment

Resumo

REV1, a Y family DNA polymerase (pol), is involved in replicative bypass past DNA lesions, so-called translesion DNA synthesis. In addition to a structural role as a scaffold protein, REV1 has been proposed to play a catalytic role as a dCTP transferase in translesion DNA synthesis past abasic and guanine lesions in eukaryotes. To better understand the catalytic function of REV1 in guanine lesion bypass, purified recombinant human REV1 was studied with two series of guanine lesions, N2-alkylG adducts (in oligonucleotides) ranging in size from methyl (Me) to CH2(6-benzo[a]pyrenyl) (BP) and O6-alkylG adducts ranging from Me to 4-oxo-4-(3-pyridyl)butyl (Pob). REV1 readily produced 1-base incorporation opposite G and all G adducts except for O6-PobG, which caused almost complete blockage. Steady-state kinetic parameters (kcat/Km) were similar for insertion of dCTP opposite G and N2-G adducts but were severely reduced opposite the O6-G adducts. REV1 showed apparent pre-steady-state burst kinetics for dCTP incorporation only opposite N2-BPG and little, if any, opposite G, N2-benzyl (Bz)G, or O6-BzG. The maximal polymerization rate (kpol 0.9 s–1) opposite N2-BPG was almost the same as opposite G, with only slightly decreased binding affinity to dCTP (2.5-fold). REV1 bound N2-BPG-adducted DNA 3-fold more tightly than unmodified G-containing DNA. These results and the lack of an elemental effect ((Sp)-2′-deoxycytidine 5′-O-(1-thiotriphosphate)) suggest that the late steps after product formation (possibly product release) become rate-limiting in catalysis opposite N2-BPG. We conclude that human REV1, apparently the slowest Y family polymerase, is kinetically highly tolerant to N2-adduct at G but not to O6-adducts. REV1, a Y family DNA polymerase (pol), is involved in replicative bypass past DNA lesions, so-called translesion DNA synthesis. In addition to a structural role as a scaffold protein, REV1 has been proposed to play a catalytic role as a dCTP transferase in translesion DNA synthesis past abasic and guanine lesions in eukaryotes. To better understand the catalytic function of REV1 in guanine lesion bypass, purified recombinant human REV1 was studied with two series of guanine lesions, N2-alkylG adducts (in oligonucleotides) ranging in size from methyl (Me) to CH2(6-benzo[a]pyrenyl) (BP) and O6-alkylG adducts ranging from Me to 4-oxo-4-(3-pyridyl)butyl (Pob). REV1 readily produced 1-base incorporation opposite G and all G adducts except for O6-PobG, which caused almost complete blockage. Steady-state kinetic parameters (kcat/Km) were similar for insertion of dCTP opposite G and N2-G adducts but were severely reduced opposite the O6-G adducts. REV1 showed apparent pre-steady-state burst kinetics for dCTP incorporation only opposite N2-BPG and little, if any, opposite G, N2-benzyl (Bz)G, or O6-BzG. The maximal polymerization rate (kpol 0.9 s–1) opposite N2-BPG was almost the same as opposite G, with only slightly decreased binding affinity to dCTP (2.5-fold). REV1 bound N2-BPG-adducted DNA 3-fold more tightly than unmodified G-containing DNA. These results and the lack of an elemental effect ((Sp)-2′-deoxycytidine 5′-O-(1-thiotriphosphate)) suggest that the late steps after product formation (possibly product release) become rate-limiting in catalysis opposite N2-BPG. We conclude that human REV1, apparently the slowest Y family polymerase, is kinetically highly tolerant to N2-adduct at G but not to O6-adducts. Cellular DNA is continuously attacked by various endogenous and exogenous agents. Although the resulting lesions can be removed by versatile cellular repair systems, many DNA lesions escape repair and are usually present in replicating DNA. Facing DNA lesions during DNA replication, DNA polymerases often show unusual behavior, such as misinsertion, slippage, and blockage, which can give rise to mutations or cell death (1Friedberg E.C. Walker G.C. Siede W. Wood R.D. Schultz R.A. Ellenberger T. DNA Repair And Mutagenesis. 