Portal de Periódicos da CAPES

T Cell Receptor-γ Gene Analysis of CD30+ Large Atypical Individual Cells in CD30+ Large Primary Cutaneous T Cell Lymphomas

2003; Elsevier BV; Volume: 120; Issue: 4 Linguagem: Inglês

10.1046/j.1523-1747.2003.12101.x

1523-1747

Sylke Gellrich, Anke Wilks, Ansgar Lukowsky, Martin Wernicke, Astrid Müller, J. Marcus Muche, Tanja Fischer, Kim Christian Jasch, Heike Audring, Wolfram Sterry,

CAR-T cell therapy research

The hallmark of primary cutaneous CD30+ large T cell lymphoma are large lymphoid tumor cells, at least 75% of which, by definition, must be positive for CD30. The relatively benign clinical course of this lymphoma type has been explained with CD30-induced apoptosis, on the assumption that expression of CD30 defines the tumor clone; however, this hypothesis has not been tested on the molecular level to date. In this study we analyzed CD30+ cells in four patients with primary cutaneous CD30+ large T cell lymphoma by single cell polymerase chain reaction of T cell receptor-γ genes followed by sequencing. Here, we demonstrate that most of the large CD30+ atypical cells possessed identical T cell receptor-γ gene rearrangements, indicative of clonal proliferation. Nevertheless, polyclonally rearranged T cells were present in all CD30+ samples studied. In addition, one patient showed a second clone in a separate biopsy and three of four patients showed chromosomal imbalances as revealed by comparative genomic hybridization. Taken together, our data suggest that the CD30+ population in primary cutaneous CD30+ large T cell lymphoma indeed contains the tumor clone, thus providing molecular support for a link between clinical course and CD30-related signaling. Importantly, however, CD30 expression does not define the tumor clone as bystander T cells, as well as occasional additional clones, are also present in this population. The hallmark of primary cutaneous CD30+ large T cell lymphoma are large lymphoid tumor cells, at least 75% of which, by definition, must be positive for CD30. The relatively benign clinical course of this lymphoma type has been explained with CD30-induced apoptosis, on the assumption that expression of CD30 defines the tumor clone; however, this hypothesis has not been tested on the molecular level to date. In this study we analyzed CD30+ cells in four patients with primary cutaneous CD30+ large T cell lymphoma by single cell polymerase chain reaction of T cell receptor-γ genes followed by sequencing. Here, we demonstrate that most of the large CD30+ atypical cells possessed identical T cell receptor-γ gene rearrangements, indicative of clonal proliferation. Nevertheless, polyclonally rearranged T cells were present in all CD30+ samples studied. In addition, one patient showed a second clone in a separate biopsy and three of four patients showed chromosomal imbalances as revealed by comparative genomic hybridization. Taken together, our data suggest that the CD30+ population in primary cutaneous CD30+ large T cell lymphoma indeed contains the tumor clone, thus providing molecular support for a link between clinical course and CD30-related signaling. Importantly, however, CD30 expression does not define the tumor clone as bystander T cells, as well as occasional additional clones, are also present in this population. primary cutaneous T cell lymphoma CD30-positive large primary cutaneous T cell lymphoma fluorescent fragment analysis CD30 expression represents a diagnostic parameter in several lymphoproliferative disorders. A cytokine receptor of the tumor necrosis factor receptor superfamily, CD30 is mainly restricted to the large cell variants of non-Hodgkin lymphoma, including the primary cutaneous T cell lymphomas (pCTCL), as well as Reed–Sternberg cells in Hodgkin's disease (Schwab et al., 1982Schwab U. Stein H. Gerdes J. et al.Production of a monoclonal antibody specific for Hodgkin and Sternberg-Reed cells of Hodgkin's disease and a subset of normal lymphoid cells.Nature. 1982; 299: 65-67Crossref PubMed Scopus (709) Google Scholar;Stein et al., 1985Stein H. Mason D.Y. Gerdes J. et al.The expression of the Hodgkin's disease associated antigen Ki-1 in reactive and neoplastic lymphoid tissue: Evidence that Reed-Sternberg cells and histiocytic malignancies are derived from activated lymphoid cells.Blood. 1985; 66: 848-858Crossref PubMed Google Scholar;Smith et al., 1993Smith C.A. Gruss H.J. Davis T. et al.CD30 antigen, a marker for Hodgkin's lymphoma, is a receptor whose ligand defines an emerging family of cytokines with homology to TNF.Cell. 1993; 73: 1349-1360Abstract Full Text PDF PubMed Scopus (500) Google Scholar;Willemze and Beljaards, 1993Willemze R. Beljaards R.C. Spectrum of primary cutaneous CD30 (Ki-1)-positive lymphoproliferative disorders. A proposal for classification and guidelines for management and treatment.J Am Acad Dermatol. 