Multiple Roles for the T7 Promoter Nontemplate Strand during Transcription Initiation and Polymerase Release
2004; Elsevier BV; Volume: 280; Issue: 5 Linguagem: Inglês
10.1074/jbc.m412287200
ISSN1083-351X
Autores Tópico(s)Bacterial Genetics and Biotechnology
ResumoTranscription initiation begins with recruitment of an RNA polymerase to a promoter. Polymerase-promoter interactions are retained until the nascent RNA is extended to 8–12 nucleotides. It has been proposed that accumulation of "strain" in the transcription complex and RNA displacement of promoter-polymerase interactions contribute to releasing the polymerase from the promoter, and it has been further speculated that too strong a promoter interaction can inhibit the release step, whereas a weak interaction may facilitate release. We examined the effects of partial deletion of the nontemplate strand on release of T7 RNA polymerase from the T7 promoter. T7 polymerase will initiate from such partially single-stranded promoters but binds them with higher affinity than duplex promoters. We found that release on partially single-stranded promoters is strongly inhibited. The inhibition of release is not due to an indirect effect on transcription complex structure or loss of specific polymerase-nontemplate strand interactions, because release on partially single-stranded templates is recovered if the interaction with the promoter is weakened by a promoter base substitution. This same substitution also appears to allow the polymerase to escape more readily from a duplex promoter. Our results further suggest that template-nontemplate strand reannealing drives dissociation of abortive transcripts during initial transcription and that loss of interactions with either the nontemplate strand or duplex DNA downstream of the RNA lead to increased transcription complex slippage during initiation. Transcription initiation begins with recruitment of an RNA polymerase to a promoter. Polymerase-promoter interactions are retained until the nascent RNA is extended to 8–12 nucleotides. It has been proposed that accumulation of "strain" in the transcription complex and RNA displacement of promoter-polymerase interactions contribute to releasing the polymerase from the promoter, and it has been further speculated that too strong a promoter interaction can inhibit the release step, whereas a weak interaction may facilitate release. We examined the effects of partial deletion of the nontemplate strand on release of T7 RNA polymerase from the T7 promoter. T7 polymerase will initiate from such partially single-stranded promoters but binds them with higher affinity than duplex promoters. We found that release on partially single-stranded promoters is strongly inhibited. The inhibition of release is not due to an indirect effect on transcription complex structure or loss of specific polymerase-nontemplate strand interactions, because release on partially single-stranded templates is recovered if the interaction with the promoter is weakened by a promoter base substitution. This same substitution also appears to allow the polymerase to escape more readily from a duplex promoter. Our results further suggest that template-nontemplate strand reannealing drives dissociation of abortive transcripts during initial transcription and that loss of interactions with either the nontemplate strand or duplex DNA downstream of the RNA lead to increased transcription complex slippage during initiation. Transcription initiation begins with the binding of RNA polymerase (RNAP) 1The abbreviations used are: RNAP, RNA polymerase; WT, wild type; ExoIII, exonuclease III; IC, initiation complex; EC, elongation complex; nt, nucleotides; T, template(s); NT, nontemplate(s); FeBABE, iron(S)-1-(p-bromoacetamidobenzyl) ethylenediaminetetraacetate; pss, partially single-stranded. 1The abbreviations used are: RNAP, RNA polymerase; WT, wild type; ExoIII, exonuclease III; IC, initiation complex; EC, elongation complex; nt, nucleotides; T, template(s); NT, nontemplate(s); FeBABE, iron(S)-1-(p-bromoacetamidobenzyl) ethylenediaminetetraacetate; pss, partially single-stranded. to a promoter. Transcription initiation ends when the RNAP releases the promoter and forms a mature elongation complex (EC). For all RNAPs in which the initiation process has been well studied, it is found that release of the promoter does not occur immediately upon formation of the first phosphodiester bond (1Krummel B. Chamberlin M. Biochemistry. 