2nd Ed. American Society for Microbiology Press, Washington, DC2006Google Scholar). Therefore, the characterization of interaction of DNA polymerases with DNA lesions is crucial for understanding the mechanism of mutagenesis in cells in detail (2Guengerich F.P. Chem. Rev. 2006; 106: 420-452Crossref PubMed Scopus (95) Google Scholar). Human cells possess at least 15 different DNA polymerases, the physiological functions of most of which are still unclear. Replicative DNA polymerases, such as pol 2The abbreviations used are:polDNA polymeraseIbisobutylBzbenzylN2-NaphN2-methyl(2-naphthyl)N2-AnthN2-methyl(9-anthracenyl)N2-BPN2-methyl(6-benzo[a]pyrenyl)Pob4-oxo-4-(3-pyridyl)butyldCTPαS2′-deoxycytidine 5′-O-(1-thiotriphosphate)T7–bacteriophage DNA polymerase T7, exonuclease-deficientTLStranslesion synthesis. α, δ, and ϵ, are intolerant of DNA distortions caused by many DNA lesions and thus are blocked (3Goodman M.F. Annu. Rev. Biochem. 2002; 71: 17-50Crossref PubMed Scopus (628) Google Scholar). As a tolerance mechanism to this replication blockade, cells utilize the specialized translesion synthesis (TLS) DNA polymerases, which have a spacious active site to replicate past replication fork-blocking lesions (4Prakash S. Johnson R.E. Prakash L. Annu. Rev. Biochem. 2005; 74: 317-353Crossref PubMed Scopus (834) Google Scholar). Many of human TLS DNA polymerases belong to the recently discovered Y family, including pol η, pol ι, pol κ, and REV1 (5Ohmori H. Friedberg E.C. Fuchs R.P. Goodman M.F. Hanaoka F. Hinkle D. Kunkel T.A. Lawrence C.W. Livneh Z. Nohmi T. Prakash L. Prakash S. Todo T. Walker G.C. Wang Z. Woodgate R. Mol. Cell. 2001; 8: 7-8Abstract Full Text Full Text PDF PubMed Scopus (740) Google Scholar). Y family members often have different properties of bypass ability and fidelity opposite various DNA lesions (4Prakash S. Johnson R.E. Prakash L. Annu. Rev. Biochem. 2005; 74: 317-353Crossref PubMed Scopus (834) Google Scholar). DNA polymerase isobutyl benzyl N2-methyl(2-naphthyl) N2-methyl(9-anthracenyl) N2-methyl(6-benzo[a]pyrenyl) 4-oxo-4-(3-pyridyl)butyl 2′-deoxycytidine 5′-O-(1-thiotriphosphate) bacteriophage DNA polymerase T7, exonuclease-deficient translesion synthesis. The N2 and O6 atoms at G are highly susceptible to modification by various potential carcinogens. The N2 atom of G is easily modified by formaldehyde (6Yasui M. Matsui S. Ihara M. Laxmi Y.R. Shibutani S. Matsuda T. Nucleic Acids Res. 2001; 29: 1994-2001Crossref PubMed Google Scholar), acetaldehyde (7Terashima I. Matsuda T. Fang T.W. Suzuki N. Kobayashi J. Kohda K. Shibutani S. Biochemistry. 2001; 40: 4106-4114Crossref PubMed Scopus (48) Google Scholar), and the oxidation products of heterocyclic amines (e.g. 2-amino-3-methylimidazo[4,5-f]quinoline (8Turesky R.J. Markovic J. Chem. Res. Toxicol. 1994; 7: 752-761Crossref PubMed Scopus (54) Google Scholar)) and polycyclic aromatic hydrocarbons (e.g. benzo[a]pyrene (9Meehan T. Straub K. Nature. 1979; 277: 410-412Crossref PubMed Scopus (268) Google Scholar)), forming various N2-G derivatives, such as Me, Et, 2-amino-3-methylimidazo[4,5-f]quinoline, and benzo[a]pyrene diol epoxide adducts. In a different way, the O6 atom of G is readily modified by DNA-alkylating agents (10Goth R. Rajewsky M.F. Proc. Natl. Acad. Sci. U. S. A. 1974; 71: 639-643Crossref PubMed Scopus (528) Google Scholar, 11Loveless A. Nature. 