Portal de Periódicos da CAPES

The Transcription Factors AP-1 and Ets Are Regulators of C3a Receptor Expression

2005; Elsevier BV; Volume: 280; Issue: 51 Linguagem: Inglês

10.1074/jbc.m508146200

1083-351X

Myriam Schaefer, Stephanie Konrad, Jessica Thalmann, Claudia Rheinheimer, Kay Johswich, Bettina Sohns, Andreas Klos,

Complement system in diseases

The anaphylatoxin C3a is a proinflammatory mediator generated during complement activation. The tight control of C3a receptor (C3aR) expression is crucial for the regulation of anaphylatoxin-mediated effects. Key factors regulating constitutive expression of the C3aR in the mast cell line HMC-1 and receptor induction by dibutyryl-cAMP in monomyeloblastic U937 cells were determined by functional characterization of the C3aR promoter. Nucleotides -18 to -285 upstream of the translational start site proved to be critical for promoter activity in HMC-1 cells. Binding sites for the transcription factors AP-1 and Ets could be located. Overexpressed c-Jun/c-Fos (AP-1) and Ets-1 led synergistically to increased promoter activity that was substantially reduced by site-directed mutagenesis of the corresponding elements within the C3aR promoter. In HMC-1 cells, Ets interacted directly with the predicted binding motif of the C3aR promoter as determined by electromobility shift assays. AP-1 binding to the C3aR promoter was augmented during C3aR induction in U937 cells. A retroviral gene transfer system was used to express a dominant negative mutant of Ets-1 in these cells. The resulting cells failed to up-regulate the C3aR after stimulation with dibutyryl-cAMP and showed decreased AP-1 binding, suggesting that Ets acts here indirectly. Thus, it was established that Ets and the AP-1 element mediates dibutyryl-cAMP induction of C3aR promoter activity, hence providing a mechanistic explanation of dibutyryl-cAMP-dependent up-regulation of C3aR expression. In conclusion, this study demonstrates an important role of AP-1 and a member of the Ets family in the transcriptional regulation of C3aR expression, a prerequisite for the ability of C3a to participate in immunomodulation and inflammation. The anaphylatoxin C3a is a proinflammatory mediator generated during complement activation. The tight control of C3a receptor (C3aR) expression is crucial for the regulation of anaphylatoxin-mediated effects. Key factors regulating constitutive expression of the C3aR in the mast cell line HMC-1 and receptor induction by dibutyryl-cAMP in monomyeloblastic U937 cells were determined by functional characterization of the C3aR promoter. Nucleotides -18 to -285 upstream of the translational start site proved to be critical for promoter activity in HMC-1 cells. Binding sites for the transcription factors AP-1 and Ets could be located. Overexpressed c-Jun/c-Fos (AP-1) and Ets-1 led synergistically to increased promoter activity that was substantially reduced by site-directed mutagenesis of the corresponding elements within the C3aR promoter. In HMC-1 cells, Ets interacted directly with the predicted binding motif of the C3aR promoter as determined by electromobility shift assays. AP-1 binding to the C3aR promoter was augmented during C3aR induction in U937 cells. A retroviral gene transfer system was used to express a dominant negative mutant of Ets-1 in these cells. The resulting cells failed to up-regulate the C3aR after stimulation with dibutyryl-cAMP and showed decreased AP-1 binding, suggesting that Ets acts here indirectly. Thus, it was established that Ets and the AP-1 element mediates dibutyryl-cAMP induction of C3aR promoter activity, hence providing a mechanistic explanation of dibutyryl-cAMP-dependent up-regulation of C3aR expression. In conclusion, this study demonstrates an important role of AP-1 and a member of the Ets family in the transcriptional regulation of C3aR expression, a prerequisite for the ability of C3a to participate in immunomodulation and inflammation. The complement system is activated in a variety of diseases (1Carroll M.C. Nat. Immunol. 