1993; 28: 973-980Abstract Full Text PDF PubMed Scopus (309) Google Scholar;Falini et al., 1995Falini B. Pileri S. Pizzolo G. et al.CD30 (Ki-1) molecule: A new cytokine receptor of the tumor necrosis factor receptor superfamily as a tool for diagnosis and immunotherapy.Blood. 1995; 85: 1-14Crossref PubMed Google Scholar;Gruss et al., 1996Gruss H.J. Duyster J. Herrmann F. Structural and biological features of the TNF receptor and TNF ligand superfamilies: Interactive signals in the pathobiology of Hodgkin's disease.Ann Oncol. 1996; 7: 19-26Crossref PubMed Scopus (46) Google Scholar;Willemze et al., 1997Willemze R. Kerl H. Sterry W. et al.EORTC classification for primary cutaneous lymphomas: A proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer.Blood. 1997; 90: 354-371PubMed Google Scholar;Bekkenk et al., 2000Bekkenk M.W. Geelen F.A. van-Voorst-Vader P.C. et al.Primary and secondary cutaneous CD30(+) lymphoproliferative disorders: A report from the Dutch Cutaneous Lymphoma Group on the long-term follow-up data of 219 patients and guidelines for diagnosis and treatment.Blood. 2000; 95: 3653-3661PubMed Google Scholar;Willemze and Meijer, 2000Willemze R. Meijer C.J. EORTC classification for primary cutaneous lymphomas: a comparison with the R.E.A.L. Classification and the proposed WHO Classification.Ann Oncol. 2000; 11: 11-15Crossref PubMed Scopus (30) Google Scholar). Predominant CD30 expression indicates a favorable prognosis in pCTCL (Willemze and Beljaards, 1993Willemze R. Beljaards R.C. Spectrum of primary cutaneous CD30 (Ki-1)-positive lymphoproliferative disorders. A proposal for classification and guidelines for management and treatment.J Am Acad Dermatol. 1993; 28: 973-980Abstract Full Text PDF PubMed Scopus (309) Google Scholar,Willemze et al., 1997Willemze R. Kerl H. Sterry W. et al.EORTC classification for primary cutaneous lymphomas: A proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer.Blood. 1997; 90: 354-371PubMed Google Scholar;Bekkenk et al., 2000Bekkenk M.W. Geelen F.A. van-Voorst-Vader P.C. et al.Primary and secondary cutaneous CD30(+) lymphoproliferative disorders: A report from the Dutch Cutaneous Lymphoma Group on the long-term follow-up data of 219 patients and guidelines for diagnosis and treatment.Blood. 2000; 95: 3653-3661PubMed Google Scholar), in contrast to Hodgkin's disease and nodal CD30+ anaplastic large cell lymphoma (Tilly et al., 1997Tilly H. Gaulard P. Lepage E. et al.Primary anaplastic large-cell lymphoma in adults: Clinical presentation, immunophenotype, and outcome.Blood. 1997; 90: 3727-3734PubMed Google Scholar;Falini et al., 1999Falini B. Pileri S. Zinzani P.L. et al.ALK+ lymphoma. Clinico-pathological findings and outcome.Blood. 1999; 93: 2697-2706PubMed Google Scholar). Primary cutaneous CD30+ large T cell lymphomas (CD30+ large pCTCL) form a distinct entity within the European Organization for Research and Treatment of Cancer classification of primary cutaneous lymphomas. Although histologically pCTCL is subdivided into anaplastic (80%) and pleomorphic or immunoblastic (20%) subtypes, all types show an identical clinical presentation with nodules and tumors (Willemze and Beljaards, 1993Willemze R. Beljaards R.C. Spectrum of primary cutaneous CD30 (Ki-1)-positive lymphoproliferative disorders. A proposal for classification and guidelines for management and treatment.J Am Acad Dermatol. 1993; 28: 973-980Abstract Full Text PDF PubMed Scopus (309) Google Scholar;Willemze et al., 1997Willemze R. Kerl H. Sterry W. et al.EORTC classification for primary cutaneous lymphomas: A proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer.Blood. 1997; 90: 354-371PubMed Google Scholar;Bekkenk et al., 2000Bekkenk M.W. Geelen F.A. van-Voorst-Vader P.C. et al.Primary and secondary cutaneous CD30(+) lymphoproliferative disorders: A report from the Dutch Cutaneous Lymphoma Group on the long-term follow-up data of 219 patients and guidelines for diagnosis and treatment.Blood. 2000; 95: 3653-3661PubMed Google Scholar). Lymphoma cells show a nodular distribution within the dermis and subcutis but not the epidermis, typically featuring round, oval, or irregularly shaped nuclei, prominent nucleoli, and abundant cytoplasm. The large CD30+ cells are CD4+ with varying loss of pan-T cell antigens (CD2, CD3, CD5). By definition CD30 is expressed on more than 75% of morphologically atypical cells. Because of these features and clonal T cell receptor (TCR)-γ rearrangement present in bulk lymphoma DNA it is generally assumed that the large atypical CD30+ cells represent the tumor cell population (Willemze and Beljaards, 1993Willemze R. Beljaards R.C. Spectrum of primary cutaneous CD30 (Ki-1)-positive lymphoproliferative disorders. A proposal for classification and guidelines for management and treatment.J Am Acad Dermatol. 