1989; 28: 7824-7829Crossref Scopus (173) Google Scholar, 2Ikeda R.A. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1986; 8: 3614-3618Crossref Scopus (147) Google Scholar, 3Place C. Oddos J. Buc H. McAllister W.T. Buckle M. Biochemistry. 1999; 38: 4948-4957Crossref PubMed Scopus (35) Google Scholar, 4Yan M. Gralla J.D. EMBO J. 1997; 16: 7457-7467Crossref PubMed Scopus (30) Google Scholar). Instead, the polymerase appears to retain at least some promoter interactions until the RNA reaches a length of 8–12 nucleotides. Since these promoter interactions are energetically favorable, their release must be driven by accumulation of strain in the initial transcription complex (IC) (5Carpousis A.J Gralla J.D. J. Mol. Biol. 1985; 183: 165-177Crossref PubMed Scopus (153) Google Scholar, 6Straney D.C. Crothers D.M. Cell. 1985; 43: 449-459Abstract Full Text PDF PubMed Scopus (155) Google Scholar, 7Brieba L.G. Sousa R. EMBO J. 2001; 20: 6826-6835Crossref PubMed Scopus (45) Google Scholar) and/or by establishment of competing interactions in the EC (8Temiakov D. Mentesanas P.E. Ma K. Mustaev A. Borukhov S. McAllister W.T. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 14109-14114Crossref PubMed Scopus (74) Google Scholar, 9Mooney R.A. Landick R. Cell. 1999; 98: 687-690Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). During initiation by the single-subunit bacteriophage T7 RNAP, for example, the nascent RNA interacts with a "recognition loop," which contacts the –7 to –11 promoter base pairs during initiation (8Temiakov D. Mentesanas P.E. Ma K. Mustaev A. Borukhov S. McAllister W.T. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 14109-14114Crossref PubMed Scopus (74) Google Scholar), and may thereby displace part of the polymerase-promoter interaction to facilitate release.Another force driving release of the polymerase from the promoter may be the collapse of the initial transcription bubble. During initiation by T7 RNAP, the size of the transcription bubble grows from 7–8 to ∼13 base pairs as the RNA is progressively extended (10Liu C. Martin C.T. J. Biol. Chem. 2002; 277: 2725-2731Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 11Villemain J. Guajardo R. Sousa R. J. Mol. Biol. 1997; 273: 958-977Crossref PubMed Scopus (50) Google Scholar). Upon transition to elongation, the bubble collapses to a size of 8 base pairs (10Liu C. Martin C.T. J. Biol. Chem. 2002; 277: 2725-2731Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 11Villemain J. Guajardo R. Sousa R. J. Mol. Biol. 1997; 273: 958-977Crossref PubMed Scopus (50) Google Scholar). There may therefore be a favorable energetic component to formation of the EC due to a reformation of ∼5 DNA base pairs upon transition to elongation. On the other hand, this may involve displacement of a similar number of RNA:DNA base pairs in the hybrid (10Liu C. Martin C.T. J. Biol. Chem. 2002; 277: 2725-2731Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar) so that the reduction in transcription bubble size would be close to energetically neutral.T7 RNAP will initiate transcription from partially single-stranded (pss) promoters, which are duplex from –23 to –5 but which lack downstream nontemplate (NT) strand DNA (12Martin C.T. Coleman J.E. Biochemistry. 1987; 26: 2690-2696Crossref PubMed Scopus (114) Google Scholar, 13Maslak M. Martin C.T. Biochemistry. 1993; 32: 4281-4285Crossref PubMed Scopus (55) Google Scholar). Polymerase binding to such promoters has been found to be much tighter than to fully duplex promoters (14Diaz G.A. Rong M. McAllister W.T. Durbin R.K Biochemistry. 