Produção Nacional
Revisado por pares
The Phosphorylation State and Expression of Soybean BiP Isoforms Are Differentially Regulated following Abiotic Stresses
2000; Elsevier BV; Volume: 275; Issue: 19 Linguagem: Inglês
10.1074/jbc.275.19.14494
ISSN1083-351X
AutoresJúlio Cézar M. Cascardo, Raul Santin Almeida, Reginaldo A.A. Buzeli, Sônia M.B. Carolino, Wagner Campos Otoni, Elizabeth P. B. Fontes,
Tópico(s)Endoplasmic Reticulum Stress and Disease
ResumoThe mammalian BiP is regulated by phosphorylation, and it is generally accepted that its unmodified form constitutes the biologically active species. In fact, the glycosylation inhibitor tunicamycin induces dephosphorylation of mammalian BiP. The stress-induced phosphorylation state of plant BiP has not been examined. Here, we demonstrated that soybean BiP exists in interconvertible phosphorylated and nonphosphorylated forms, and the equilibrium can be shift to either direction in response to different stimuli. In contrast to tunicamycin treatment, water stress condition stimulated phosphorylation of BiP species in soybean cultured cells and stressed leaves. Despite their phosphorylation state, we demonstrated that BiP isoforms from water-stressed leaves exhibit protein binding activity, suggesting that plant BiP functional regulation may differ from other eukaryotic BiPs. We also compared the induction of the soybean BiP gene family, which consists of at least four members designated soyBiPA, soyBiPB,soyBiPC, and soyBiPD, by tunicamycin and osmotic stress. Although all soybean BiP genes were induced by tunicamycin, just the soyBiPA RNA was up-regulated by osmotic stress. In addition, these stresses promoted BiP induction with different kinetics and acted synergistically to increase BiP accumulation. These results suggest that the soybean BiP gene family is differentially regulated by abiotic stresses through distinct signaling pathways. The mammalian BiP is regulated by phosphorylation, and it is generally accepted that its unmodified form constitutes the biologically active species. In fact, the glycosylation inhibitor tunicamycin induces dephosphorylation of mammalian BiP. The stress-induced phosphorylation state of plant BiP has not been examined. Here, we demonstrated that soybean BiP exists in interconvertible phosphorylated and nonphosphorylated forms, and the equilibrium can be shift to either direction in response to different stimuli. In contrast to tunicamycin treatment, water stress condition stimulated phosphorylation of BiP species in soybean cultured cells and stressed leaves. Despite their phosphorylation state, we demonstrated that BiP isoforms from water-stressed leaves exhibit protein binding activity, suggesting that plant BiP functional regulation may differ from other eukaryotic BiPs. We also compared the induction of the soybean BiP gene family, which consists of at least four members designated soyBiPA, soyBiPB,soyBiPC, and soyBiPD, by tunicamycin and osmotic stress. Although all soybean BiP genes were induced by tunicamycin, just the soyBiPA RNA was up-regulated by osmotic stress. In addition, these stresses promoted BiP induction with different kinetics and acted synergistically to increase BiP accumulation. These results suggest that the soybean BiP gene family is differentially regulated by abiotic stresses through distinct signaling pathways. endoplasmic reticulum unfolded protein response reverse transcriptase-polymerase chain reaction polyacrylamide gel electrophoresis polyethylene glycol phenylmethylsulfonyl fluoride base pair(s) The endoplasmic reticulum (ER)1 provides the folding environment that facilitates the acquisition of proper folding and assembly of secretory proteins, a prerequisite for them to move further through the secretory apparatus (for reviews, see Refs. 1.Denecke J. Plant Physiol. Biochem. 