1993; 28: 973-980Abstract Full Text PDF PubMed Scopus (309) Google Scholar;Willemze et al., 1997Willemze R. Kerl H. Sterry W. et al.EORTC classification for primary cutaneous lymphomas: A proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer.Blood. 1997; 90: 354-371PubMed Google Scholar;Bekkenk et al., 2000Bekkenk M.W. Geelen F.A. van-Voorst-Vader P.C. et al.Primary and secondary cutaneous CD30(+) lymphoproliferative disorders: A report from the Dutch Cutaneous Lymphoma Group on the long-term follow-up data of 219 patients and guidelines for diagnosis and treatment.Blood. 2000; 95: 3653-3661PubMed Google Scholar). To date, however, there exist no molecular data supporting this assumption. Therefore, we investigated TCR-γ rearrangements of single cells found within the CD30+ cell population of pCTCL. A 36 y old male initially developed a single erythematous nodule on the left lower leg. After ruling out systemic disease (using chest X-ray and ultrasound of abdomen and lymph nodes as well as bone marrow biopsy), CD30+ large pCTCL was diagnosed. Various treatment modalities, including excision, radiotherapy, acitretin, interferon α, and chemotherapy with methotrexate and CHOP (Cyclophosphamide, Hydroxydaunomycin, Oncovin, and Prednisone) did not induce complete remission (Fig 1IA). Three years after the occurrence of the first skin lesion the patient died of cerebral metastases and multiple skin involvement. Biopsies from the initial lesion showed a CD30+ large pCTCL infiltrating the entire dermis down to the subcutaneous fatty tissue. Atypical cells appeared as medium- to large-sized cells with a CD3–, CD4+, CD30+ phenotype and a mitotic rate of about 70% (Fig 1IB,IC). Molecular biologic investigation of blood and skin samples revealed a monoclonal TCR-γ gene rearrangement via polymerase chain reaction (PCR) from bulk DNA and following fluorescent fragment analysis (FFA). For single cell PCR, CD30+ cells were dissected from the dermal infiltrate as described below. A 75 y old male with a CD30+ large pCTCL presented with a single erythematous nodule on the left elbow without extracutaneous involvement as documented by chest X-ray, ultrasound of the abdomen and peripheral lymph nodes and computed tomography of the chest and abdomen. Excision and postexcisional radiotherapy induced complete remission of about 15 mo duration. Thereafter, new lesions developed on the left hand and lower arm (Fig 1IIA), which were excised. Eight months later this patient is alive in partial remission. Biopsy from the initial lesion showed a CD30+ large pCTCL infiltrating the whole dermis. Atypical cells were medium sized to large sized with a CD3–, CD4+, CD30+ phenotype and a mitotic rate of almost 100% (Fig 1IIB, IIC). Monoclonal TCR-γ rearrangements were detected in blood samples as well as skin samples by PCR from bulk DNA followed by FFA. For single cell PCR, CD30+ cells were dissected from the dermal infiltrate as described below. A 62 y old female with a CD30+ large pCTCL presented with multiple erythematous papules on the left upper leg (Fig 1IIIA). The patient was treated with so-called mimotope vaccination therapy (two nonapeptides mimicking unknown tumor antigens) for a total of 10mo (Linnemann et al., 2000Linnemann T. Wiesmuller K.H. Gellrich S. et al.A T-cell epitope determined with random peptide libraries and combinatorial peptide chemistry stimulates T cells specific for cutaneous T-cell lymphoma.Ann Oncol. 2000; 11: 95-99Abstract Full Text PDF PubMed Scopus (11) Google Scholar,Linnemann et al., 2001Linnemann T. Tumenjargal S. Gellrich S. et al.Mimotopes for tumor-specific T lymphocytes in human cancer determined with combinatorial peptide libraries.Eur J Immunol. 2001; 31: 156-165Crossref PubMed Scopus (45) Google Scholar). After 2 mo of treatment complete remission was achieved. Relapse occurred after an additional 3 mo, and the vaccination therapy was continued leading to a second complete remission 3 mo later. A second, very aggressive relapse of skin lesions, as well as tumor involvement of the bone marrow and lymph nodes, occurred 10 mo after the beginning of therapy. For that reason, vaccination therapy was discontinued. The patient was treated with CHOP chemotherapy and died 19 mo after occurrence of the first skin lesions. Biopsy of the initial lesion showed an infiltrate extending through the whole dermis up to the subcutaneous fatty tissue. Morphologically, T cells were medium-sized cells with a CD3+, CD4+, CD30+ phenotype and a mitotic