Portal de Periódicos da CAPES

NF-Y Organizes the γ-Globin CCAAT Boxes Region

1998; Elsevier BV; Volume: 273; Issue: 27 Linguagem: Inglês

10.1074/jbc.273.27.16880

1083-351X

Chiara Liberati, Antonella Ronchi, Patricia Lievens, Sergio Ottolenghi, Roberto Mantovani,

RNA Research and Splicing

The CCAAT-binding activator NF-Y is formed by three evolutionary conserved subunits, two of which contain putative histone-like domains. We investigated NF-Y binding to all CCAAT boxes of globin promoters in direct binding, competition, and supershift electrophoretic mobility shift assay; we found that the α, ζ, and proximal γ CCAAT boxes of human and the prosimian Galago bind avidly, and distal γ CCAAT boxes have intermediate affinity, whereas the ε and β sequences bind NF-Y very poorly. We developed an efficientin vitro transcription system from erythroid K562 cells and established that both the distal and the proximal CCAAT boxes are important for optimal γ-globin promoter activity. Surprisingly, NF-Y binding to a mutated distal CCAAT box (a C to T at position −114) is remarkably increased upon occupancy of the high affinity proximal element, located 27 base pairs away. Shortening the distance between the two CCAAT boxes progressively prevents simultaneous CCAAT binding, indicating that NF-Y interacts in a mutually exclusive way with CCAAT boxes closer than 24 base pairs apart. A combination of circular permutation and phasing analysis proved that (i) NF-Y-induced angles of the two γ-globin CCAAT boxes have similar amplitudes; (ii) occupancy of the two CCAAT boxes leads to compensatory distortions; (iii) the two NF-Y bends are spatially oriented with combined twisting angles of about 100°. Interestingly, such distortions are reminiscent of core histone-DNA interactions. We conclude that NF-Y binding imposes a high level of functionally important coordinate organization to the γ-globin promoter. The CCAAT-binding activator NF-Y is formed by three evolutionary conserved subunits, two of which contain putative histone-like domains. We investigated NF-Y binding to all CCAAT boxes of globin promoters in direct binding, competition, and supershift electrophoretic mobility shift assay; we found that the α, ζ, and proximal γ CCAAT boxes of human and the prosimian Galago bind avidly, and distal γ CCAAT boxes have intermediate affinity, whereas the ε and β sequences bind NF-Y very poorly. We developed an efficientin vitro transcription system from erythroid K562 cells and established that both the distal and the proximal CCAAT boxes are important for optimal γ-globin promoter activity. Surprisingly, NF-Y binding to a mutated distal CCAAT box (a C to T at position −114) is remarkably increased upon occupancy of the high affinity proximal element, located 27 base pairs away. Shortening the distance between the two CCAAT boxes progressively prevents simultaneous CCAAT binding, indicating that NF-Y interacts in a mutually exclusive way with CCAAT boxes closer than 24 base pairs apart. A combination of circular permutation and phasing analysis proved that (i) NF-Y-induced angles of the two γ-globin CCAAT boxes have similar amplitudes; (ii) occupancy of the two CCAAT boxes leads to compensatory distortions; (iii) the two NF-Y bends are spatially oriented with combined twisting angles of about 100°. Interestingly, such distortions are reminiscent of core histone-DNA interactions. We conclude that NF-Y binding imposes a high level of functionally important coordinate organization to the γ-globin promoter. NF-Y organizes the γ-globin CCAAT boxes region.Journal of Biological ChemistryVol. 