1996; 35: 10837-10843Crossref PubMed Scopus (58) Google Scholar, 15Bandwar R.P. Patel S.S. J. Mol. Biol. 2002; 324: 63-72Crossref PubMed Scopus (18) Google Scholar). Given such enhanced binding, it is legitimate to ask if the polymerase would be able to release such a promoter upon transition to elongation. If promoter release on such templates is indeed inefficient or even abrogated, there may be at least two possible mechanisms for why release fails. One is that binding to the pss promoter is simply too strong to be disrupted by the forces and competing interactions that disrupt the promoter interaction on a duplex promoter. The other possibility is that inefficient release would not be a direct consequence of the strength of the interaction with the pss promoter but rather a consequence of how the pss promoter modifies normal transcription complex structure. For example, it has been shown that on pss promoters, the RNA is not displaced from the template strand, and extended RNA:DNA hybrids are formed (16Gopal V. Brieba L.G. Guajardo R. McAllister W.T. Sousa R. J. Mol. Biol. 1999; 290: 411-413Crossref PubMed Scopus (49) Google Scholar, 17He B. Kukarin A. Temiakov D. Chin-Bow S.T. Lyakhov D.L. Rong M. Durbin R.K. McAllister W.T. J. Biol. Chem. 1998; 273: 18802-18816Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 18Gong P. Esposito E.A. Martin C.T. J. Biol. Chem. 2004; 279: 44277-44285Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). If the nascent RNA does not follow its normal pathway during transcription from pss templates, it may not be able to help displace the promoter-polymerase interaction as it is believed to do on a duplex template.To address these questions, we have used enzymatic footprinting to monitor polymerase movement away from the promoter during T7 RNAP initiation and elongation on duplex, pss, and heteroduplex templates. We find that promoter release by the polymerase is indeed abrogated on promoters that lack part of the NT strand around the transcription start site. Release is not recovered if the NT strand is present but is not complementary to the template, indicating that it is reannealing of the template strand and not its simple presence or absence that determines whether release occurs. Finally, we find that if the promoter is mutated to weaken its interaction with the polymerase, release is recovered even with pss templates, indicating that failure to release is due to overly strong interactions with the pss promoters and not to a change in transcription complex structure.EXPERIMENTAL PROCEDURESRNA Polymerase and Templates—Wild type and mutated T7 RNAP were purified as described previously (36Bonner G. Patra D. Lafer E.M. Sousa R. EMBO J. 1992; 11: 3767-3775Crossref PubMed Scopus (100) Google Scholar) and stored in 20 mm Tris-HCl (pH 8.0), 0.5 m NaCl, 5 mm dithiothreitol, 1 mm EDTA, 50% glycerol. The Q239C (–7) mutant was constructed by cysteine substitution of Gln239 in T7 RNAP in which 7 of the 12 endogenous cysteines had been mutated to serines using PCR-mediated mutagenesis as described previously (24Muhkerjee S. Brieba L.G. Sousa R. Cell. 2002; 110: 81-91Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). DNA oligomers were purchased from Qiagen and purified by PAGE. The sequences of all oligomers are presented in Table I. Where indicated, synthetic oligomers were labeled at the 5′-end with [γ-32P]ATP (4000 Ci/mmol; ICN) by T4 polynucleotide kinase (Invitrogen). To form double-stranded or pss templates, each oligomer was mixed with equimolar complementary oligomer in annealing buffer (20 mm Tris-HCl, pH 8.0, 10 mm NaCl) at 0.5 μm, followed by heating to 95 °C for 1 min, and allowed to cool slowly to room temperature.Fig. 1A, structure of the synthetic promoters used. For PNT–5, the NT strand extends from –23 to –5. The T strand sequence from –23 to +6 matches the T7 class I promoter, and from +7 to +34 the transcript sequence is CCGGAAUUCGAGCUCGCCCGGGGAUCCU. B, transcription reactions run for 2 (lanes 1–4), 4 (lanes 5–8), 8 (lanes 9–12), or 16 (lanes 13–16) min with the indicated templates (BUB, Bubble; GAP, Gapped) at 0.1 μm, with RNAP at 0.3 μm, and with GTP, ATP, CTP, and 3′-dUTP at 0.5 mm. Heterogeneous sequence transcripts are numbered, and oligo(G) products are indicated with an asterisk. C, transcription reactions run as in B but with CTP at 0.01 mm. D, number of 13-mers per template synthesized over time on the indicated templates with all NTPs at 0.5 mm. E, as in D but for reactions with CTP at 0.01 mm (at 2 and 4 min, 13-mer synthesized on the double-stranded promoter was too low to be reliably measured). F, abortive initiation assays carried out on double-stranded (lanes 1–6) or Bubble (lanes 7–12) templates for 2, 5, 10, 20, 45, and 60 min with only GTP and ATP at 0.5 mm present in the reaction.