1969; 223: 206-207Crossref PubMed Scopus (900) Google Scholar) and metabolites of tobacco-specific carcinogen 4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanone (12Wang L. Spratt T.E. Liu X.K. Hecht S.S. Pegg A.E. Peterson L.A. Chem. Res. Toxicol. 1997; 10: 562-567Crossref PubMed Scopus (102) Google Scholar), forming various O6-G adducts, such as Me, Et, and 4-oxo-4-(3-pyridyl)butyl (Pob) adducts. Relatively large G adducts, such as N2-benzo[a]pyrene diol epoxide-G (13Moriya M. Spiegel S. Fernandes A. Amin S. Liu T. Geacintov N. Grollman A.P. Biochemistry. 1996; 35: 16646-16651Crossref PubMed Scopus (123) Google Scholar) and O6-PobG (14Pauly G.T. Peterson L.A. Moschel R.C. Chem. Res. Toxicol. 2002; 15: 165-169Crossref PubMed Scopus (65) Google Scholar) produce mutations in bacterial and mammalian cells. Even small G adducts, such as N2-EtG and O6-EtG, also produce some mutations in bacterial and human cells (15Upton D.C. Wang X. Blans P. Perrino F.W. Fishbein J.C. Akman S.A. Mutat. Res. 2006; 599: 1-10Crossref PubMed Scopus (14) Google Scholar, 16Upton D.C. Wang X. Blans P. Perrino F.W. Fishbein J.C. Akman S.A. Chem. Res. Toxicol. 2006; 19: 960-967Crossref PubMed Scopus (31) Google Scholar) but with varied spectra and frequencies. These diverse mutagenicities of G lesions may be attributable to the differences in translesion DNA synthesis for each. To better understand TLS processes at N2- and O6-G lesions and the mechanisms of mutagenesis, we have previously addressed the details of lesion bypass across various N2-G and O6-G adducts by DNA polymerases, including replicative polymerases, such as human immunodeficiency virus type 1 reverse transcriptase, pol T7– (17Choi J.-Y. Guengerich F.P. J. Biol. Chem. 2004; 279: 19217-19229Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 18Woodside A.M. Guengerich F.P. Biochemistry. 2002; 41: 1027-1038Crossref PubMed Scopus (50) Google Scholar, 19Woodside A.M. Guengerich F.P. Biochemistry. 2002; 41: 1039-1050Crossref PubMed Scopus (44) Google Scholar), and human pol δ and TLS polymerases, such as human pol η, ι, and κ (20Choi J.-Y. Angel K.C. Guengerich F.P. J. Biol. Chem. 2006; 281: 21062-21072Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar, 21Choi J.-Y. Guengerich F.P. J. Biol. Chem. 2006; 281: 12315-12324Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 22Choi J.-Y. Guengerich F.P. J. Mol. Biol. 2005; 352: 72-90Crossref PubMed Scopus (82) Google Scholar, 23Choi J.-Y. Chowdhury G. Zang H. Angel K.C. Vu C.C. Peterson L.A. Guengerich F.P. J. Biol. Chem. 2006; 281: 38244-38256Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 24Choi J.-Y. Stover J.S. Angel K.C. Chowdhury G. Rizzo C.J. Guengerich F.P. J. Biol. Chem. 2006; 281: 25297-25306Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 25Choi J.-Y. Zang H. Angel K.C. Kozekov I.D. Goodenough A.K. Rizzo C.J. Guengerich F.P. Chem. Res. Toxicol. 2006; 19: 879-886Crossref PubMed Scopus (52) Google Scholar). REV1, a Y family polymerase, is believed to play both structural and catalytic roles in TLS in eukaryotes. REV1 has been suggested to serve as a scaffold protein for the recruitment of polymerases by the ability of interactions with proteins PCNA (26Guo C. Sonoda E. Tang T.S. Parker J.L. Bielen A.B. Takeda S. Ulrich H.D. Friedberg E.C. Mol. Cell. 2006; 23: 265-271Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar), ubiquitinated proteins (27Guo C. Tang T.S. Bienko M. Parker J.L. Bielen A.B. Sonoda E. Takeda S. Ulrich H.D. Dikic I. Friedberg E.C. Mol. Cell Biol. 2006; 26: 8892-8900Crossref PubMed Scopus (169) Google Scholar), and polymerases η, ι, κ, and ζ (28Guo C. Fischhaber P.L. Luk-Paszyc M.J. Masuda Y. Zhou J. Kamiya K. Kisker C. Friedberg E.C. EMBO J. 2003; 22: 6621-6630Crossref PubMed Scopus (302) Google Scholar). In its catalytic role as a polymerase, REV1 can catalyze the preferential insertion of dCTP opposite template G, apurinic/apyrimidinic sites, and the various damaged bases (29Nelson J.R. Lawrence C.W. Hinkle D.C. Nature. 