273Issue 44PreviewPage 16885, Fig. 6E: This part of Fig. 6 was printed without the legends. The complete version of Fig. 6 E is shown below. Full-Text PDF Open Access The CCAAT box is a widespread regulatory sequence found in promoters and enhancers of several genes (1Bucher P. J. Mol. Biol. 1990; 212: 563-578Crossref PubMed Scopus (984) Google Scholar), whose functional importance has been well established in different systems (2Cowie A. Myers R.M. Mol. Cell. Biol. 1988; 8: 3122-3128Crossref PubMed Scopus (50) Google Scholar, 3Delvoye N.L. Destroismaisons N.M. Wall L.A. Mol. Cell. Biol. 1993; 13: 6969-6983Crossref PubMed Google Scholar, 4Mason M.M. Grasso J.A. Gavrilova O. Reitman M. J. Biol. Chem. 1996; 271: 25459-25467Abstract Full Text Full Text PDF PubMed Scopus (7) Google Scholar, 5Pondel M.D. Sharpe J.A. Clark S. Pearson L. Wood W.G. Proudfoot N.J. Nucleic Acids Res. 1996; 24: 4158-4164Crossref PubMed Scopus (6) Google Scholar, 6Bienz M. Pelham H.R.B. Cell. 1986; 45: 753-760Abstract Full Text PDF PubMed Scopus (131) Google Scholar, 7Li-Weber M. Davydov I.V. Krafft H. Krammer P.H. J. Immunol. 1994; 153: 4122-4133PubMed Google Scholar, 8Osawa H. Robey R.B. Printz R.L Granner D.K. J. Biol. Chem. 1996; 271: 17296-17303Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 9Ruddel A. Virology. 1995; 206: 1-7Crossref PubMed Scopus (57) Google Scholar, 10Skalnik D.G. Strauss E.C. Orkin S.H. J. Biol. Chem. 1991; 266: 16736-167744Abstract Full Text PDF PubMed Google Scholar, 11Spear D.H. Ericsson J. Jackson S.M. Edwards P.A. J. Biol. Chem. 1994; 269: 25212-25218Abstract Full Text PDF PubMed Google Scholar, 12Mantovani R. Pessara U. Tronche F. Li X.Y. Knapp A.M. Pasquali J.L. Benoist C. Mathis D. EMBO J. 1992; 11: 3315-3322Crossref PubMed Scopus (165) Google Scholar). NF-Y (also termed CBF) has an almost absolute requirement for these five nucleotides and a strong preference for additional flanking sequences (13Dorn A. Bollekens J. Staub A. Benoist C. Mathis D. Cell. 1987; 50: 863-872Abstract Full Text PDF PubMed Scopus (476) Google Scholar, 14Ronchi A. Bellorini M. Mongelli N. Mantovani R. Nucleic Acids Res. 1995; 23: 4565-4572Crossref PubMed Scopus (86) Google Scholar). Based on supershift experiments with anti-NF-Y antibodies, on competition analysis with the original Ea Y box oligo, 1The abbreviations used are: oligos, oligonucleotides; HPFH, hereditary persistence of fetal hemoglobin; bp, base pair(s); EMSA, electrophoretic mobility shift assay; MHC, major histocompatibility complex; wt, wild type. or on the heteromeric nature of the DNA-binding complex, NF-Y has been identified as the CCAAT box activator in over 100 promoters (7Li-Weber M. Davydov I.V. Krafft H. Krammer P.H. J. Immunol. 1994; 153: 4122-4133PubMed Google Scholar, 8Osawa H. Robey R.B. Printz R.L Granner D.K. J. Biol. Chem. 1996; 271: 17296-17303Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 9Ruddel A. Virology. 1995; 206: 1-7Crossref PubMed Scopus (57) Google Scholar, 10Skalnik D.G. Strauss E.C. Orkin S.H. J. Biol. Chem. 1991; 266: 16736-167744Abstract Full Text PDF PubMed Google Scholar, 11Spear D.H. Ericsson J. Jackson S.M. Edwards P.A. J. Biol. Chem. 1994; 269: 25212-25218Abstract Full Text PDF PubMed Google Scholar, 14Ronchi A. Bellorini M. Mongelli N. Mantovani R. Nucleic Acids Res. 1995; 23: 4565-4572Crossref PubMed Scopus (86) Google Scholar, 15Kim C.G. Sheffrey M. J. Biol. Chem. 1990; 265: 13362-13369Abstract Full Text PDF PubMed Google Scholar). The CCAAT consensus derived statistically by Bucher (1Bucher P. J. Mol. Biol. 1990; 212: 563-578Crossref PubMed Scopus (984) Google Scholar) (RRCCAAT(C/G)(A/G)) fits well with the optimal NF-Y-binding site. NF-Y is a ubiquitous heteromeric protein composed of three subunits, NF-YA, NF-YB, and NF-YC, all necessary for DNA binding (16Sinha S. Maity S.N. Lu J. de Crombrugghe B. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1624-1628Crossref PubMed Scopus (252) Google Scholar, 17Hahn S. Pinkham J. Weil R. Miller R. Guarente L. Mol. Cell. Biol. 1988; 8: 655-663Crossref PubMed Scopus (87) Google Scholar). The cloning of NF-Y genes from several species including yeast, maize, lamprey, and sea urchin, evidenced highly conserved domains (16Sinha S. Maity S.N. Lu J. de Crombrugghe B. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1624-1628Crossref PubMed Scopus (252) Google Scholar, 17Hahn S. Pinkham J. Weil R. Miller R. Guarente L. Mol. Cell. Biol. 1988; 8: 655-663Crossref PubMed Scopus (87) Google Scholar, 18Hooft van Huijsduijnen R. Li X.Y. Black D. Matthes H. Benoist C. Mathis D. EMBO J. 1990; 9: 3119-3127Crossref PubMed Scopus (211) Google Scholar, 19Li X.-Y. Mantovani R. Hooft van Huijsduijnen R. Andre I. Benoist C. Mathis D. Nucleic Acids Res. 1992; 20: 1087-1091Crossref PubMed Scopus (108) Google Scholar, 20McNabb D.S. Xing Y. Guarente L. Genes Dev. 1995; 9: 47-58Crossref PubMed Scopus (235) Google Scholar, 21Pinkham J.L. Olesen S. Guarente L. Mol. Cell. Biol. 1987; 7: 578-585Crossref PubMed Scopus (90) Google Scholar, 22Bellorini M. Zemzoumi K. Farina A. Berthelsen J. Piaggio G. Mantovani R. Gene (Amst.). 1997; 193: 119-125Crossref PubMed Scopus (0) Google Scholar). The NF-YA homology domain can be divided into subunit association and DNA-contacting subdomains (20McNabb D.S. Xing Y. Guarente L. Genes Dev. 1995; 9: 47-58Crossref PubMed Scopus (235) Google Scholar). The N-terminal contains a hydrophobic and Gln-rich activation surface (18Hooft van Huijsduijnen R. Li X.Y. Black D. Matthes H. Benoist C. Mathis D. EMBO J. 1990; 9: 3119-3127Crossref PubMed Scopus (211) Google Scholar). The NF-YC gene has been recently cloned and is specular with respect to NF-YA, since the homology domain is at the N terminus, whereas the C-terminal 180 amino acids are rich in glutamines and hydrophobic residues. NF-YB and NF-YC tightly interact with each other, and their association is a prerequisite for NF-YA binding and sequence-specific DNA interactions (16Sinha S. Maity S.N. Lu J. de Crombrugghe B. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 1624-1628Crossref PubMed Scopus (252) Google Scholar, 22Bellorini M. Zemzoumi K. Farina A. Berthelsen J. Piaggio G. Mantovani R. Gene (Amst.). 1997; 193: 119-125Crossref PubMed Scopus (0) Google Scholar). Both the NF-YB- and NF-YC-conserved domains contain putative histone fold motifs. This motif, common to all core histones, is responsible for the formation of the histone octamer (24Arents G. Moudrianakis E.N. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10489-10493Crossref PubMed Scopus (313) Google Scholar) and is composed of three α-helices, separated by short loops/strand regions, enabling histones to dimerize with companion subunits (24Arents G. Moudrianakis E.N. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10489-10493Crossref PubMed Scopus (313) Google Scholar, 25Arents G. Moudrianakis E.N. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11170-11174Crossref PubMed Scopus (292) Google Scholar). Recent experiments on the yeast HAP3 (26Xing Y. Fikes J.D. Guarente L. EMBO J. 1993; 12: 4647-4655Crossref PubMed Scopus (141) Google Scholar), NF-YB/CBF-A (27Sinha S. Kim I.-S. Sohn K.Y. deCrombrugghe B. Maity S.N. Mol. Cell. Biol. 1996; 16: 328-337Crossref PubMed Scopus (147) Google Scholar), and NF-YC/CBF-C (28Kim I.-S. Sinha S. deCrombrugghe B. Maity S.N. Mol. Cell. Biol. 1996; 16: 4003-4013Crossref PubMed Scopus (128) Google Scholar) indicate that this 65 amino acid long motif is necessary for subunit interactions and DNA binding. NF-Y has additional interesting features as follows: (i) CCAAT boxes are not able to activate alone even if multimerized, but they increase the activity of neighboring enhancer motifs. (ii) NF-Y appears to increase the affinity of transcription factors for their target sequence (29Reith W. Siegrist C.