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table ISynthetic DNA oligomersNameSequence (5′-3′)SPT34-PNT-5ATCGAAATTAATACGACTCACSPT34-PNT-4ATCGAAATTAATACGACTCACTSPT34-PNT-3ATCGAAATTAATACGACTCACTASPT34-PNT-4ATCGAAATTAATACGACTCACTATSPT34-PNT-5-FlapATCGAAATTAATACGACTCACATATSPT34-PNT-1ATCGAAATTAATACGACTCACTATASPT34-PNT+4ATCGAAATTAATACGACTCACTATAGGGASPT34-PNT+8ATCGAAATTAATACGACTCACTATAGGGAGACCSPT34-PNT+14ATCGAAATTAATACGACTCACTATAGGGAGACCGGAATTSPT34-GapATCGAAATTAATACGACTCAC_______________________CGAGCTCGCCCGGGGATCCTSPT34-BubATCGAAATTAATACGACTCACATATCCCTCTGGCCTTAACGAGCTCGCCCGGGGATCCTSPT34-TAGGATCCCCGGGCGAGCTCGAATTCCGGTCTCCCTATAGTGAGTCGTATTAATTTCGATSPT34-NTATCGAAATTAATACGACTCACTATAGGGAGACCGGAATTCGAGCTCGCCCGGGGATCCTSPT25-TGGGCGAGCTCGAATTCCGGTCTCCCTATAGTGAGTCGTATTAATTTCGATSPT25-NTATCGAAATTAATACGACTCACTATAGGGAGACCGGAATTCGAGCTCGCCCEC14-26-TATGCATGCATGCAGCTGCTGCTGCGCTCTCTCTCTCCCTATAGTGAGTCGTATTAATTTCGATEC14-26-NTATCGAAATTAATACGACTCACTATAGGGAGAGAGAGAGCGCAGCAGCAGCTGCATGCATGCATEC14-26-GapATCGAAATTAATACGACTCAC________________________CGCAGCAGCAGCTGCATGCATGCATA15G-TTGCATGCATGCAGCTGCTGCTGCGCTCTCTCTCTCCCTATAGTGAGTCGTACTAATTTCGGA15G-NTCCGAAATTAGTACGACTCACTATAGGGAGAGAGAGAGCGCAGCAGCAGCTGCATGCATGCAA15G-GapCCGAAATTAGTACGACTCAC________________________CGCAGCAGCAGCTGCATGCATGCAT Open table in a new tab Transcription Assays—Transcription reactions were carried out for 15 min at room temperature in 10-μl reactions containing 10 mm Tris-HCl, pH 8.0, 10 mm NaCl, 6 mm MgCl2, 5 mm dithiothreitol, 2 mm spermidine, 0.01% Triton X-100. NTPs were added to 0.5 mm, unless otherwise indicated, and transcripts were labeled by inclusion of 1% (v/v) 800 Ci/mm, 10 mCi/ml [α-32P]GTP in the reaction mixture. To form halted complexes, required NTPs with 3′-deoxyribonucleoside triphosphates (3′-dNTP; Trilink Biotechnologies) were added to 0.5 mm in reaction mixture. Reactions were terminated by the addition of an equal volume of stop buffer (90% formamide, 50 mm EDTA, and 0.01% xylene cyanol) and analyzed by electrophoresis in 20% polyacrylamide (19% acrylamide, 1% bisacrylamide) gel cast in 1× Tris borate-EDTA (TBE) buffer containing 7 m urea. The gels were analyzed with an Amersham Biosciences PhosphorImager.DNA Footprinting and Digestion Assays—Halted complexes were formed as described above. DNase I (U.S. Biochemical Corp.) footprinting on these halted complexes was carried out as described (31Mukherjee S. Brieba L.G. Sousa R. EMBO J. 2003; 22: 6483-6493Crossref PubMed Scopus (22) Google Scholar). In exonuclease III (ExoIII) digestion reactions, halted complexes were incubated with 1 unit/μl ExoIII (New England Biolabs) at room temperature for 15 min or 30 min, as indicated in the figures. Products were resolved by denaturing 15% polyacrylamide (14.2% acrylamide, 0.8% bisacrylamide) with 7 m urea gel, followed by phosphorimaging. The digestion patterns were assessed with ImageQuant software (Amersham Biosciences). Cleavage positions were mapped by reference to Maxam-Gilbert G+A ladders prepared as described (31Mukherjee S. Brieba L.G. Sousa R. EMBO J. 2003; 22: 6483-6493Crossref PubMed Scopus (22) Google Scholar).DNA Cleavage by FeBABE-conjugated RNAP—Conjugation of Q239C (–7) with FeBABE (Dojindo Laboratories) was carried out as described previously (24Muhkerjee S. Brieba L.G. Sousa R. Cell. 2002; 110: 81-91Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). All reactions were carried out on halted complexes with DNA in which the 5′-end of the template (T) strand was labeled. DNA sequences are given in Table I. Halted complexes were formed at room temperature in transcription buffer with 1 × 10–8 m DNA and 3 × 10–8 m FeBABE-conjugated enzyme as above. After a 10-min incubation, cleavage was carried out by the addition of sodium ascorbate and H2O2 as described previously (24Muhkerjee S. Brieba L.G. Sousa R. Cell. 2002; 110: 81-91Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). Cleavage products were resolved by electrophoresis on denaturing 15% polyacrylamide and visualized by phosphorimaging.RESULTSTranscript Patterns on pss and Heteroduplex Templates—It has been previously shown that T7 RNAP will transcribe from promoters in which the NT strand downstream of –5 is missing (12Martin C.T. Coleman J.E. Biochemistry. 