1996; 34: 197-205Google Scholar, 2.Galili G. Sengupta-Gopalam C. Ceriotti A. Plant Mol. Biol. 1998; 38: 1-29Crossref PubMed Google Scholar, 3.Hammond C. Helenius A. Curr. Opin. Cell Biol. 1995; 7: 523-529Crossref PubMed Scopus (589) Google Scholar, 4.Pelham H.R.B. Annu. Rev. Cell Biol. 1989; 5: 1-23Crossref PubMed Scopus (542) Google Scholar). A set of ER-resident proteins, including molecular chaperones and folding enzymes, associates with newly synthesized polypeptides to assist proper folding and assembly of oligomeric secretory proteins (reviewed in Refs. 1.Denecke J. Plant Physiol. Biochem. 1996; 34: 197-205Google Scholar, 3.Hammond C. Helenius A. Curr. Opin. Cell Biol. 1995; 7: 523-529Crossref PubMed Scopus (589) Google Scholar, and 5.Gething M.-J. Sambrook J. Nature. 1992; 355: 33-45Crossref PubMed Scopus (3607) Google Scholar). The binding protein (BiP) represents one of the best-characterized molecular chaperones from the ER. The mechanism of BiP binding to and release from nascent polypeptide is believed to be analogous to that described for the cytosolic HSP70 protein (6.Ellis R.J. van der Vies S.M. Annu. Rev. Biochem. 1991; 60: 321-347Crossref PubMed Google Scholar, 7.Hendrick J.P. Hartl F.-U. Annu. Rev. Biochem. 1993; 62: 349-384Crossref PubMed Scopus (1477) Google Scholar). HSP70-related proteins exist in equilibrium between self-assembled forms and monomers in which the binding site is either free or associated with other proteins (8.Benaroudj N. Triniolles F. Ladjimi M.M. J. Biol. Chem. 1996; 271: 18471-18476Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). This equilibrium is regulated by cycles of ADP/ATP binding and hydrolysis as well as cycles of protein substrate binding and release (9.Knittler M.R. Haas I.G. EMBO J. 1992; 11: 1573-1581Crossref PubMed Scopus (144) Google Scholar). BiP also exists in interconvertible oligomeric and monomeric forms and is post-translationally modified and regulated by ADP-ribosylation and phosphorylation (10.Carlsson L. Lazarides E. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 4664-4668Crossref PubMed Scopus (81) Google Scholar, 11.Hendershot L.M. Ting J. Lee A. J. Mol. Cell. Biol. 1988; 8: 4250-4256Crossref Scopus (162) Google Scholar). These modifications occur upon the ATP-dependent release of BiP from associated proteins and can be reversed under stress conditions that increase the level of unfolded polypeptides in the ER. Because phosphorylation and ADP-ribosylation appear to be restricted to oligomeric forms of mammalian BiP that are not bound to nascent polypeptides, the monomeric, unmodified form of BiP is thought to be the biologically active species (12.Freiden P.J. Gaut J.R. Hendershot L.M. EMBO J. 1992; 11: 63-70Crossref PubMed Scopus (152) Google Scholar). In spinach, three forms of BiP, the 85-kDa monomer, a 280-kDa multimeric form, and a 650-kDa oligomeric form, have been described (13.Anderson J.V. Li Q.B. Haskell D.W. Guy C.L. Plant Physiol. (Rockv). 1994; 104 (1370): 1395Google Scholar). However, only the oligomeric form of BiP is phosphorylated in vitro, suggesting that, like mammals, the level of functional plant BiP is regulated by post-translational modification. The ER molecular chaperone proteins are expressed constitutively at low levels in all cells but are induced upon accumulation of unfolded protein in the lumen of the ER (5.Gething M.-J. Sambrook J. Nature. 1992; 355: 33-45Crossref PubMed Scopus (3607) Google Scholar, 7.Hendrick J.P. Hartl F.-U. Annu. Rev. Biochem. 