2004; 5: 981-986Crossref PubMed Scopus (821) Google Scholar, 2Gasque P. Dean Y.D. McGreal E.P. VanBeek J. Morgan B.P. Immunopharmacology. 2000; 49: 171-186Crossref PubMed Scopus (318) Google Scholar, 3Kohl J. Mol. Immunol. 2001; 38: 175-187Crossref PubMed Scopus (157) Google Scholar) and leads to the generation of the anaphylatoxic peptide C3a. 2The abbreviations used are: C3aanaphylatoxic peptide derived from complement factor C3C3aRC3a receptorC5aanaphylatoxic peptide derived from complement factor C5C5aRC5a receptor, CD88AP-1transcription factor activator protein-1wtwild typeAP-1wtdouble-stranded consensus oligonucleotide representing the AP-1 wild type sequence and recognition motifAP-1mutdouble-stranded consensus oligonucleotide with a point mutation within its AP-1 binding motifAP-1-C3aRwtdouble-stranded oligonucleotide representing part of the C3aR promoter including the putative AP-1 wild type sequence and recognition motifAP-1-C3aRmutdouble-stranded oligonucleotide representing part of the C3aR promoter with a point mutation within its putative AP-1 binding motifBt2cAMPdibutyryl-cAMPEMSAelectromobility shift assayEtstranscription factor family E26 transformation-specificEts-1transcription factor E26-transformation specific-1Ets-1DNdominant negative mutant of Ets-1Ets-1wtdouble-stranded consensus oligonucleotide representing the Ets-1 wild type sequence and recognition motifEts-1mut/Ets-1mut2double-stranded consensus oligonucleotides with point mutations within their Ets-1 binding motifEts-C3aRwtdouble-stranded oligonucleotide representing part of the C3aR promoter including the putative Ets-1 wild type sequence and recognition motifEts-C3aRmutdouble-stranded oligonucleotide representing part of the C3aR promoter with a point mutation within its putative Ets-1 binding motiffMLPformylmethionylleucylphenylalanineHa-Rassmall GTP-protein Harvey-RasHEK293human embryonic kidney cellsHMC-1human mast cell lineNCnegative control oligonucleotideTPAphorbol ester 12-O-tetradecanoylphorbol 13-acetateU937human monocytes-like cell lineTIStranscription initiation or start siteSEAPsecreted alkaline phosphataseRTreverse transcriptionUTRuntranslated regionDNdominant negative. This proinflammatory mediator binds specifically to its heptahelical receptor (C3aR) (4Crass T. Raffetseder U. Martin U. Grove M. Klos A. Kohl J. Bautsch W. Eur. J. Immunol. 1996; 26: 1944-1950Crossref PubMed Scopus (157) Google Scholar, 5Ames R.S. Li Y. Sarau H.M. Nuthulaganti P. Foley J.J. Ellis C. Zeng Z. Su K. Jurewicz A.J. Hertzberg R.P. Bergsma D.J. Kumar C. J. Biol. Chem. 1996; 271: 20231-20234Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar) which is expressed on various cells such as leukocytes, endothelial and broncho-epithelial cells, smooth muscle cells of the lung, and even neurons (4Crass T. Raffetseder U. Martin U. Grove M. Klos A. Kohl J. Bautsch W. Eur. J. Immunol. 1996; 26: 1944-1950Crossref PubMed Scopus (157) Google Scholar, 6Martin U. Bock D. Arseniev L. Tornetta M.A. Ames R.S. Bautsch W. Kohl J. Ganser A. Klos A. J. Exp. Med. 1997; 186: 199-207Crossref PubMed Scopus (135) Google Scholar, 7Zwirner J. Gotze O. Begemann G. Kapp A. Kirchhoff K. Werfel T. Immunology. 