rate of about 10%. A T cell population with a monoclonal TCR-γ rearrangement was detected in all blood and skin samples. A medium-sized pleomorphic T cell lymphoma with CD30 expression was diagnosed. Subsequent lesions showed large CD30+ tumor cells with aberrant phenotypes. For single cell PCR, CD30+ cells were dissected from the dermis of two separate skin biopsies and from one blood sample: This skin biopsy was taken from a papule developing during the first relapse after mimotope vaccination. Its histologic and morphologic features were identical to pretreatment biopsies (Fig 1IIIB, IIIC). A second nodule was excised after 10 mo of mimotope vaccination, during an aggressive relapse and showed an infiltrate of the whole dermis reaching the subcutaneous fatty tissue. T cells were large cells with a loss of CD3 and CD4 expression (CD3–, CD4–, CD30+ phenotype) and a mitotic rate of 90–100%. Analysis of blood skin samples by PCR from bulk DNA followed by FFA revealed a T cell population with a biallelic TCR-γ rearrangement in the Vg2 primer set. Disease progression into a CD30+ anaplastic large T cell lymphoma was diagnosed. Because of leukemic manifestation of T cell lymphoma, we also dissected single large CD30+ blood lymphocytes from a cytospin slide to compare TCR-γ genes of these cells with cells from skin biopsies (IIIa,b). The leukemic cells exhibited the same phenotype as those described in biopsy IIIb. A 24 y old male presented with plaques on the right lower arm and wrist. By histology, the diagnostic criteria of CD30+ large pCTCL were met (see below); there was no evidence of systemic disease (by X-ray, ultrasound of abdomen and lymph nodes) (Fig 1IVA). Treatment with local electron beam irradiation of the right lower arm induced complete remission, lasting 3 mo at the time of writing. Skin specimen, analyzed by single cell PCR, showed a subepidermal CD30+ atypical T cells with a proliferation rate of 50% (Fig 1IVB,IVC). Almost all CD30+ large atypical cells were CD3– and CD4–. Routine molecular biologic investigation (FFA–TCR-γ) revealed clonal TCR rearrangements in skin biopsy and a polyclonal PCR product in blood. All human studies were performed in accordance to the Declaration of Helsinki Principles. The skin biopsies were snap frozen in liquid nitrogen and stored at –80°C. Frozen skin sections (10 μm thick) were stained with monoclonal mouse anti-CD30 (DAKO, Glostrup, Denmark) using biotinylated Fab anti-mouse followed by streptavidin-peroxidase conjugated complexes (LSAB-Kit 2: DAKO, Hamburg, Germany) and hydrogen peroxidase–chromogen (AEC Substrate System: DAKO, Hamburg, Germany) as developing reagents. Subsequently, counterstaining with hematoxylin was performed. CD30+ cells were dissected microscopically (Nikon, Düsseldorf, Germany) by means of a hydraulic micromanipulator (Narishige, Düsseldorf, Germany). Thereafter, single cells were aspirated into a micropipette (Narishige), placed into 20 μl PCR buffer supplemented with 1 ng rRNA per μl (both from Boehringer, Mannheim, Germany), and stored at –20°C. Photographs were taken before and after micromanipulation of each cell. In the case of patient III CD30+ blood cells were investigated in addition to the skin samples. Peripheral blood mononuclear cells were prepared from 10 ml heparinized blood (sample IIIc) by density gradient centrifugation using Ficoll Hypaque (Pharmacia, Freiburg, Germany). Peripheral blood mononuclear cells were cytospun on slides. Immunohistologic staining and micromanipulation of single CD30-positive cells was subsequently performed as described above. Initially, cells were incubated with 0.25 μg per ml Proteinase K (Boehringer) for 50 min at 55°C and for an additional 10 min at 95°C (enzyme inactivation). Rearranged TCR-γ genes were amplified by a seminested PCR with primers Vg1 (5′CTACATCC-ACTGGTACCT 3′), recognizing Vg1–Vg8 gene families (Volkenandt et al., 1993Volkenandt M. Burmer G.C. Schadendorf D. et al.The polymerase chain reaction. Method and applications in dermatopathology.Am J Dermatopathol. 1993; 15: 118-126Crossref PubMed Scopus (13) Google Scholar), Vg9ext (ATTGGTATCGAGAGAGAC), Vg10/11ext (CACTGGTACKKGCAGAAAC) (Muche et al., 1997Muche J.M. Lukowsky A. Asadullah K. et al.Demonstration of frequent occurrence of clonal T cells in the peripheral blood of patients with cutaneous T-cell lymphoma.Blood. 1997; 90: 1636-1642PubMed Google Scholar), and Jg1/2 (5′CAACAAGTGTTGTTCCAC 3′) in the first round, and with Vgseq (5′AGRCCCCACAGCRTCTTC 3′), recognizing Vg1–Vg8 gene families, Vg9int (GGAAAGGAATCTGGCATTCCG), Vg10 (AATCCGCAGCTCGACGCAGCA), and Vg11 (GCTCAAGATTGCTCAGGTGGG) (Trainor et al., 1991Trainor K.J. Brisco M.J. Wan J.H. et al.Gene rearrangement in B- and T-lymphoproliferative disease detected by the polymerase chain reaction.Blood. 