1993; 62: 349-384Crossref PubMed Scopus (1477) Google Scholar). The expression of folding-defective mutant secretory proteins or treatment of cells with agents that impair protein folding activates a signaling cascade to allow communication between the ER and nucleus (14.Lee A.S. Curr. Opin. Cell Biol. 1992; 4: 267-273Crossref PubMed Scopus (396) Google Scholar). This signal transduction pathway, designated the unfolded protein response (UPR) pathway, is characterized by the coordinated transcriptional up-regulation of BiP and other ER proteins that are involved in folding and assembly of nascent proteins. The inter-organelle signaling cascade, which has been elucidated in yeast, involves an ER transmembrane kinase and a basic leucine zipper transcription factor, Hac1p, whose level is modulated by a regulated spliceosome-independent mRNA splicing event (reviewed in Ref. 15.Shamu C.E. Curr. Biol. 1997; 7: 67-70Abstract Full Text Full Text PDF PubMed Google Scholar). In plants, like mammals and yeast, the expression of BiP is regulated according to cellular requirements for chaperone activity. Thus, both the increase of secretory activity and the accumulation of unfolded proteins within the ER result in the induction of BiP synthesis in plants (reviewed in Refs. 1.Denecke J. Plant Physiol. Biochem. 1996; 34: 197-205Google Scholar and 16.Boston R.S. Viitanen P.V. Vierling E. Plant Mol. Biol. 1996; 34: 191-222Crossref Scopus (512) Google Scholar). In the floury-2 mutant of maize, the synthesis of a zein-like storage protein variant, which contains an uncleavable signal sequence, is associated with increased accumulation of BiP (17.Boston R.S. Fontes E.P.B. Shank B.B. Wrobel R.L. Plant Cell. 1991; 3: 497-505Crossref PubMed Scopus (113) Google Scholar, 18.Fontes E.P.B. Shank B.B. Wrobel R.L. Moose S.P. O'Brian G.R. Wurtzel E.T. Boston R.S. Plant Cell. 1991; 3: 483-496Crossref PubMed Scopus (163) Google Scholar, 19.Coleman C.E. Lopes M.A. Gillikin J.W. Boston R.S. Larkins B.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6828-6831Crossref PubMed Scopus (101) Google Scholar, 20.Gillinki J.W. Zhang F. Coleman C.E. Bass H.W. Larkins B.A. Boston R.S. Plant Physiol. (Rockv). 1997; 114: 345-352Crossref PubMed Scopus (63) Google Scholar). Expression of an assembly-defective mutant of the bean storage protein phaseolin also induces BiP synthesis in tobacco leaf protoplasts (21.Pedrazzini E. Giovinazzo G. Bollini R. Ceriotti A. Vitale A. Plant J. 1994; 5: 103-110Crossref Scopus (72) Google Scholar). Furthermore, tunicamycin, a potent activator of the UPR pathway, efficiently induces BiP expression at both mRNA and protein level in several plant systems (18.Fontes E.P.B. Shank B.B. Wrobel R.L. Moose S.P. O'Brian G.R. Wurtzel E.T. Boston R.S. Plant Cell. 1991; 3: 483-496Crossref PubMed Scopus (163) Google Scholar, 22.D'amico L. Valsania B. Daminati M.G. Fabrini M.S. Nitti G. Bollini R. Ceriotti A. Vitale A. Plant J. 1992; 2: 443-445PubMed Google Scholar). These results have led to the conclusion that, like mammals and yeast BiP, plant BiP is most likely regulated through an unfolded protein response pathway. This idea is supported by the observation that, as in mammalian cells, overexpression of BiP in tobacco leaf protoplasts attenuates ER stress caused by tunicamycin and prevents activation of the unfolded protein response pathway (23.Leborgne-Castel N. Jelitto-Van Dooren E.P.W.M. Crofts A.J. Denecke J. Plant Cell. 1999; 11: 459-469Crossref PubMed Scopus (154) Google Scholar, 24.Morris J.A. Dorner A.J. Edwards C.A. Hendershot L.M. Kaufman R.J. J. Biol. Chem. 1997; 272: 4327-4334Abstract Full Text Full Text PDF PubMed Scopus (301) Google Scholar). However, in some plant species, specific stress conditions and developmental events alter BiP mRNA and protein levels to different extents, suggesting that post-transcriptional mechanisms are also involved in the regulation of BiP synthesis in plants (13.Anderson J.V. Li Q.B. Haskell D.W. Guy C.L. Plant Physiol. (Rockv). 