1999; 97: 166-172Crossref PubMed Scopus (82) Google Scholar). anaphylatoxic peptide derived from complement factor C3 C3a receptor anaphylatoxic peptide derived from complement factor C5 C5a receptor, CD88 transcription factor activator protein-1 wild type double-stranded consensus oligonucleotide representing the AP-1 wild type sequence and recognition motif double-stranded consensus oligonucleotide with a point mutation within its AP-1 binding motif double-stranded oligonucleotide representing part of the C3aR promoter including the putative AP-1 wild type sequence and recognition motif double-stranded oligonucleotide representing part of the C3aR promoter with a point mutation within its putative AP-1 binding motif dibutyryl-cAMP electromobility shift assay transcription factor family E26 transformation-specific transcription factor E26-transformation specific-1 dominant negative mutant of Ets-1 double-stranded consensus oligonucleotide representing the Ets-1 wild type sequence and recognition motif double-stranded consensus oligonucleotides with point mutations within their Ets-1 binding motif double-stranded oligonucleotide representing part of the C3aR promoter including the putative Ets-1 wild type sequence and recognition motif double-stranded oligonucleotide representing part of the C3aR promoter with a point mutation within its putative Ets-1 binding motif formylmethionylleucylphenylalanine small GTP-protein Harvey-Ras human embryonic kidney cells human mast cell line negative control oligonucleotide phorbol ester 12-O-tetradecanoylphorbol 13-acetate human monocytes-like cell line transcription initiation or start site secreted alkaline phosphatase reverse transcription untranslated region dominant negative. The best experimental evidence for the involvement of C3a in diseases has been obtained in animal models using C3aR knock-out mice, guinea pigs with a natural C3aR defect, or specific C3aR inhibitors (8Ames R.S. Lee D. Foley J.J. Jurewicz A.J. Tornetta M.A. Bautsch W. Settmacher B. Klos A. Erhard K.F. Cousins R.D. Sulpizio A.C. Hieble J.P. McCafferty G. Ward K.W. Adams J.L. Bondinell W.E. Underwood D.C. Osborn R.R. Badger A.M. Sarau H.M. J. Immunol. 2001; 166: 6341-6348Crossref PubMed Scopus (161) Google Scholar, 9Bautsch W. Hoymann H.G. Zhang Q. Meier-Wiedenbach I. Raschke U. Ames R.S. Sohns B. Flemme N. Meyer z., V Grove M. Klos A. Kohl J. J. Immunol. 2000; 165: 5401-5405Crossref PubMed Scopus (102) Google Scholar, 10Drouin S.M. Corry D.B. Hollman T.J. Kildsgaard J. Wetsel R.A. J. Immunol. 2002; 169: 5926-5933Crossref PubMed Scopus (144) Google Scholar, 11Hollmann T.J. Haviland D.L. Kildsgaard J. Watts K. Wetsel R.A. Mol. Immunol. 1998; 35: 137-148Crossref PubMed Scopus (24) Google Scholar, 12Kildsgaard J. Hollmann T.J. Matthews K.W. Bian K. Murad F. Wetsel R.A. J. Immunol. 2000; 165: 5406-5409Crossref PubMed Scopus (161) Google Scholar). Intriguingly, C3a and its receptor act partially protective, partially destructive. In endotoxin shock, C3a seems to be protective; the mortality rate of C3aR-/- mice was much higher than that of their wild type littermates, investigated by a cecal ligation puncture sepsis model (12Kildsgaard J. Hollmann T.J. Matthews K.W. Bian K. Murad F. Wetsel R.A. J. Immunol. 2000; 165: 5406-5409Crossref PubMed Scopus (161) Google Scholar). Moreover, C3a participates in liver regeneration after partial hepatectomy or toxic injury (13Markiewski M.M. Mastellos D. Tudoran R. DeAngelis R.A. Strey C.W. Franchini S. Wetsel R.A. Erdei A. Lambris J.D. J. Immunol. 2004; 173: 747-754Crossref PubMed Scopus (136) Google Scholar, 14Strey C.W. Markiewski M. Mastellos D. Tudoran R. Spruce L.A. Greenbaum L.E. Lambris J.D. J. Exp. Med. 2003; 198: 913-923Crossref PubMed Scopus (343) Google Scholar). As demonstrated in an adjuvant-induced arthritis rat model, C3a aggravates the inflammatory reaction (8Ames R.S. Lee D. Foley J.J. Jurewicz A.J. Tornetta M.A. Bautsch W. Settmacher B. Klos A. Erhard K.F. Cousins R.D. Sulpizio A.C. Hieble J.P. McCafferty G. Ward K.W. Adams J.L. Bondinell W.E. Underwood D.C. Osborn R.R. Badger A.M. Sarau H.M. J. Immunol. 