1991; 78: 192-196PubMed Google Scholar) in the second round. The reaction mix (50 μl) for the first round of amplification consisted of 1×PCR buffer (Boehringer), 2.5 mM MgCl2 (Boehringer), 200 μM of each nucleotide (deoxyadenosine triphosphate, deoxythymidine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate) (AGS, Heidelberg, Germany), 7 nM of each primer, and 3.5 U Expand high fidelity Taq-Polymerase (Boehringer). PCR amplification was carried out on a Personal Cycler (Biometra, Göttingen, Germany): one cycle at 95°C for 2 min, 65°C for 1 min (addition of Taq-Polymerase), and 72°C for 1 min, followed by 35 cycles at 95°C for 1 min, 58°C for 1 min and 72°C for 1 min, and a final extension at 72°C for 5 min. The second round of PCR was carried out using 1 μl of the PCR product from the first round. Reaction mixture: 1×PCR buffer (Boehringer), 2.5 mM MgCl2 (Boehringer), 200 μl of each nucleotide (deoxyadenosine triphosphate, deoxythymidine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate) (AGS), 7 nM of each primer and 1 U Taq-polymerase (Boehringer). The second round cycle program was carried out on a Trio-Thermoblock (Biometra) and consisted of one cycle at 95°C for 2 min, 68°C for 5 min (addition of Taq-Polymerase), and at 72°C for 1 min, 45 cycles at 95°C for 1 min, at 58°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 5 min. A 5 μl aliquot of the reaction mixture was analyzed on a 2% agarose gel for successful amplification. In order to avoid contamination with DNA, micromanipulation, first and second round of PCR were carried out separately in three different rooms. Every 10 tubes one tube without cells was inserted as negative control, failing to show any products. PCR products were purified using the Gel DNA Extraction Kit (Boehringer) followed by direct sequencing with 5 μl Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Weiterstadt, Germany) on the automated DNA Sequencing System ABI 373A (Perkin Elmer Applied Biosystems, Weiterstadt, Germany) using 30 ng purified PCR product and 5 μM Vgseq, Vg9, Vg10, and Vg11 primer. Sequence evaluation was done using Sequence Navigator® software (Perkin Elmer Applied Biosystems). DNA sequences were analyzed online using DNA BLOT® software (created by H.H. Althaus) and compared with the EMBL gene bank data (Heidelberg, Germany) for known TCR-γ genes. In total, 257 single CD30+ cells were analyzed. Two hundred and thirty were localized in the dermis or in the subcutaneous fatty tissue. Twenty-seven CD30+ cells were isolated from a cytospin sample of peripheral blood lymphocytes. DNA could be amplified and sequenced in 137 of 257 isolated single CD30+ cells, what represents a method relevant efficacy (Küppers et al., 1995Küppers R. Hansmann M.L. Rajewsky K. Micromanipulation and PCR analysis of single cell from tissue sections.in: Weir D.M. Blackwell C. Herzberg L.A. Handbook of Experimental Immunology. 5th edn. Blackwell Science, Cambridge, MA1995Google Scholar). Primers Vg1 and Vg2 (V9, V10/11) or Jg1/2 were 5′-labeled with 5-carboxy-fluorescein (FAM). Labeled PCR products or product mixtures were subjected to FFA on the ABI 310 PRISM (capillary; PE Applied Biosystems) or, as indicated, on the ABI 373A (polyacrylamide gel electrophoresis) sequencers (PE Applied Biosystems). For FFA on the ABI 310 PRISM, 12 μl deionized formamide and 0,5 μl Genescan 500TM ROX internal lane standard (PE Applied Biosystems) were added to 1 μl of the PCR amplification, denatured at 90°C for 2 min and chilled on ice to produce single stranded DNA. Each run was performed at 60°C and 15 kV with a 5 s injection and 36 min separation time in a 47 cm POP 6-filled capillary (PE Applied Biosystems). For analysis on the ABI 373A, 5 μl deionized formamide, 0.5 μl ethylenediamine tetraacetic acid, 0.5 μl GeneScan 2500TM ROX internal lane standard (PE Applied Biosystems) and 0.5 μl dextran blue were added to 2 μl of the labeled PCR product, denatured as described above and loaded on to a 4.75% polyacrylamide gel (LC 6 premixed gel, FMC Bioproducts, Rockland MD). The runs of both sequencers were analyzed using the “GeneScan 372” software (PE Applied Biosystems). Lesional skin samples of all four patients were investigated for chromosomal aberrations (Table I) as described byTonnies et al., 2001Tonnies H. Stumm M. Wegner R.D. et al.Comparative genomic hybridization based strategy for the analysis of different chromosome imbalances detected in conventional cytogenetic diagnostics.Cytogenet Cell Genet. 