1996; 382: 729-731Crossref PubMed Scopus (507) Google Scholar, 30Zhang Y. Wu X. Rechkoblit O. Geacintov N.E. Taylor J.S. Wang Z. Nucleic Acids Res. 2002; 30: 1630-1638Crossref PubMed Scopus (116) Google Scholar, 31Guo D. Xie Z. Shen H. Zhao B. Wang Z. Nucleic Acids Res. 2004; 32: 1122-1130Crossref PubMed Scopus (26) Google Scholar, 32Haracska L. Prakash S. Prakash L. J. Biol. Chem. 2002; 277: 15546-15551Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 33Lin W. Xin H. Zhang Y. Wu X. Yuan F. Wang Z. Nucleic Acids Res. 1999; 27: 4468-4475Crossref PubMed Scopus (164) Google Scholar) by utilizing a unique mechanism of protein-template-directed nucleotide incorporation (34Nair D.T. Johnson R.E. Prakash L. Prakash S. Aggarwal A.K. Science. 2005; 309: 2219-2222Crossref PubMed Scopus (201) Google Scholar), but the enzymatic role of REV1 in TLS still remains to be elucidated. With a unique ability for selective dCTP insertion, REV1 inherently has the potential to play a role in error-free bypass opposite guanine DNA lesions. Although the suggestion has been advanced that REV1 can incorporate dCTP opposite some minor groove guanine adducts and facilitate the lesion bypass (35Washington M.T. Minko I.G. Johnson R.E. Haracska L. Harris T.M. Lloyd R.S. Prakash S. Prakash L. Mol. Cell Biol. 2004; 24: 6900-6906Crossref PubMed Scopus (89) Google Scholar), quantitative evidence to support this suggestion is still limited. In order to obtain a better understanding of the catalytic role of human REV1 in bypass of guanine lesions, we performed steady-state and pre-steady-state kinetic studies with this enzyme and site-specifically modified oligonucleotides containing various N2-G and O6-G adducts. The results obtained with REV1 can also be compared with the corresponding studies done with three other human Y family polymerases, pol η (22Choi J.-Y. Guengerich F.P. J. Mol. Biol. 2005; 352: 72-90Crossref PubMed Scopus (82) Google Scholar), pol ι (21Choi J.-Y. Guengerich F.P. J. Biol. Chem. 2006; 281: 12315-12324Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar), and pol κ (20Choi J.-Y. Angel K.C. Guengerich F.P. J. Biol. Chem. 2006; 281: 21062-21072Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar). Our results indicate that REV1 catalysis is remarkably resistant to the large lesions at guanine N2, very similar to pol κ, but not at guanine O6. This study also provides detailed kinetic information on human REV1, which is quite different from other human Y family polymerases. Materials—Unlabeled dNTPs, T4 polynucleotide kinase, and restriction endonucleases were purchased from New England Biolabs (Ipswich, MA). (Sp)-dCTPαS was purchased from Biolog Life Science Institute (Bremen, Germany). [γ-32P]ATP (specific activity 3,000 Ci/mmol) was purchased from PerkinElmer Life Sciences. Bio-spin columns were purchased from Bio-Rad. A protease inhibitor mixture was obtained from Roche Applied Science. Human testis cDNA was purchased from BD Biosciences Clontech. Pfu Ultra DNA polymerase and pPCR-Script Amp vector were purchased from Stratagene (La Jolla, CA). Amicon Ultra centrifugal filter devices were purchased from Millipore (Billerica, MA). Oligonucleotides—Unmodified 24- and 36-mer (Table 1) were purchased from Midland Certified Reagent Co. (Midland, TX). Eleven 36-mers, each containing a guanine N2- or O6-adduct (N2-MeG, N2-EtG, N2,N2-diMeG, N2-IbG, N2-BzG, N2-NaphG, N2-AnthG, N2-BPG, O6-MeG, O6-BzG, and O6-PobG) were prepared as previously described (17Choi J.