2001; 166: 6341-6348Crossref PubMed Scopus (161) Google Scholar). In asthma, C3a is deleterious because C3aR-/--mice are protected from ovalbumin-driven airway hyper-responsiveness and early phase bronchoconstriction (15Hawlisch H. Wills-Karp M. Karp C.L. Kohl J. Mol. Immunol. 2004; 41: 123-131Crossref PubMed Scopus (116) Google Scholar). In man C3a might play a similar role because its concentration is augmented in bronchoalveolar lavage fluid of asthmatics after allergen provocation (16Krug N. Tschernig T. Erpenbeck V.J. Hohlfeld J.M. Kohl J. Am. J. Respir. Crit. Care Med. 2001; 164: 1841-1843Crossref PubMed Scopus (156) Google Scholar). Mast cells and eosinophils contribute to certain inflammatory responses. The proinflammatory mediator C3a is a chemotaxin for these cells, suggesting their anaphylatoxin-mediated recruitment into inflamed tissue (17Daffern P.J. Pfeifer P.H. Ember J.A. Hugli T.E. J. Exp. Med. 1995; 181: 2119-2127Crossref PubMed Scopus (224) Google Scholar, 18Hartmann K. Henz B.M. Kruger-Krasagakes S. Kohl J. Burger R. Guhl S. Haase I. Lippert U. Zuberbier T. Blood. 1997; 89: 2863-2870Crossref PubMed Google Scholar, 19Nilsson G. Johnell M. Hammer C.H. Tiffany H.L. Nilsson K. Metcalfe D.D. Siegbahn A. Murphy P.M. J. Immunol. 1996; 157: 1693-1698PubMed Google Scholar). As recently demonstrated, mast cells are additionally involved in autoimmune diseases (20Benoist C. Mathis D. Nature. 2002; 420: 875-878Crossref PubMed Scopus (260) Google Scholar, 21Secor V.H. Secor W.E. Gutekunst C.A. Brown M.A. J. Exp. Med. 2000; 191: 813-822Crossref PubMed Scopus (376) Google Scholar). Here, anaphylatoxins are also of importance. C3a exhibits various biological functions in leukocytes, mast cells, and related cell lines expressing the C3aR. Mediated by a pertussis-toxin sensitive G-protein, it leads to the increase of free cytosolic Ca2+, cell activation, and degranulation (17Daffern P.J. Pfeifer P.H. Ember J.A. Hugli T.E. J. Exp. Med. 1995; 181: 2119-2127Crossref PubMed Scopus (224) Google Scholar, 18Hartmann K. Henz B.M. Kruger-Krasagakes S. Kohl J. Burger R. Guhl S. Haase I. Lippert U. Zuberbier T. Blood. 1997; 89: 2863-2870Crossref PubMed Google Scholar). Surface expression of adhesion molecules (22Jagels M.A. Daffern P.J. Hugli T.E. Immunopharmacology. 2000; 46: 209-222Crossref PubMed Scopus (76) Google Scholar) and cytokine release are also modulated by C3a (23Monsinjon T. Gasque P. Ischenko A. Fontaine M. FEBS Lett. 2001; 487: 339-346Crossref PubMed Scopus (41) Google Scholar, 24Fischer W.H. Hugli T.E. J. Immunol. 1997; 159: 4279-4286PubMed Google Scholar, 25Sayah S. Ischenko A.M. Zhakhov A. Bonnard A.S. Fontaine M. J. Neurochem. 1999; 72: 2426-2436Crossref PubMed Scopus (74) Google Scholar, 26Takabayashi T. Vannier E. Clark B.D. Margolis N.H. Dinarello C.A. Burke J.F. Gelfand J.A. J. Immunol. 1996; 156: 3455-3460PubMed Google Scholar). Obviously, the tightly controlled expression of the C3aR is crucial for the regulation of anaphylatoxin-mediated effects. As an example for such a regulation in situ, C3aR expression cannot be detected in normal brain sections although a strong C3aR immunohistochemical staining is evident in areas of inflammation. In meningitis, the C3aR is abundantly expressed by reactive astrocytes, microglia, and infiltrating macrophages and neutrophils. In multiple sclerosis, a strong staining can be additionally detected on smooth muscle cells surrounding blood vessels (27Gasque P. Singhrao S.K. Neal J.W. Wang P. Sayah S. Fontaine M. Morgan B.P. J. Immunol. 