1994; 104 (1370): 1395Google Scholar, 25.Kalinski A. Rowley D.L. Loer D.S. Foley C. Buta G. Herman E.M. Planta. 1995; 195: 611-621Crossref PubMed Scopus (68) Google Scholar). Alternatively or additionally, these discrepancies between the level of BiP mRNA and protein may reflect differential expression and regulation of plant BiP gene families, since the genome of several plant species is represented by multiple BiP genes (25.Kalinski A. Rowley D.L. Loer D.S. Foley C. Buta G. Herman E.M. Planta. 1995; 195: 611-621Crossref PubMed Scopus (68) Google Scholar, 26.Denecke J. Goldman M.H.S. Demolder J. Seurinck J. Botterman J. Plant Cell. 1991; 3: 1025-1035Crossref PubMed Google Scholar, 27.Wrobel R.L. O'Brian G.R. Boston R.S. Gene. 1997; 204: 105-113Crossref PubMed Scopus (23) Google Scholar). Both alternatives support the argument that multiple, complex regulatory mechanisms control BiP gene expression in plants. In soybean, three distinct BiP cDNAs have been isolated from a leaf library (25.Kalinski A. Rowley D.L. Loer D.S. Foley C. Buta G. Herman E.M. Planta. 1995; 195: 611-621Crossref PubMed Scopus (68) Google Scholar), and one has been identified in a seed cDNA expression library (28.Figueiredo J.E.F. Cascardo J.C.M. Carolino S.M.B. Alvim F. Fontes E.P.B. Rev. Bras. Fisiol. Veg. 1997; 9: 103-110Google Scholar). In this paper, we used two-dimensional gel electrophoresis and reverse transcription (RT)-PCR assays to examine the potential BiP regulatory mechanisms in plants. We compared the mechanisms controlling BiP up-regulation by tunicamycin treatment and water stress as well as the phosphorylation state of the induced BiP forms. Soybean plants (Glycine max cv. Cristalina) were germinated in 5-liter pots containing a mixture of soil, sand, and dung (3:1:1) and grown in standardized greenhouse conditions. Plant tissues were harvested, immediately frozen in liquid nitrogen, and stored at −80 °C. Water stress condition was induced in 40-day-old plants by withholding watering for 8 days before harvesting of leaves. Half of the leaves were used to measure the relative water content (29.Catsky J. Slavik N. Methods of Studying Plant Water Relations. Springer-Verlag New York Inc., New York1974: 136-151Google Scholar), and the other half was frozen in liquid nitrogen. Cotyledons cells from the soybean variety IAC-12 were cultured as described previously (30.Finer J.J. Nagasawa A. Plant Cell Tissue Organ. Cult. 1988; 15: 125-136Crossref Scopus (173) Google Scholar). Tunicamycin was added to cultures at 4 days after passage by dilution of a 5 mg/ml stock in Me2SO into normal growth medium to 10 μg/ml and incubated for the intervals indicated in the figure legends. For water stress, the cells were washed and then cultured with normal growth medium containing 10% (w/v) PEG-8000 (polyethylene glycol), which corresponds to a water potential of −1.4 megapascals for the indicated intervals. For two-dimensional gel electrophoresis, SDS-PAGE, and RT-PCR assays, the cells were filtered under vacuum and washed with an isotonic solution (0.25 m NaCl) to remove any adhered medium and PEG. The cells were then frozen in liquid nitrogen before protein and RNA extractions. Total protein was extracted from an acetone dry powder, as described (31.Görg A. Postel W. Günther S. Electrophoresis. 