1987; 26: 2690-2696Crossref PubMed Scopus (114) Google Scholar, 13Maslak M. Martin C.T. Biochemistry. 1993; 32: 4281-4285Crossref PubMed Scopus (55) Google Scholar). However, transcription initiation from such templates does not replicate the transcript patterns seen on fully double-stranded templates (18Gong P. Esposito E.A. Martin C.T. J. Biol. Chem. 2004; 279: 44277-44285Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar, 19Jiang M. Ma N. Vassylyev D.G. McAllister W.T. Mol. Cell. 2004; 15: 777-788Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). Fig. 1B shows the transcript patterns obtained in assays with the four different synthetic promoter templates illustrated in Fig. 1A. In these reactions, 3′-dUTP replaces UTP so that the polymerase can only extend to +13 to form a halted EC (EC13). On all of these templates, a 13-mer is generated in amounts that equal or exceed the molar amount of template (Fig. 1D). We therefore conclude that the polymerase can extend transcripts beyond the initiation phase on all of these templates. However, the heteroduplex or bubble (BUB), gapped (GAP), or PNT–5 templates all exhibit greatly increased levels of oligo(G) slippage synthesis relative to the fully double-stranded (D.S.) promoter. In addition, if we measure the amounts of 13-mer synthesized per template over the reaction time course (Fig. 1D), we see that at the 2-min time point approximately one 13-mer has been synthesized on every template molecule. For the bubble and double-stranded templates, there is little increase in the amount of 13-mer over the next 14 min of the reaction. However, on the gapped and PNT–5 templates, additional 13-mers are generated at the rate of 1 every 3–4 min (Fig. 1D). These observations are consistent with previous studies showing that ECs formed on templates missing the NT strand are unstable and turn over rapidly, whereas ECs formed on double-stranded or heteroduplex templates turn over more slowly (20Mentesanas P.E. Chin-Bow S.T. Sousa R. McAllister W.T. J. Mol. Biol. 2000; 302: 1049-1062Crossref PubMed Scopus (46) Google Scholar).Another difference noted is that whereas transcription on the bubble, gapped, or PNT–5 templates is characterized by high levels of oligo(G) synthesis and near normal levels of 4- and 5-mer abortive transcripts, the levels of 6-, 7-, and 8-mer abortive transcripts obtained with these templates are less than with the double-stranded promoter (compare lane 13 with lanes 14–16 in Fig. 1B). To amplify the signal due to abortion at the 6- and 7-mer points, we carried out reactions at low (0.01 mm) CTP levels (Fig. 1C), and we also compared the rates of 6-mer synthesis in the absence of CTP on duplex and bubble templates (Fig. 1F). Under limiting CTP conditions, the polymerases pause after synthesis of the 6- and 7-mers, because CTP is required to extend these transcripts. On the double-stranded promoter, the delay in extending the 6- and 7-mer leads to a large increase in the level of 6- and 7-mer abortive transcripts, as is apparent in lanes 1, 5, 9, and 13 of Fig. 1C. On this template, the repeated abortion of transcription at the 6- and 7-mer points also delays the appearance of the 13-mer (Fig. 1E), revealing that, on average, it takes more than 16 min for all of the polymerases to clear the double-stranded promoter at low CTP concentrations. In contrast, the amounts of 6- and 7-mer synthesized on the other three templates are much less than with the double-stranded template, particularly in terms of the ratios of 6- or 7-mer to 13-mer (on the double-stranded template, for example, the 6-mer is made in 14-fold excess of 13-mer at 0.01 mm CTP, whereas on the gapped template, the 13-mer is 2-fold in excess of 6-mer). In the absence of CTP, transcription stops at the 6-mer (Fig. 1F). On both duplex and bubble templates, one 6-mer per template is synthesized 2 min after initiation of