1998; 160: 3543-3554Crossref PubMed Google Scholar). Finally, in experimental allergic encephalitis the C3aR was elevated on microglia, infiltrating monocytes/macrophages, and astrocytes (28Davoust N. Jones J. Stahel P.F. Ames R.S. Barnum S.R. Glia. 1999; 26: 201-211Crossref PubMed Scopus (121) Google Scholar). C3aR regulation can also be observed in other tissues: In ovalbumin- or lipopolysaccharide-challenged mice, C3aR expression increased on bronchial smooth muscle cells (29Drouin S.M. Kildsgaard J. Haviland J. Zabner J. Jia H.P. McCray Jr., P.B. Tack B.F. Wetsel R.A. J. Immunol. 2001; 166: 2025-2032Crossref PubMed Scopus (172) Google Scholar). In patients suffering from atopic dermatitis or allergic contact dermatitis, C3aR expression can be detected in CD4+ and CD8+ T-cell clones, cell types that normally do not express this receptor (6Martin U. Bock D. Arseniev L. Tornetta M.A. Ames R.S. Bautsch W. Kohl J. Ganser A. Klos A. J. Exp. Med. 1997; 186: 199-207Crossref PubMed Scopus (135) Google Scholar, 30Werfel T. Kirchhoff K. Wittmann M. Begemann G. Kapp A. Heidenreich F. Gotze O. Zwirner J. J. Immunol. 2000; 165: 6599-6605Crossref PubMed Scopus (107) Google Scholar). Corresponding to the regulation in situ, the C3aR can be induced in cell culture by Bt2cAMP or interferon-γ on monomyeloblastic cell lines such as U937 (31Burg M. Martin U. Bock D. Rheinheimer C. Kohl J. Bautsch W. Klos A. J. Immunol. 1996; 157: 5574-5581PubMed Google Scholar). The aim of the current study was to obtain a deeper understanding of the regulation of the human C3aR, in particular, its transcriptional control, which has never been investigated before. Constitutive expression of the C3aR in the mast cell line HMC-1 (32Zwirner J. Gotze O. Sieber A. Kapp A. Begemann G. Zuberbier T. Werfel T. Scand. J. Immunol. 1998; 47: 19-24Crossref PubMed Scopus (34) Google Scholar) and receptor induction by Bt2cAMP (and TPA) in monomyeloblastic U937 cells (33Klos A. Bank S. Gietz C. Bautsch W. Kohl J. Burg M. Kretzschmar T. Biochemistry. 1992; 31: 11274-11282Crossref PubMed Scopus (75) Google Scholar) were investigated. The transcription initiation site was identified. The essential part of the C3aR promoter was narrowed down by 5′ and 3′ deletion analysis. Detailed characterization by various methods revealed a crucial role for the transcription factors activator protein-1 (AP-1) and E26-transformation specific (Ets) and their corresponding binding sites within the C3aR promoter. Ets seems to act directly on the C3aR promoter but also indirectly when receptor expression is induced. All reagents were obtained from Sigma if not otherwise indicated. Cell Lines and Cell Culture Conditions—The human mast cell line HMC-1 (kindly provided by J. H. Butterfield) and human monomyeloblastic U937 cells (ATCC CRL 1593) were cultured in RPMI 1640 medium (Biochrom AG, Berlin, Germany) at 37 °C, 5% CO2. The human embryonic kidney cell line HEK293 (ATCC CRL 1573) (4Crass T. Raffetseder U. Martin U. Grove M. Klos A. Kohl J. Bautsch W. Eur. J. Immunol. 1996; 26: 1944-1950Crossref PubMed Scopus (157) Google Scholar) was cultured in Dulbecco's modified Eagle's medium/Ham's F-12 (Biochrom AG). Both media were supplemented with 10% (v/v) fetal calf serum (Sigma). Transient Transfection of HMC-1 Cells and Reporter Gene Assay— Human C3aR promoter fragments were generated by PCR using the pDP1 plasmid as template (34Paral D. Sohns B. Crass T. Grove M. Kohl J. Klos A. Bautsch W. Eur. J. Immunol. 