1988; 9: 531-546Crossref PubMed Scopus (863) Google Scholar) with some modifications. Briefly, plant tissues (cells and leaves) were crushed in liquid nitrogen, and 2 g of the powder were homogenized with 10% (w/v) trichloroacetic acid in acetone containing 0.07% (v/v) 2-mercaptoethanol. Total protein was precipitated for 40 min at −20 °C, recovered by centrifugation at 16,000 × g for 15 min, and washed 2–3 times with acetone containing 0.07% (v/v) 2-mercaptoethanol. The pellet was dried under vacuum, and 30 mg of the acetone dry powder were resuspended in 1 ml of lysis buffer (9 m urea, 2% (v/v) Triton X-100, 2% (v/v) 2-mercaptoethanol, 0.8% (v/v) Ampholines (pH 5–7), 0.2% (v/v) Ampholines (pH 3.5–10), 8 mm PMSF) followed by ultrasonication on ice. Cell debris was removed by centrifugation at 30,000 × g for 15 min, and protein concentration was determined as described (32.Hill H.D. Straka J.G. Anal. Biochem. 1988; 170: 203-208Crossref PubMed Scopus (289) Google Scholar). Two-dimensional gel electrophoresis was performed as described (33.O'Farrell P.H. J. Biol. Chem. 1975; 250: 4007-4021Abstract Full Text PDF PubMed Google Scholar). For the first dimension, 30–50 μg of protein were loaded on isoelectric focusing tube gels (Bio-Rad) in which the pH gradient was established with 80% pH 5–7 and 20% pH 3.5–10 Ampholines (Amersham Pharmacia Biotech). After electrophoresis at 750 V for 3.5 h, the gels were equilibrated with buffer A (5 mm Tris-HCl (pH 6.8), 6 m urea, 30% (v/v) glycerol, and 2% (w/v) SDS) and stored at −80 °C. Prior to the second dimension, the gels were re-equilibrated for 15 min with buffer A containing 65 mmdithiothreitol and then for 15 min with buffer A containing 65 mm dithiothreitol and 260 mm iodoacetamide. SDS-PAGE was carried out as described previously (34.Laemmli U. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar), and the proteins were transferred from 10% SDS-polyacrylamide gels to nitrocellulose membranes by electroblotting. Immunoblot analyses were performed using polyclonal anti-BiP-carboxy antibodies (28.Figueiredo J.E.F. Cascardo J.C.M. Carolino S.M.B. Alvim F. Fontes E.P.B. Rev. Bras. Fisiol. Veg. 1997; 9: 103-110Google Scholar) at a 1:1000 dilution and a goat anti-rabbit IgG alkaline phosphatase conjugate (Sigma) at a 1:5000 dilution. Alkaline phosphatase activity was assayed using 5-bromo-4-chloro-3-indolyl phosphate (Life Technologies, Inc.) andp-nitro blue tetrazolium (Life Technologies, Inc.). The pH gradient of the isoelectric focusing gels was determined by incubating 0.2-cm mock-loaded gel slices in 2 ml of H2O at room temperature for 12 h with shaking. The pH of each gel slice was measured and plotted as a function of the distance from the anode. Pre-stained molecular markers were electrophoresed in the second dimension and served as a reference point for comparison of the different gels. For the dephosphorylation assays, total protein extracts were dialyzed against 10 mm Tris-HCl (pH 7.5), 10 mmMgCl2, 50 mm potassium acetate, and 4 mm PMSF and treated with 4 units of alkaline phosphatase (Amersham Pharmacia Biotech) for 2 h at 37 °C. After phosphatase treatment, the proteins were dialyzed against 40 mm Tris-HCl (pH 7.5) and 1 mm PMSF, concentrated by freeze-drying, and resuspended in lysis buffer. The integrity of the proteins was monitored by SDS-PAGE. Total RNA from cells was extracted as described (35.$$$$$$ ref data missingGoogle Scholar) or using an RNAeasy kit (Qiagen). The RNA was treated with 2 units of RNase-free DNase (Promega) in 20 mm Tris-HCl (pH 8.4), 50 mm KCl, and 2 mm MgCl2 at 37 °C for 1 h and recovered by ethanol precipitation. First-strand cDNA was synthesized from 2–5 μg of total RNA using the SuperScript II Kit (Life Technologies, Inc.) according to the manufacturer's instructions. PCR assays were performed withsoyBiPA-, soyBiPB-, soyBiPC- (25.Kalinski A. Rowley D.L. Loer D.S. Foley C. Buta G. Herman E.M. Planta. 