-Y. Guengerich F.P. J. Biol. Chem. 2004; 279: 19217-19229Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 21Choi J.-Y. Guengerich F.P. J. Biol. Chem. 2006; 281: 12315-12324Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 22Choi J.-Y. Guengerich F.P. J. Mol. Biol. 2005; 352: 72-90Crossref PubMed Scopus (82) Google Scholar, 23Choi J.-Y. Chowdhury G. Zang H. Angel K.C. Vu C.C. Peterson L.A. Guengerich F.P. J. Biol. Chem. 2006; 281: 38244-38256Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). The extinction coefficients for the oligonucleotides, estimated by the Borer method (36Borer P.N. Fasman G.D. Handbook of Biochemistry and Molecular Biology. 3rd Ed. CRC Press, Inc., Cleveland, OH1975: 589-590Google Scholar), were as follows: 24-mer, ϵ260 = 224 mm–1 cm–1; 36-mer, ϵ260 = 310 mm–1 cm–1TABLE 1Oligodeoxynucleotides used in this studyOligodeoxynucleotideSequence24-mer5′GCCTCGAGCCAGCCGCAGACGCAG25-mer5′GCCTCGAGCCAGCCGCAGACGCAGC36-meraG* = G, N2-MeG, N2-EtG, N2-IbG, N2-BzG, N2-NaphG, N2-AnthG, N2-BPG, N2,N2-diMeG, O6-MeG, O6-BzG, or O6-PobG.3′CGGAGCTCGGTCGGCGTCTGCGTCG*CTC CTGCGGCTa G* = G, N2-MeG, N2-EtG, N2-IbG, N2-BzG, N2-NaphG, N2-AnthG, N2-BPG, N2,N2-diMeG, O6-MeG, O6-BzG, or O6-PobG. Open table in a new tab Isolation of Human REV1 cDNA and Construction of Escherichia coli Expression Vector—The human REV1 cDNA was obtained as two overlapping cDNA fragments by PCR amplifications (the 2.2-kb coding region from the 5′-end and the 1.8-kb coding region from the 3′-end) from human testis cDNAs (as template) using Pfu Ultra DNA polymerase with the two sets of corresponding primers (5′-CATATGCATCACCATCACCATCACATGAGGCGAGGTGGATGG-3′ and 5′-CTTCTGCCTCTTTTGGCTGAGT-3′ for the 5′-end coding region of REV1; 5′-TTGTGGAGACTTGCAGTA-3′ and 5′-CTCGAGTTATGTAACTTTTAATGTGC-3′ for the 3′-end coding region of REV1). The resulting 2.2- and 1.8-kb PCR products of REV1 were cloned into the vector pPCR-Script Amp, respectively, and nucleotide sequencing was used to confirm the sequence of the coding region. The full-length human REV1 cDNA was constructed by ligating a 2.1-kb SmaI/BstBI fragment containing the 5′-fragment of hREV1 into the SmaI/BstBI sites of the 4.6-kb pPCR-Script Amp vector containing 3′-fragment of hREV1. The 3.8-kb human REV1 cDNA fragment was then cloned into the NdeI and XhoI sites of the vector pET-22b(+), generating pET22b(+)/hREV1-NHis6 vector. Expression and Purification of Human REV1—Recombinant human REV1, fused to an N-terminal His6 tag, was expressed in E. coli strain BL21(DE3). E. coli BL21(DE3) harboring the vector (24 liters) was grown in Luria-Bertani broth supplemented with ampicillin (100 μgml–1) at 25 °C, with aeration, to A600 0.6. Isopropyl-β-d-thiogalactopyranoside was added to 0.2 mm, and the incubation was continued for 11 h at 15 °C. The cells were harvested by centrifugation and resuspended in 60 ml of lysis buffer (50 mm Tris-HCl, pH 7.4, containing 300 mm NaCl, 10% glycerol (v/v), 5 mm β-mercaptoethanol, 1 mg/ml lysozyme, and protease inhibitor mixture (Roche Applied Sciences), cooled on ice for 30 min, and then lysed by sonication (12 × 10 s duration with a Branson digital sonifier (VWR, West Chester, PA), microtip, 45% amplitude, with intervening cooling time). The cell lysate was clarified by centrifugation at 4 × 104 × g for 60 min at 4 °C. The resulting supernatant was loaded (0.3 ml min–1) onto a 5-ml size FPLC HisTrap HP column (Amersham Biosciences) at 4 °C. The column was washed (at 0.8 ml min–1) with 50 ml of Buffer A (50 mm Tris-HCl, pH 7.5, with 500 mm NaCl, 10% glycerol (v/v), and 5 mm 2-mercaptoethanol) containing 20 mm imidazole, 50 ml of Buffer A containing 40 mm imidazole, and then with 50 ml of Buffer A containing 50 mm imidazole. Bound His6-tagged REV1 was eluted with 400 mm imidazole in Buffer B. Fractions containing REV1 were collected and diluted 2-fold with Buffer B (50 mm Tris-HCl (pH 7.5) containing 10% glycerol (v/v), 5 mm 2-mercaptoethanol, and 1 mm EDTA) and loaded onto a Mono Q column (Amersham Biosciences Bioscience). REV1 was eluted with a 50-ml linear gradient of 250 mm to 1 m NaCl in Buffer B. Eluted fractions (0.26 ml) were analyzed by SDS-polyacrylamide gel electrophoresis, and REV1 was found to be eluted at 320 mm NaCl. Fractions containing REV1 were collected and loaded onto a HiTrap Heparin HP column (Amersham Biosciences Bioscience). REV1 was eluted with a 50-ml linear gradient of 400 mm to 1 m NaCl in Buffer B. Eluted fractions (0.26 ml) were analyzed by SDS-polyacrylamide gel electrophoresis, and REV1 was found to be eluted at 700 mm NaCl. The pooled fractions containing REV1 were concentrated (using an Amicon Ultra centrifugal filter; Millipore) to a volume of 100 μl and further purified using a Superdex 200 column (Amersham Biosciences) with buffer B containing 400 mm NaCl. Fractions containing recombinant protein were pooled, concentrated, and exchanged into storage buffer (50 mm Tris-HCl, pH 7.5, containing 50% glycerol (v/v), 5 mm 2-mercaptoethanol, 1 mm EDTA, and 400 mm NaCl). The yield was about 330 μg from 24 liters of culture. The protein concentration was determined using a calculated ϵ280 value of 102 mm–1 cm–1 for REV1 (37Pace C.N. Vajdos F. Fee L. Grimsley G. Gray T. Protein Sci. 1995; 4: 2411-2423Crossref PubMed Scopus (3472) Google Scholar). An SDS-polyacrylamide gel electrophoretogram of purified REV1 is included in Fig. S1. Reaction Conditions for Enzyme Assays—Unless indicated otherwise, standard DNA polymerase reactions were performed in 50 mm Tris-HCl (pH 7.5) buffer containing 50 mm NaCl, 5 mm dithiothreitol, 100 μgml–1 bovine serum albumin (w/v), and 10% glycerol (v/v) with 100 nm primer-template at 37 °C. Primers were 5′-end-labeled using T4 polynucleotide kinase with [γ-32P]ATP and annealed with template (36-mer). All reactions were initiated by the addition of dNTP and MgCl2 (5 mm final concentration) to preincubated enzyme/DNA mixtures. Primer Extension Assay with All Four dNTPs—A 32P-labeled primer, annealed to either an unmodified or adducted template, was extended in the presence of all four dNTPs (100 μm each) for 15 min. Reaction mixtures (8 μl) were quenched with 2 volumes of a solution of 20 mm EDTA in 95% formamide (v/v). Products were resolved using a 16% polyacrylamide (w/v) gel electrophoresis system containing 8 m urea and visualized using a Bio-Rad Molecular Imager FX and Quantity One software (Bio-Rad). Steady-state Reactions—A 32P-labeled primer, annealed to either an unmodified or adducted template, was extended in the presence of increasing concentrations of a single dNTP. The molar ratio of primer/template to enzyme was at least 10:1, except for dGTP, dTTP, and O6-PobG-adducted template. Enzyme concentrations and reaction times were chosen so that maximal product formation would be ≤20% of the substrate concentration (38Goodman M.F. Creighton S. Bloom L.B. Petruska J. Crit. Rev. Biochem. Mol. Biol. 1993; 28: 83-126Crossref PubMed Scopus (404) Google Scholar). The primer-template was extended with dNTP in the presence of 0.1–50 nm enzyme for 5 or 10 min. All reactions (8 μl) were done at 10 dNTP concentrations and quenched with 10 volumes of a solution of 20 mm EDTA in 95% formamide (v/v). Products were resolved using a 