the reactions (Fig. 1F, lanes 1 and 7). On the duplex template, the IC with the 6-mer RNA (IC6) is unstable and turns over every 2–3 min, leading to a steady accumulation of 6-mer over an extended reaction time course (lanes 2–6). In contrast, on the bubble template, the IC6 is stable, and turnover during a 60-min reaction is barely detected (lanes 8 and 9). These observations suggest that the absence of a complementary NT strand has at least two effects on initial transcription: 1) it markedly increases the amount of oligo(G) synthesis; 2) it stabilizes ICs in which the RNA is longer than 5 nt.Efficient Promoter Release Requires a Fully Duplex Promoter— To detect clearance of the promoter by the polymerase, we used ExoIII to digest the template strand from the 3′ (upstream) end (Fig. 2A). In the absence of polymerase, digestion of double-stranded, PNT–5, Bubble, or Gapped promoters for 10 min (lanes 2, 8, 14, and 20) or 30 min (lanes 5, 11, 17, and 23) reduces the 56-nt T-strand to fragments of 25 nt or less. If polymerase and NTPs allowing RNA extension to 7 nt are added, the exonuclease is blocked at –20, corresponding to the upstream edge of the transcription complex bound to the promoter (lanes 3, 9, 15, and 21). Prolonged (30-min) treatment of the IC with ExoIII leads to some digestion beyond –20 (lanes 6, 12, 18, and 24). If NTPs allowing RNA extension to +13 are added to the reaction with the double-stranded template, the block to ExoIII digestion moves downstream to +2, revealing release of the polymerase from the promoter upon formation of EC13 (lanes 4 and 7).Fig. 2A, exonuclease III digestion of the indicated templates in which the T-strand is labeled at the 5′-end with 32P; [template] and [RNAP] are as in Fig. 1. Digestion was carried out for either 10 or 30 min (as indicated) with either naked DNA (lanes 2, 5, 8, 11, 14, 17, 20, and 23); polymerase + GTP, ATP, and 3′-dCTP (resulting in synthesis of a 7-mer; lanes 3, 6, 9, 12, 15, 18, 21, and 24); or GTP, ATP, CTP, and 3′-dUTP (resulting in 13-mer synthesis; lanes 4, 7, 10, 13, 16, 19, 22, and 25). B, DNase I digestion of the indicated templates (5′-end-labeled T-strand) with either no polymerase (lanes 3, 9, 15, and 21); polymerase + GTP, 3′-dATP (lanes 4, 10, 16, and 22); polymerase + GTP, ATP (lanes 5, 11, 17, and 23); polymerase + GTP, ATP, 3′-dCTP (lanes 6, 12, 18, and 24); and polymerase + GTP, ATP, CTP, 3′-dUTP (lanes 7, 13, 19, and 25). The vertical lines indicate regions of protection from DNase I.View Large Image Figure ViewerDownload Hi-res image Download (PPT)On the PNT–5, Bubble, or Gapped promoters, a block at –20 is observed for IC7 (lanes 9, 12, 15, 18, 21, and 24), just as for the double-stranded promoter. However, upon the addition of NTPs, allowing extension to +13, the block at –20 persists, and no new block at +2 is observed (lanes 10, 13, 16, 19, 22, and 25). After 30 min, some digestion beyond –20 is observed, especially with the Bubble and Gapped promoters (lanes 19 and 25); however, the new blocks to ExoIII do not appear at +2 but are spread between –7 and +1 (PNT–5 and bubble templates; lanes 13 and 19), or –13 and –17 (gapped template; lane 25). These observations suggest that, on the PNT–5, Bubble, and Gapped templates, promoter-polymerase interactions persist even if the transcript is extended to lengths that allow full promoter clearance on a double-stranded promoter.It is possible that on these templates the polymerase extends the transcript to +13 but then slides back to reestablish interactions with the promoter, leaving the downstream DNA uncovered. To test this possibility, we carried out a set of experiments using DNAse I to monitor movement of the polymerase during initiation (Fig. 2B). The results with the double-stranded promoter are straightforward and, as in the ExoIII experiment, reveal an efficient and quantitative progression of the polymerase through the transcription reaction. When NTPs allowing transcript extension to +4 are present, the IC4 footprint extends from –18 to +9, with partial protection extending ∼7 nt downstream of this (lane 4). Formation of an IC6 (lane 5) or IC7 (lane 6) extends the footprint downstream by 1 or 3 