1995; 195: 611-621Crossref PubMed Scopus (68) Google Scholar), orsoyBiPD- (28.Figueiredo J.E.F. Cascardo J.C.M. Carolino S.M.B. Alvim F. Fontes E.P.B. Rev. Bras. Fisiol. Veg. 1997; 9: 103-110Google Scholar) specific primers (Table I). A typical reaction consisted of 2 μl of the reverse transcription reaction, 200 μm each dNTP, 100 nm each sense and antisense gene-specific primers, 1 × PCR buffer (10 mm Tris-HCl (pH 8.3), 50 mm KCl, 2.5 mm MgCl2), and 1 unit of Taq DNA polymerase (Life Technologies, Inc.) in a total volume of 30 μl. The presence of contaminating DNA was assessed in control reactions conducted without reverse transcriptase. The reactions were performed for 35 cycles (30 s at 94 °C, 30 s at 52 °C, and 1 min at 72 °C), with a final extension at 72 °C for 10 min. For RNA abundance assays, the number of cycles was reduced to 25. The reaction products were separated by electrophoresis on 1% agarose, Tris borate-EDTA gels and visualized with ethidium bromide-staining under UV transillumination.Table IGene-specific primersPrimerSequenceAnnealing sequenceAnnealing position (cognate cDNA)BiPABiPBBiPCBiPD% identityBiPAFCGAGCTCTAGAGATGTTGTTGCTT10046.2ND41.72044BiPARTACGTAGACGGCTGTAGTTCC1000ND02317BiPBFTGAGCTCTAGTTAGTCGGAGTCTG45.8100ND58.32080BiPBRCGATCGGCACGAGGAAGTTG40100ND452259BiPCFCGAGCGCACCTTCAACTTAACC22.727.3100912BiPCRCAACATGGCCATTCTTGTAAACACCG924610092260BiPDFATCTGGAGGAGCCCTAGGCGGTGG62.9100ND1001966BiPDRCTTGAAGAAGCTTCGTCGTAAAACTAAG4470ND1002184The annealing position corresponds to the nucleotide position in the cognate cDNA in which the 5′ nucleotide of the primer sequence anneals. The numbering scheme was taken considering the first nucleotide of the BiP cDNA sequence in the GenBank™ as the nucleotide +1. F and R following the name of the primers refer to forward and reverse, respectively. ND, not determined. Open table in a new tab The annealing position corresponds to the nucleotide position in the cognate cDNA in which the 5′ nucleotide of the primer sequence anneals. The numbering scheme was taken considering the first nucleotide of the BiP cDNA sequence in the GenBank™ as the nucleotide +1. F and R following the name of the primers refer to forward and reverse, respectively. ND, not determined. PCR assays were also carried out with soybean Actin 3 gene-specific primers (GenBank™ accession number J01297) to assess the quantity and quality of the cDNA. The upstream primer 5′-cccctcaacccaaaggtcaacag-3′ (coordinates 614 to 636) and the downstream primer 5′-ggaatctctctgccccaattgtg-3′ (positions 2011 to 2024) amplify a 440-bp fragment from the actin 3 cDNA and a 520-bp fragment, including an 81-bp intron, from genomic DNA. RNA for gel blot analysis was isolated from control, tunicamycin, and water-stressed cells as described (35.$$$$$$ ref data missingGoogle Scholar). Equal amounts of total RNA were denatured by formamide/formaldehyde and resolved on 1% agarose gels containing formaldehyde (36.Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). The RNA was transferred to a nylon membrane by capillary transfer and immobilized by UV cross-linking (Stratalinker, Stratagene). The membrane was hybridized at high stringency conditions (18.Fontes E.P.B. Shank B.B. Wrobel R.L. Moose S.P. O'Brian G.R. Wurtzel E.T. Boston R.S. Plant Cell. 1991; 3: 483-496Crossref PubMed Scopus (163) Google Scholar) using thesoyBiPD or soyBiPA cDNA as probes. The hybridization probe was radiolabeled with [α-32P]dCTP by random primed labeling (Amersham Pharmacia Biotech). Autoradiography was performed at −80 °C using a Lightning-Plus intensifying screen (Sigma). The amount of RNA and the integrity of ribosomal RNA were monitored by rehybridizing the membranes with a pea 18 S rDNA probe. All of the procedures were conducted at 4 °C. Protein extracts were prepared by homogenization of water-stressed leaves with 50 mm Tris-HCl (pH 7.5), 100 mm NaCl, 0.5% (v/v) Triton X-100, 1 mm PMSF, and 2 units/ml apyrase or 2 mm ATP at a ratio of 1 g of the tissue/2 