16% polyacrylamide (w/v) electrophoresis gel containing 8 m urea and quantitated by phosphorimaging analysis using a Bio-Rad molecular imager FX instrument and Quantity One software. Graphs of product formation versus dNTP concentration were fit using nonlinear regression (hyperbolic fits) in GraphPad Prism (San Diego, CA) for the determination of kcat and Km values. Pre-steady-state Reactions—Rapid quench experiments were performed using a model RQF-3 KinTek Quench Flow Apparatus (KinTek Corp., Austin, TX). Reactions were initiated by rapid mixing of 32P-primer/template/polymerase mixtures (12.5 μl) with the dNTP-Mg2+ complex (10.9 μl) and then quenched with 0.3 m EDTA after times varying from 5 ms to 15 s for N2-BzG-, O6-BzG-, N2-BPG-, and O6-PobG-containing DNA. Reactions were mixed with 450 μl of formamide-dye solution (20 mm EDTA, 95% formamide (v/v), 0.5% bromphenol blue (w/v), and 0.05% xylene cyanol (w/v)) and run on a denaturing electrophoresis gel, with quantitation as described for the steady-state reactions. Pre-steady-state experiments were fit with the burst equation y = A(1 – e–kpt) + ksst, where y = concentration of product, A = burst amplitude, kp = pre-steady-state rate of nucleotide incorporation, t = time, and kss = steady-state rate of nucleotide incorporation (not normalized for enzyme concentration in the equation) (39Patel S.S. Wong I. Johnson K.A. Biochemistry. 1991; 30: 511-525Crossref PubMed Scopus (473) Google Scholar, 40Johnson K.A. Methods Enzymol. 1995; 249: 38-61Crossref PubMed Scopus (194) Google Scholar), using nonlinear regression analysis in GraphPad Prism software. Results obtained under single turnover conditions were fit with the burst equation y = A(1 – e–kpt) (see above). Phosphorothioate Analysis—With the 32P-primer annealed to an N2-BPG-adducted template, reactions were initiated by rapid mixing of 32P-primer/template/polymerase mixtures (12.5 μl) with an (S)p-dCTPαS-Mg2+ complex (or dCTP-Mg2+) (10.9 μl) and then quenched with 0.3 m EDTA after reaction times varying from 5 ms to 30 s. Products were analyzed as described for the pre-steady-state reactions mentioned earlier. Determination of K dCTPd—K dCTPd was estimated by performing pre-steady-state reactions at different dNTP concentrations with reaction times varying from 5 ms to 15 s. A graph of the burst rate (kobs) versus dCTP concentration was fit to the hyperbolic equation kobs = kpol[dNTP]/([dNTP] + Kd), where kpol is the maximal rate of nucleotide incorporation, and K dCTPd is the equilibrium dissociation constant for dCTP (39Patel S.S. Wong I. Johnson K.A. Biochemistry. 1991; 30: 511-525Crossref PubMed Scopus (473) Google Scholar, 40Johnson K.A. Methods Enzymol. 1995; 249: 38-61Crossref PubMed Scopus (194) Google Scholar). Estimation of the Apparent Dissociation Constant (Kd) for DNA by Electrophoretic Mobility Shift Assay—Increasing concentrations of human REV1 (2.5–320 nm) were incubated with 0.5 nm 32P-labeled 24-mer/36-mer primer-template DNA on ice for 15 min in the binding buffer containing 50 mm Tris-HCl (pH 8.0 at 4 °C), 50 mm NaCl, 50 mm MgCl2, 5 mm dithiothreitol, 100 μgml–1 bovine serum albumin (w/v), and 10% glycerol (v/v). The mixtures were directly loaded on nondenaturing 4% polyacrylamide gels and electrophoresed at 8 V cm–1 for 1 h at 4 °C in the running buffer (40 mm Tris acetate (pH 8.0 at 4 °C) containing 5 mm magnesium acetate and 0.1 mm EDTA. The fractions of REV1-bound DNA were quantitated using a Bio-Rad molecular imager FX instrument and Quantity One software. Assuming a 1:1 stoichiometry between REV1 and DNA substrate, the data were fit to a single-site binding equation (41van Holde K.E. Johnson W.C. Ho P.S. Principles