2001; 93: 188-194Crossref PubMed Scopus (37) Google Scholar.Table IResults of micromanipulation and single cell PCR for TCR-γ chain gene rearrangement in CD30+ large pCTCL and CGHPatientCompartmentCGH resultsCell size of CD30+ cellsNo. of isolated cellsClonal/total sequencesPolyclonal/total sequencesIDermis subcutaneous fatTrisomy 7Medium-sized to large5027/33(81.8%)6/33(18.2%)IIDermisTrisomy 7Medium-sized to large4522/27(81.5%)5/27(18.5%)IIIaDermisNo materialMedium-sized364/22(18.2%)13/22(59.1%)(5/22aIn skin biopsy IIIa identical rearrangements were found in five of 22 cells that do not belong to the tumor cell population)(22.7%)IIIbDermis subcutaneous fatPartial deletion 7q trisomy 14large5417/23(74%)6/23(26%)IIIcBloodNo materiallarge2711/14(78.6%)3/14(21.4%)IVDermisNo aberrationlarge4513/18(72.2%)5/18(27.8%)a In skin biopsy IIIa identical rearrangements were found in five of 22 cells that do not belong to the tumor cell population Open table in a new tab Large, atypical CD30+ cells of four patients with CD30+ large pCTCL were examined by single cell PCR analysis followed by sequencing of the TCR-γ chain genes (Table I). The majority of dermal CD30+ cells displayed identical individual TCR-γ genes in all patients (patient I: 81.8%; patient II: 81.5%; patient III: biopsy IIIb 74.0%, blood IIIc 78.6%; patient IV: 78.2%). The only exception was skin sample IIIa of patient III containing only a minority of cells with an identical TCR-γ rearrangement (patient III: biopsy IIIa 18.2%). For details see Table I. Two different clonal TCR-γ chain genes could be amplified from several cells of patients I–IV. Therefore, both TCR-γ genes can be assigned to a biallelic, clonal (malignant) T cell population (Table II); however, the remainder of CD30+ T cells analyzed in this investigation was polyclonal (sequences not shown). In 18 of 38 of these polyclonal cells in all investigated specimens, both TCR-γ chain genes could be amplified and sequenced successfully. Morphologically, there was no difference between CD30+ cells belonging to the predominant clone and their polyclonal counterparts.Table IIClonal TCR-γ rearrangements of the patients, detected by single cell PCRPatientAlleleV-geneV-segmentN-sequenceJ-segmentLength of TCRI1V9TACTACTGTGCCTTGGTGGAGAAACTTGACAGAGAAACGAATTATTATAAGAAA2572V10TACTACTGTGCTGCGTGGGCTATTATAAGAAA240II1V4TATTACTGTGCCACCTGGGATGGGGGCGGATAAGAAA2492V5TATTACTGTGCCACCTGGGACAGGCCCAGCGGGAAA248IIIa,b,c1V9TATTACTGTGCCACCTGGGAGACCTATTATAAGAAA2412V10TACTACTGTGCTGCGTGGGAAGGCCTATGTTGATATAAAAA250IIIa1V8TACTACTGTGCCTTGTGGGAGCCCGAATTATTATAAGAAA251IV1V10TACTACTGTGCTGCGTGGGATCCGAAA2352V4TACTACTGTGCCTTGTGGGATGGGTTGGGATTATAAGAAA252 Open table in a new tab A remarkable additional observation was made in patient III, where three samples were investigated by single cell analysis. In biopsy IIIa, two different clonal T cell populations were identified (lengths of PCR products in clone 1: 241 bp, 250 bp and in clone 2: 251 bp). Clone 1 (241 bp, 250 bp) persisted during disease progression. Four of 22 CD30+ cells (18.2%) (Table I) in biopsy IIIa showed a biallelic TCR-γ chain gene rearrangement (clone 1: 241 bp, 250 bp); in subsequent samples (IIIb, IIIc), clone 1 had expanded, accounting for 70–80% of all CD30+ cells in biopsy IIIb and blood sample IIIc. Clone 2 (251 bp; Table II) was found in five of 18 CD30+ cells taken from biopsy IIIa, showing only one rearranged TCR-γ chain gene. This clone was no longer detectable in subsequent samples (IIIb, IIIc). Most CD30+ cells in sample IIIa were of a polyclonal nature (59.1%) (Table I). In biopsy IIIb and blood sample IIIc, the majority but not all (similar to patient I, II, and IV) of CD30+ T cells belonged to the clonal population (74% and 78.6%, respectively). In order to confirm these results, FFA–TCR-γ was performed from bulk DNA of samples IIIa, IIIb, and IIIc. Two clonal PCR products of identical sequence lengths were demonstrated as previously detected in single cell PCR (clone 1: 241 bp, 250 bp) (Fig 2D,E, Table II). The second, transient, clone 2 (251 bp) most likely corresponds to a dominant PCR product in FFA–TCR-γ (length 251 bp) in one biopsy prior to treatment (Fig 2A) and in specimen IIIa (Fig 2B) under vaccination therapy. Finally, an analysis of skin samples by CGH detected the following chromosomal imbalances: trisomy 7 in patients I and II, deletion of 7q and trisomy 14 in patient III and no aberration at all in patient IV (Table I). The CD30 antigen, a member of the tumor necrosis factor receptor superfamily, has been shown to be involved in the process of lymphoid development and differentiation (Falini et al., 1995Falini B. Pileri S. Pizzolo G. et al.CD30 (Ki-1) molecule: A new cytokine receptor of the tumor necrosis factor receptor superfamily as a tool for diagnosis and immunotherapy.Blood. 