ml of extraction buffer. After incubation of the protein extracts for 10 min, cell debris was removed by centrifugation at 13,000 × g for 15 min. Immunoprecipitations were performed as described (37.Li X. Su R.T.C. Hsu H. Sze H. Plant Cell. 1998; 10: 119-130Crossref PubMed Scopus (151) Google Scholar) with some modifications. Protein extracts (1 ml) were precleared by incubating with 100 μl of 50% (v/v) protein A-Sepharose (Amersham Pharmacia Biotech) and goat anti-rabbit IgG-agarose (Sigma) suspensions in 20 mm Tris-HCl (pH 7.5), 140 mm NaCl for 1 h. After incubation, proteins that bound nonspecifically to protein A or anti-IgG were removed by centrifugation. The precleared supernatant was then incubated with 100 μl of anti-BiP-carboxy antibodies (28.Figueiredo J.E.F. Cascardo J.C.M. Carolino S.M.B. Alvim F. Fontes E.P.B. Rev. Bras. Fisiol. Veg. 1997; 9: 103-110Google Scholar) for 2 h under agitation at 4 °C, followed by incubation with 30 μl of 50% (v/v) protein A-Sepharose and anti-IgG-Sepharose suspensions for 4 h. The immunocomplexes were recovered by centrifugation at 8,000 × g for 5 min. Pelleted Sepharose beads were washed extensively with 1 ml of 50 mmTris-HCl (pH 7.5), 100 mm NaCl, 1% (v/v) Triton X-100, and 1 mm PMSF and resuspended in 40 μl of SDS-PAGE sample buffer (34.Laemmli U. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). Immunoprecipitated proteins were analyzed by immunoblotting using a chicken anti-WSBiP antibody and a rabbit anti-chicken IgG alkaline phosphatase conjugate (Sigma). The chicken anti-WSBiP antibody was raised against a BiP fraction that was purified from water-stressed leaves essentially as described (18.Fontes E.P.B. Shank B.B. Wrobel R.L. Moose S.P. O'Brian G.R. Wurtzel E.T. Boston R.S. Plant Cell. 1991; 3: 483-496Crossref PubMed Scopus (163) Google Scholar), except that the ATP-agarose affinity chromatography was replaced by an immunoaffinity batch step using an anti-BiP antibody (28.Figueiredo J.E.F. Cascardo J.C.M. Carolino S.M.B. Alvim F. Fontes E.P.B. Rev. Bras. Fisiol. Veg. 1997; 9: 103-110Google Scholar) cross-linked to protein A-Sepharose beads (Amersham Pharmacia Biotech). About 50 μg of BiP preparations from water-stressed leaves were emulsified with complete Freund's adjuvant and injected subcutaneously under the wing of a chicken. For subsequent injections at 14-day intervals, incomplete Freund's adjuvant was used. After the third injection, eggs were collected daily, and the anti-WSBiP antibody was purified from egg yolk as described (38.Carroll S.B. Stollar B.D. J. Biol. Chem. 1983; 258: 24-26Abstract Full Text PDF PubMed Google Scholar, 39.Polson A. Coetzer T. Kruger J. von Maltzahn E. van der Merve K.J. Immunol. Invest. 1985; 14: 323-327Crossref PubMed Scopus (184) Google Scholar). For microsomal membrane isolation, normal and water-stressed leaves were homogenized with 25 mm Tris-HCl (pH 7.0), 250 mm sucrose, 2.5 mm dithiothreitol, 10 mm MgSO4, 0.5% (w/v) gelatin, and 0.5 mm PMSF (40.Ripp K.G. Viitanen P.V. Hitz W.D. Franceschi V.R. Plant Physiol. (Rockv). 1988; 88: 1435-1445Crossref PubMed Google Scholar). The homogenate was filtered and centrifuged at 13,000 × g for 15 min at 4 °C. Microsomal preparations were isolated by centrifugation at 80,000 ×g for 45 min (37.Li X. Su R.T.C. Hsu H. Sze H. Plant Cell. 1998; 10: 119-130Crossref PubMed Scopus (151) Google Scholar) and subsequently by density gradient centrifugation (41.Chrispeels M.J. Planta. 1983; 158: 140-151Crossref PubMed Scopus (128) Google Scholar, 42.Helm K.W. Lafayette P.R. Nagao R.T. Key J.L. Vierling E. Mol. Cell. Biol. 1993; 13: 238-247Crossref PubMed Scopus (78) Google Scholar, 43.Koizumi N. Ujino T. Sano H. Chrispeels M.J. Plant Physiol. (Rockv). 