of Physical Biochemistry. Prentice Hall, Upper Saddle River, NJ1998: 587-633Google Scholar), θ = [Ef]/(Kd + [Ef]), where θ = fraction saturation and [Ef] = free enzyme concentration, in GraphPad Prism software. The free enzyme concentration was estimated using a conservation of mass equation [Ef] = [Et] – [E·DNA], in which [Et] = total enzyme concentration in reaction mixture and [E·DNA] = the concentration of enzyme-DNA complex. REV1-catalyzed Pyrophosphorolysis—REV1 (50 nm) was preincubated with 100 nm 32P-labeled 25-mer/36-mer primer-template DNA in a reaction mixture containing 50 mm Tris-HCl (pH 7.5), 50 mm NaCl, 50 mm MgCl2, 5 mm dithiothreitol, 100 μgml–1 bovine serum albumin (w/v), and 10% glycerol (v/v) on ice for 15 min. Pyrophosphorolysis was then initiated by the addition of various concentrations of PPi to a preincubated E·DNA mixture. After 15 min at 37 °C, the reactions were quenched with 10 volumes of a solution of 20 mm EDTA in 95% formamide (v/v). Products were analyzed by electrophoresis, as described for the steady-state experiments. Primer Extension by Human REV1 in the Presence of All Four dNTPs—Polymerization by human REV1 at various N2- and O6-modified G adducts was analyzed in "standing start" assays using 24-mer/36-mer duplexes containing G and each of 11 different N2-G and O6-G adducts (Fig. 1) at position 25 of the template (Fig. 2). Increasing concentrations of REV1 were used in 15-min incubations with each of 12 different primer-template complexes in the presence of all four dNTPs. REV1 readily incorporated one base on the 3′-end of the 24-mer primer annealed to unmodified G and all of the N2-modified G templates, in proportion to enzyme concentration, but extended poorly across subsequent nonguanine (C and T) positions 26 and 27 of templates except for the cases of the G and N2-MeG templates. Opposite N2-AnthG and N2-BPG, REV1 did incorporate one base but with a gradual reduction in extension products. Polymerization across O6-MeG and O6-BzG yielded a pattern of extension similar to N2-G adducts, but each of the extension products was less than the insertion product formed across N2-MeG and N2-BzG, respectively. In contrast, all polymerization by REV1 was almost completely blocked opposite O6-PobG.FIGURE 2Extension of 32P-labeled primers opposite G and N2- and O6-G adducts by human REV1 in the presence of all four dNTPs. A, opposite G, N2-MeG, N2-EtG, N2-IbG, N2-BzG, N2-NaphG, N2-AnthG, N2-BPG, and N2,N2-diMeG; B, opposite G, O6-MeG, O6-BzG, and O6-PobG. Primer (24-mer) was annealed with each of the 12 different 36-mer templates (Table 1) containing an unmodified G or N2- or O6-modified G placed at the 25th position from the 3′-end (see Fig. 1). Reactions were performed for 15 min with increasing concentrations of REV1 (0–50 nm) and a constant concentration of DNA substrate (100 nm primer-template) as indicated. 32P-Labeled 24-mer primer was extended in the presence of all four dNTPs. The reaction products were analyzed by denaturing gel electrophoresis with subsequent phosphorimaging analysis.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Steady-state Kinetics of dNTP Incorporation Opposite G and N2-G and O6-G Adducts—Steady-state parameters were measured for dNTP incorporation into 24-mer/36-mer duplexes opposite G, N2-G, and O6-G adducts by REV1 (Tables 2 and 3). The incorporations of dATP opposite G, N2-G, and O6-G adducts were not determined because of much less efficient activity than with other dNTPs. REV1 preferentially incorporated dCTP opposite G and all of the modified G adducts, with relatively low misinsertion frequency for dTTP and dGTP (f = 0.006–0.06), where f

Referência(s)