1995; 85: 1-14Crossref PubMed Google Scholar;Gruss et al., 1996Gruss H.J. Duyster J. Herrmann F. Structural and biological features of the TNF receptor and TNF ligand superfamilies: Interactive signals in the pathobiology of Hodgkin's disease.Ann Oncol. 1996; 7: 19-26Crossref PubMed Scopus (46) Google Scholar;Horie and Watanabe, 1998Horie R. Watanabe T. CD30. Expression and function in health and disease.Semin Immunol. 1998; 10: 457-470Crossref PubMed Scopus (219) Google Scholar). Apart from its physiologic function, CD30 expression may play a pivotal role in tumorigenesis and tumor survival, as CD30 expression represents an important diagnostic and prognostic marker in patients with cutaneous lymphoma. In order to define the extent of overlap between CD30+ large atypical cells and the malignant T cell clone, we studied TCR-γ gene sequences in single CD30+ cells by micromanipulation and single cell PCR. Using the same approach, it has previously been demonstrated that CD30+ Reed–Sternberg and Hodgkin cells in Hodgkin's disease represent the malignant cells, 90% of which are of B cell origin and 10% of T cell origin (Küppers et al., 1994Küppers R. Rajewsky K. Zhao M. et al.Hodgkin disease: Hodgkin and Reed-Sternberg cells picked from histological sections show clonal immunoglobulin gene rearrangements and appear to be derived from B cells at various stages of development.Proc Natl Acad Sci USA. 1994; 91: 10962-10966Crossref PubMed Scopus (521) Google Scholar;Maeuschen et al., 2000Maeuschen M. Rajewsky K. Brauninger A. et al.Rare occurrence of classical Hodgkin's disease as a T cell lymphoma.J-Exp Med. 2000; 191: 387-394Crossref PubMed Scopus (165) Google Scholar). We detected a population of T cells with clonal TCR-γ gene rearrangements in all four cases studied. All of these tumor-related cells showed a biallelic TCR-γ rearrangement (Table I, Table II). Unexpectedly, we also found polyclonal T cells besides the expected clonal population with relatively high frequency. Previously, we have shown that T cells expressing one expanded Vβ family comprise both reactive cells and the tumor cell population in mycosis fungoides (Gellrich et al., 2000Gellrich S. Lukowsky A. Schilling T. et al.Microanatomical compartment of clonal and reactive cells in mycosis fungoides: Molecular demonstration by single cell PCR of T cell receptor gene rearrangement.J Invest Dermatol. 2000; 115: 620-624Crossref PubMed Scopus (33) Google Scholar). The role of these bystanding T cells present within the tumor cell population of both disease entities is currently unknown. Possibly, they represent cytotoxic T cells. Several studies show that cytotoxic T cells exist in cutaneous T cell lymphoma expressing various kinds of inhibitory receptors involved in anti-tumor responses. In this study all patients showed a loss of CD3 within the CD30+ cell infiltrate. The absence of this cell surface receptor could represent a tumor escape mechanism as described byBagot et al., 2000Bagot M. Martinvallet D. Echchakir H. et al.Functional inhibitory receptors expressed by a cutaneous T cell lymphoma-specific cytolytic clonal T cell population.J Invest Dermatol. 2000; 115: 994-999Crossref PubMed Scopus (8) Google Scholar. In the earlier stage of disease in patient III (sample IIIa) we observed expression of CD3 and CD4 on CD30+ cells and a relatively high number of polyclonal T cells possibly induced by mimotope vaccination. Paralleling clinical tumor progression a loss of CD3 and CD4 was noted (samples IIIb and IIIc), concomitant with increased numbers of clonal cells. Thus, continued expression of CD3 and CD4 might be relevant for an intact anti-tumor response. Our finding of a second expanded clonal T cell population in sample IIIa (revealed by the same length of PCR products (251 bp) in single cell analysis and in FFA–TCR-γ) suggests the existence of a reactive cytotoxic anti-tumor cell line (Linnemann et al., 2000Linnemann T. Wiesmuller K.H. Gellrich S. et al.A T-cell epitope determined with random peptide libraries and combinatorial peptide chemistry stimulates T cells specific for cutaneous T-cell lymphoma.Ann Oncol. 2000; 11: 95-99Abstract Full Text PDF PubMed Scopus (11) Google Scholar,Linnemann et al., 2001Linnemann T. Tumenjargal S. Gellrich S. et al.Mimotopes for tumor-specific T lymphocytes in human cancer determined with combinatorial peptide libraries.Eur J Immunol. 