1998; 28: 2417-2423Crossref PubMed Scopus (8) Google Scholar) and subcloned in between the NheI and HindIII site of pSEAP2-E (Clontech, Heidelberg, Germany). Primer sequences can be obtained from the corresponding author. Point mutations were introduced using the QuikChange mutagenesis protocol (Stratagene, La Jolla, CA): TATAA to GCTAA for the TATA box, CAGGAAG to CAAGAAG for the Ets binding site, ATGACTC to ACAACTC for AP-1. Putative transcription factor binding sites were identified with MatInspector® Version 6.2. All constructs were sequenced for verification. HMC-1 cells were transiently transfected in 6-well plates at 1 × 10E6 cells/well with the C3aR promoter constructs either alone or in combination with Ets-1 from chicken, human c-Jun, c-Fos, and Ha-Ras (generous gifts from Dr. A. Nordheim and Dr. B. Luescher), 200 ng each. Effectene transfection reagent® (Qiagen, Hilden, Germany) was used according to the manufacturer's instruction. The transfection efficiency was normalized by cotransfection with pCMV-β-galactosidase (Clontech). Cells were harvested and centrifuged 72 h post-transfection. Secreted alkaline phosphatase (SEAP) was determined in the supernatant; β-galactosidase was determined in the cell-lysate. Great EscAPE SEAP™ detection Kit from Clontech and High Sensitivity β-GAL Assay Kit™ were used as described in the manufacturer's protocol. Transient Transfection of HEK293 Cells—HEK cells were transiently transfected with Lipofectamine™ according to the manufacturer's instructions (Invitrogen). Generation of a Dominant Negative Mutant of Ets-1 and Its Transduction into U937 Cells—A retroviral gene transfer system was applied to generate U937 cells expressing a dominant negative mutant of Ets-1. It consists of amino acids 306-441 of chicken Ets-1 (accession number M22462) and is, thus, lacking the transactivation domain (35Mattot V. Vercamer C. Soncin F. Calmels T. Huguet C. Fafeur V. Vandenbunder B. Oncogene. 2000; 19: 762-772Crossref PubMed Scopus (36) Google Scholar). RNA Preparation and cDNA Synthesis—Total RNA was isolated from cell cultures using TRIzol™ reagent (Invitrogen) according to the manufacturer's protocol. Five μg of total RNA was transcribed by SuperScript II RNase H- reverse transcriptase from Invitrogen using an oligo(dT) primer (Stratagene). Detection of the Transcription Initiation Site by RT-PCR—cDNA (2 of 60 μl) was generated using a reverse antisense primer (CTGCATCTTCAGGCCAGC) hybridizing to the coding region of the C3aR for cDNA synthesis. The resulting cDNA was applied as template in PCR reactions, combining this reverse antisense primer with a whole set of sense primers that anneal to the C3aR 5′-UTR. The amplified genomic DNA fragments could be excluded because they would additionally contain the 6-kilobase intron. The construct pSEAP2-E308-hC3aR-234, artificially combining part of the promoter region (308 bp) with part of the coding region of the C3aR, was used as a positive control. The primer positions upstream from the start codon were: 104-85 for P1, 141-121 for P2, 159-141 for P3, 190-172 for P4, 215-196 for P5, 230-211 for P6, 240-221 for P7, 253-233 for P8, 269-249 for P9, and 286-267 for P10. Nuclease Protection Assay—3, 10, and 30 μg of RNA were used in the nuclease protection assay (Ambion Inc., Austin, TX). Thirty μg of yeast RNA served as the negative control. A probe representing part of exon 1 of the C3aR (position -444 to -26) was generated by PCR using a [α-35S]dATP-labeled oligonucleotide (GTCCTGTCTGGTCCCCACACTTAG; -85 to -26) as the reverse antisense primer and a biotinylated sense primer (-444 to -425). Genomic sequence (ligated into the plasmid DP1) served as the template. The sense primer was removed using streptavidin-coupled Dynabeads (Dynal/Invitrogen). The RNA was hybridized overnight at 43 °C followed by nuclease treatment according to the manufacturer's instruction. After digestion, the protected fragments were separated in a 6% denaturing polyacrylamide gel followed by 3 weeks of exposure of the x-ray film (Kodak X-Omat Ar35 × 43). C3aR Real-time RT-PCR—TaqMan real-time RT-PCR was performed using a