1999; 121: 353-361Crossref PubMed Scopus (76) Google Scholar). Previously we showed that soybean BiP is induced by water stress (28.Figueiredo J.E.F. Cascardo J.C.M. Carolino S.M.B. Alvim F. Fontes E.P.B. Rev. Bras. Fisiol. Veg. 1997; 9: 103-110Google Scholar). In water-stressed leaves, BiP synthesis is up-regulated to the same extent as in nutritionally stressed leaves and in pathogen-infected leaves. However, the synthesis of spinach BiP, which is a product of a single gene, is unaffected by water stress (13.Anderson J.V. Li Q.B. Haskell D.W. Guy C.L. Plant Physiol. (Rockv). 1994; 104 (1370): 1395Google Scholar). In fact, in spinach, water stress resulted in disappearance of the BiP mRNA, although the level of protein remained unaltered. To characterize the water stress regulation of the soybean BiP family, we examined the BiP isoforms in control (relative water content 85%) and in water-stressed (relative water content 50%) soybean leaves by immunoblotting assays of two-dimensional gels (Fig. 1). The pI range of the BiP species detected in water-stressed leaves was more acidic than that of the BiP isoforms from control leaves (compare Fig.1, B and A). To identify whether water stress resulted in the appearance of phosphorylated BiP isoforms or caused the induction of more acidic, distinct BiP species, the leaf protein extract was treated with phosphatase before electrophoresis (Fig.1 C). Dephosphorylation of BiP caused a shift in the isoelectric focusing migrations of the water-stressed-induced forms (pI 5.4–5.8) toward a less acidic pI cluster (pI 6.1–6.25) and a single acidic species, pI 6.5 (Fig. 1, B and C). The effectiveness of the alkaline phosphatase treatment was confirmed by complete removal of radiolabeled phosphate incorporated into the protein (data not shown). These results indicated that water stress stimulated phosphorylation of the induced BiP species. Although our result may suggest that phosphorylation of BiP is part of the ER stress response in plants, it would be in marked contrast with the stress-mediated dephosphorylation of mammalian BiP by tunicamycin treatment of cultured cells (11.Hendershot L.M. Ting J. Lee A. J. Mol. Cell. Biol. 1988; 8: 4250-4256Crossref Scopus (162) Google Scholar). To directly compare the induction and phosphorylation state of the water stress- and tunicamycin-induced BiP forms of soybean, we used cultured soybean cells treated with either 10% (w/v) PEG or tunicamycin. After the treatments, the cells were immediately frozen in liquid nitrogen, and whole cell protein extracts were displayed in two-dimensional gels and immunoblotted with an anti-BiP serum (Fig. 2). Apparently all the BiP forms were induced upon treatment of suspension cells with tunicamycin, because the cross-reactive induced proteins were resolved in several isoelectric states ranging from pI 5.8 to 6.5 (compare Fig.2, A and C, Bs and In). In contrast, treatment of the cells with PEG promoted the induction of a subset of BiP forms, which were resolved in a more acidic isoelectric focusing position cluster, pI 5.4–5.7 (Fig. 2 E,Ac). The relative differences in the isoelectric focusing migrations between the water stress- and tunicamycin-induced forms prompted us to examine whether their phosphorylation state changed following stress conditions. In untreated control cells (Fig. 2 A), BiP occurred in several isoelectric states that resolved as an acidic cluster (3–4 forms, pI 5.8–6.1, In) and a more basic species, pI 6.5 (Bs). The acidic cluster represents different phosphorylated forms of the same protein because dephosphorylation assays caused their co-migration as a less acidic single species (compare BiP forms under In in Fig. 2,A and B). In contrast, phosphatase treatment of the samples did not cause a shift in the isoel
Referência(s)