2001; 31: 156-165Crossref PubMed Scopus (45) Google Scholar). In the peripheral blood of patient III an increased number of mimotope-activated cytotoxic T cells could be found by specific interferon-γ production of these cells (unpublished data). As noted by Kadin (Mori et al, 1999), signaling pathways seem to be important in the tumor biology of CD30+ cutaneous T cell lymphoma. Of these, the CD30/CD30 ligand interaction may be involved in spontaneous self-regression of tumor lesions probably due to tumor cell apoptosis. Nevertheless, recent observations indicate that aberrant cell activation by CD30 may cause the opposite effect: in anaplastic large cell lymphoma (ALCL) cell lines transformed from progressed lymphomatoid papulosis lesions, CD30/CD30 ligand signaling leads to cell proliferation instead of cell death. Therefore, defective CD30/CD30 ligand interaction in CD30+ tumor cells could promote tumor progression by resistance to CD30-mediated growth inhibition (Mori et al., 1999Mori M. Manuelli C. Pimpinelli N. et al.CD30–CD30 ligand interaction in primary cutaneous CD30(+) T-cell lymphomas. A clue to the pathophysiology of clinical regression.Blood. 1999; 94: 3077-3083PubMed Google Scholar;Levi et al., 2000Levi E. Wang Z. Petrogiannis-Haliotis T. et al.Distinct effects of CD30 and Fas signaling in cutaneous anaplastic lymphomas: A possible mechanism for disease progression.J Invest Dermatol. 2000; 115: 1034-1040Crossref PubMed Scopus (42) Google Scholar). Furthermore, the interaction between transforming growth factor β and its receptor is compromised by mutations in the transforming growth factor β receptor gene (Knaus et al., 1996Knaus P.I. Lindemann D. DeCoteau J.F. et al.A dominant inhibitory mutant of the type II transforming growth factor beta receptor in the malignant progression of a cutaneous T-cell lymphoma.Mol Cell Biol. 1996; 16: 3480-3489Crossref PubMed Google Scholar;Schiemann et al., 1999Schiemann W.P. Pfeifer W.M. Levi E. et al.A deletion in the gene for transforming growth factor beta type I receptor abolishes growth regulation by transforming growth factor beta in a cutaneous T-cell lymphoma.Blood. 1999; 15: 2854-2861Google Scholar). Interestingly, tumor cells in cutaneous T cell lymphoma were shown to produce high amounts of transforming growth factor β leading to the inhibition of specific anti-tumor responses (Bagot et al., 2001Bagot M. Nikolova M. Schirm-Chabanette F. et al.Crosstalk between tumor T lymphocytes and reactive T lymphocytes in cutaneous T cell lymphomas.Ann N Y Acad Sci. 2001; 941: 31-38Crossref PubMed Scopus (40) Google Scholar) and a lack of Fas expression (Mori et al., 1999Mori M. Manuelli C. Pimpinelli N. et al.CD30–CD30 ligand interaction in primary cutaneous CD30(+) T-cell lymphomas. A clue to the pathophysiology of clinical regression.Blood. 1999; 94: 3077-3083PubMed Google Scholar). In contrast to the favorable clinical course generally noted in CD30+ pCTCL two of the investigated patients (patients I and III) underwent a highly aggressive clinical course, both dying within 3 y. Mechanisms such as chromosomal imbalances (Beylot-Barry et al., 1998Beylot-Barry M. Groppi A. Vergier B. et al.Characterization of t(2;5) reciprocal transcripts and genomic breakpoints in CD30+ cutaneous lymphoproliferations.Blood. 1998; 91: 4668-4676PubMed Google Scholar;Zoi Toli et al., 2000Zoi Toli O. Vermeer M.H. De-Vries E. et al.Expression of Fas and Fas-ligand in primary cutaneous T-cell lymphoma (CTCL): Association between lack of Fas expression and aggressive types of CTCL.Br J Dermatol. 2000; 143: 313-319Crossref PubMed Scopus (79) Google Scholar) are considered important in tumor progression. In line with this notion, we detected a trisomy 7 in patients I and II as well as a partial deletion of 7q and a trisomy 14 in patient III by CGH analysis; however, whether these aberrations are present in the clonal, the polyclonal, or both populations remains an open question at present. In conclusion, our results demonstrate that CD30+ large atypical T lymphocytes in CD30+ large pCTCL indeed include clonally rearranged cells, and thus the tumor clone, but do not represent a uniform cell population, but rather a mixture of clonal and polyclonal T lymphocytes. With regard to the role of polyclonal CD30+ T cells within the tumor lesions, we speculate that strong T cell activating factors, i.e., T helper 2 type cytokines are active within the lesion, inducing common morphologic, and likely functional, features both in malignant in bystander T cells (Li et al., 1997Li G. Salhany K.E. Rook A.H. et al.The pathogenesis of large cell transformation in cutaneous T-cell lymphoma is not associated with t(2;5)(p23;q35) chromosomal translocation.J Cutan Pathol. 1997; 24: 403-408Crossref PubMed Scopus (21) Google Scholar). As activated T cells are probably more vulnerable to the genetic alterations detected in our patients, such local stimuli may be directly involved in the initial phases of lymphoma genesis. The Deutsche Forschungsgemeinschaft supported this work, grant no. GE 1004/1-1 and 1-2. We thank H. Tonnies for supporting the CGH experiments.