C3aR-specific TaqMan® gene expression assay (HS00377780-m1) in combination with the TaqMan® Universal PCR Master Mix and the 7000 Sequence Detection System for analysis (all Applied Biosystems, Weiterstadt, Germany). For normalization, the housekeeping gene RPS9 was used. Standard curves were generated using serially diluted cDNA. For each sample, the -fold induction was calculated as the ratio of the normalized volume equivalent of the transfected cells to the normalized volume equivalent of the corresponding mock-transfected cells. Competitive 125I-Labeled C3a and C5a Binding Studies—Competitive binding studies with human 125I-labeled C3a or C5a (PerkinElmer Life Sciences) as tracer and increasing concentrations of cold C3a or C5a were performed as previously described (6Martin U. Bock D. Arseniev L. Tornetta M.A. Ames R.S. Bautsch W. Kohl J. Ganser A. Klos A. J. Exp. Med. 1997; 186: 199-207Crossref PubMed Scopus (135) Google Scholar). Fura2 Assay for the Determination of Free Cytosolic Ca2+ in Bt2cAMP-induced U937 Cells—This assay was performed exactly as previously described (6Martin U. Bock D. Arseniev L. Tornetta M.A. Ames R.S. Bautsch W. Kohl J. Ganser A. Klos A. J. Exp. Med. 1997; 186: 199-207Crossref PubMed Scopus (135) Google Scholar, 31Burg M. Martin U. Bock D. Rheinheimer C. Kohl J. Bautsch W. Klos A. J. Immunol. 1996; 157: 5574-5581PubMed Google Scholar). Electromobility Shift Assay (EMSA)—All oligonucleotides were annealed in equimolar amounts and end-labeled by T4 polynucleotide kinase with [γ-32P]ATP followed by desalting through G-50 Micro Columns (Amersham Biosciences). The following oligonucleotides were used for gel shift experiments: AP-1wt/AP-1mut, Gelshift AP-1 family kit (Active Motif, Rixensart, Belgium); AP-1-C3aRwt (position -233 to -213 of the C3aR promoter), 5′-ttcaaagtgagtcatttctaa-3′; AP-1-C3aRmut (position -233 to -213 of the C3aR promoter, with mutated AP-1 site), 5′-ttcaaagtgagttgtttctaa-3′; Ets-1wt (36Kang R. Saito H. Ihara Y. Miyoshi E. Koyama N. Sheng Y. Taniguchi N. J. Biol. Chem. 1996; 271: 26706-26712Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar), 5′-cggccaaccggaagcatgtgc-3′; Ets-C3aRwt (position -219 to -196 of the C3aR promoter), 5′-gacctcacaggaagagtttcaaag-3′; Ets-C3aRmut (position -219 to -196 of the C3aR promoter, with mutated Ets site), 5′-gacctcacaagaagagtttcaaag-3′; Ets-C3aRmut2 (position -219 to -196 of the C3aR promoter, with completely mutated Ets site), 5′-gacctcactctcggagtttcaaag-3′; negative control oligonucleotide (NC), 5′-ttcactccctaggggttctgctaggttaaca-3′. Nuclear extracts were prepared according to the manufacturer's protocol (NucBuster Protein Extraction Kit, Novagen, Darmstadt, Germany). Binding reactions were performed in 20 mm HEPES, 50 mm NaCl, 0.1 mm EDTA, 2% Ficoll, 1 μg of poly(dI-dC), and 1 mm dithiothreitol. For competition, 5-7.5 μg of nuclear extract were preincubated for 20 min at room temperature with an excess of nonlabeled oligonucleotide: 5-, 50-, or 500-fold molar concentrations as indicated in the figure legends. After the addition of 100,000 cpm of the 32P-radiolabeled oligonucleotide, the mixture was incubated at room temperature for 20 min. The DNA-nuclear factor complexes were resolved on a 1 × Tris-buffered EDTA, 7% polyacrylamide gel pre-electrophoresed at room temperature for 60 min at 100 V. The gel was dried and then analyzed on a phosphorimaging plate. C3aR Transcription Initiation Site Determined by Nuclease Protection Assay and RT-PCR—To localize the transcription initiation site (TIS in Fig. 1 and 2a) of the C3aR promoter, total RNA from HMC-1 cells was analyzed by nuclease protection assay. A single band at position -185 relative to the start codon became visible in the radiography (Fig. 1, upper panel), indicating