nt, respectively, whereas the upstream border of the footprint remains static. Extension of the RNA to 13 nt shifts the downstream boundary of protection to +19 and reveals disengagement of the polymerase from the promoter as detected by loss of protection of the –17 to –2 region (lane 7). On the PNT–5 template, protection by IC4 (lane 10) and IC6 (lane 11) extends from –17 to +9, although the downstream border of the footprint is difficult to define because DNase I digestion between –11 and +14 is weak even in the absence of polymerase (lane 9). Protection extends 1–2 nt further downstream in IC7 (lane 12), and DNA downstream of –14 shows a pattern of both suppressed and enhanced cleavage relative to either IC4/6 or naked DNA. This is probably due to binding of the single-stranded DNA to the polymerase in a manner that is not reflective of the mode of binding with a fully duplex template. Formation of EC13 leads to extensive protection of the downstream DNA up to +25, whereas protection of the promoter region up to –17 persists (lane 13). Results with the Bubble and Gapped templates are similar to those with PNT–5, but because these templates are both duplex downstream of +14, digestion patterns in this region are more readily comparable with those of the double-stranded promoter. It is seen that the downstream protection by EC13 on the Bubble (lane 19) and Gapped (lane 25) templates extends to +19 and is essentially identical to the protection observed on the double-stranded promoter (lane 7). However, on the Bubble and Gapped templates, protection of the upstream promoter up to –17 persists in EC13.The DNase I and exonuclease III results are therefore in agreement and suggest that the persistent protection of the promoter upon the addition of NTPs allowing transcript extension to 13 nt is not due to a polymerase that has slid back to the promoter, since, if that were the case, we would not expect to see the downstream extension of the EC13 footprint on the PNT–5, Bubble, or Gapped templates. However, since these experiments were done with polymerase in 3-fold excess of template, it is possible that the persistent promoter protection is due to a second polymerase molecule that binds to the promoter after the first has moved off to form the EC. This seems unlikely, because a polymerase halted at +13 is close enough to the promoter to block binding by a second enzyme, but to test this, we carried out an ExoIII experiment with double-stranded promoter and PNT–5 and with varying polymerase/template ratios (Fig. 3). NTPs allowing RNA extension to 13 nt were present. When polymerase is in severalfold excess of promoter, strong blocks to ExoIII are observed at +2 and –20 on the double-stranded and PNT–5 promoters, respectively (lanes 1–3 and 6–8). As the polymerase concentration is reduced, limited digestion beyond these blocks is detected (lanes 4, 5, 9, and 10), but even at a 1:1 polymerase/template ratio, the predominating block on PNT–5 is at –20 (lane 10). We conclude that this block is not due to a second polymerase that binds after the first has cleared the promoter and halted at +13 but rather to a single polymerase that retains promoter interactions.Fig. 3ExoIII digestion of double-stranded (lanes 1–5) or PNT–5 (lanes 6–10) in reactions with RNAP/template ratios varying from 16 to 1, as indicated, and with GTP, ATP, CTP, and 3′-dUTP present.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Promoter Clearance on pss Templates Is Inefficient Even When Transcription Extends to +26 —The above results indicate that promoter clearance on a pss promoter is inefficient when the transcript is extended to 13 nt. To determine whether the transcript could be extended even further on such a template without leading to promoter release, we used a promoter that allows transcript extension to 14 or 26 nt by including GTP/ATP/3′-dCTP or GTP/ATP/CTP/3′-dUTP, respectively, in the reaction (Fig. 4). Because movement of the polymerase to +26 would probably allow binding of a second polymerase to the promoter, we worked with 1:1 RNAP/template ratios. The addition of polymerase, GTP, and 3′-dATP resulted in protection of the –18 to +9 region of the template on
Referência(s)