the (major) transcription initiation site.FIGURE 2Deletion analysis of the C3aR promoter (b-d) and mutations of putative TATA-boxes (e), analyzed by SEAP reporter gene assays in HMC-1 cells, indicate positive regulatory promoter elements and a TATA-less promoter. The genomic organization of the human C3aR (hC3aR), the predicted cis-acting elements (MatInspector® Software) for AP-1 and Ets, and two putative TATA-boxes are depicted in the upper part of this figure (a). A ∼2-kilobase region of the promoter located in exon one was stepwise deleted from the 5′-end (b and c), and the 3′-end (d). Two putative TATA boxes, TATA1 centered at -275 and TATA2 centered at -351, were deleted either as separate mutations (mutTATA1 and mutTATA2) or combined (mutTATA1/2) (e). Nucleotide positions are given relative to the start codon (+1). The horizontal lines at the left represent graphically the part of the C3aR promoter that has been ligated into the pSEAP2-E reporter gene vector. The names of the constructs indicate the length of the analyzed part of the C3aR promoter. For normalization, a plasmid expressing β-galactosidase under the control of the CMV promoter was cotransfected. On the right side of b-e, the normalized SEAP activity determined in the supernatant 3 days after transient transfection is depicted as the mean ± S.D. of n = 3(b-d) and n = 4(e) independent experiments (and duplicates within each experiment), respectively. For better comparison, the C3aR promoter activity of construct pSEAP2-E267 was defined as 100%. ORF, open reading frame; TIS, transcription initiation site; kb, kilobases.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The RNA was additionally analyzed by RT-PCR, combining a whole set of sense primers annealing to the C3aR 5′-UTR with one common reverse antisense primer hybridizing to the coding region of the C3aR (Fig. 1, lower panel). Strong amplified fragments (P1-P4 in Fig. 1) became apparent using primer combinations with sense primers binding within 185 bp of the 5′-UTR relative to the start codon. Primer combinations with sense primers annealing further upstream resulted in weaker but still visible PCR products (P5-P10 in Fig. 1), suggesting an additional minor transcription start site located upstream of position -280. A vector containing the C3aR 5′-UTR (cloned from genomic DNA) in combination with part of the coding region of the C3aR served as positive control. As expected, amplified fragments resulted with all primer pairs (not shown). Identification of Regulatory Regions by 5′ and 3′ Deletion of the C3aR 5′-UTR in HMC-1 Cells—To gain further insights into the modes of regulation of the C3aR, the minimal transcriptional unit of the C3aR promoter was mapped, and key regulatory elements within this promoter directing basal gene expression were identified. HMC-1 cells constitutively expressing the C3aR (and thus, exhibiting all necessary cofactors) were used in this deletion analysis. The gene of the human C3aR is located on chromosome 12p13. A single 6-kilobase intron is present 17 bp upstream of the ATG initiation codon of exon 2 (34Paral D. Sohns B. Crass T. Grove M. Kohl J. Klos A. Bautsch W. Eur. J. Immunol. 1998; 28: 2417-2423Crossref PubMed Scopus (8) Google Scholar). A 2-kilobase region of the C3aR 5′-UTR located directly upstream of the intron was analyzed by SEAP reporter gene assay (Fig. 2a). For this purpose, a whole set of overlapping fragments of the C3aR 5′-UTR was generated by PCR and cloned into the pSEAP2-Enhancer vector, as indicated in the corresponding figures (Fig. 2, b-e). In all figures and throughout the paper, all nucleotide positions are given relative to the ATG start codon. The names of the constructs indicate the lengths of the analy