-A. Durand B. Barras E. Mach B. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 554-558Crossref PubMed Scopus (169) Google Scholar). However, the exact mechanisms of transcriptional activation by NF-Y are still elusive. Globin genes are transcribed in a tissue-specific and developmentally regulated manner by means of various regulatory elements in their clusters (30Grosveld F. Antoniou M. Berry M. deBoer E. Dillon N. Ellis J. Fraser P. Hurst A. Imam A. Meijer D. Philipsen S. Pruzina S. Stroubulis J. Whyatt D. Cold Spring Harbor Symp. Quant. Biol. 1993; 58: 7-13Crossref PubMed Scopus (29) Google Scholar). In addition to the locus control regions which have been characterized in transgenic mice, the promoters of each globin gene contain sequences that usually impart tissue-specific control in transfection experiments. Several lines of reasoning point to CCAAT sequences as important elements in globin gene expression as follows: (i) they are present in all globin promoters; (ii) they have been remarkably conserved in different species at a fixed distance from the cap site; (iii) genomic footprinting of all globin promoters in erythroid cells showed invariable protection of CCAAT sequencesin vivo, indicating binding of activators (31Reddy P.M. Stamatoyannopoulos G. Papayannopoulou T. James Shen C.-K. J. Biol. Chem. 1994; 269: 8287-8295Abstract Full Text PDF PubMed Google Scholar); (iv) the functional importance has been documented in the β-, α-, ζ-, and ε-globin promoters (2Cowie A. Myers R.M. Mol. Cell. Biol. 1988; 8: 3122-3128Crossref PubMed Scopus (50) Google Scholar, 3Delvoye N.L. Destroismaisons N.M. Wall L.A. Mol. Cell. Biol. 1993; 13: 6969-6983Crossref PubMed Google Scholar, 4Mason M.M. Grasso J.A. Gavrilova O. Reitman M. J. Biol. Chem. 1996; 271: 25459-25467Abstract Full Text Full Text PDF PubMed Scopus (7) Google Scholar, 5Pondel M.D. Sharpe J.A. Clark S. Pearson L. Wood W.G. Proudfoot N.J. Nucleic Acids Res. 1996; 24: 4158-4164Crossref PubMed Scopus (6) Google Scholar, 15Kim C.G. Sheffrey M. J. Biol. Chem. 1990; 265: 13362-13369Abstract Full Text PDF PubMed Google Scholar); (v) the γ-globin duplicated CCAAT boxes are the target of mutations affecting developmental silencing of γ-globin expression in adult life. In particular, strong genetic evidence suggests that point mutations in the CCAAT box region are causative of the HPFH syndromes, characterized by increased fetal globin levels in adults (32Mantovani R. Superti-Furga G. Gilman J. Ottolenghi S. Nucleic Acids Res. 1989; 17: 6681-6691Crossref PubMed Scopus (49) Google Scholar, 33Superti-Furga G. Barberis A. Schaffner G. Busslinger M. EMBO J. 1988; 7: 3099-3107Crossref PubMed Scopus (95) Google Scholar, 34Fucharoen S. Shimizu K. Fukumaki Y. Nucleic Acids Res. 1990; 18: 5245-5253Crossref PubMed Scopus (83) Google Scholar, 35Berry M. Grosveld F. Dillon N. Nature. 1992; 358: 499-502Crossref PubMed Scopus (113) Google Scholar, 36Ronchi A. Bottardi S. Mazzucchelli C. Ottolenghi S. Santoro C. J. Biol. Chem. 1995; 270: 21934-21941Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 37Ronchi A. Berry M. Raguz S. Imam A. Yannoutsos N. Ottolenghi S. Grosveld F. Dillon N. EMBO J. 1996; 15: 143-149Crossref PubMed Scopus (45) Google Scholar). Several studies investigated factors binding to CCAAT; CDP, NFE3, and c/EBP appear to recognize different globin promoters (3Delvoye N.L. Destroismaisons N.M. Wall L.A. Mol. Cell. Biol. 1993; 13: 6969-6983Crossref PubMed Google Scholar, 32Mantovani R. Superti-Furga G. Gilman J. Ottolenghi S. Nucleic Acids Res. 1989; 17: 6681-6691Crossref PubMed Scopus (49) Google Scholar, 33Superti-Furga G. Barberis A. Schaffner G. Busslinger M. EMBO J. 1988; 7: 3099-3107Crossref PubMed Scopus (95) Google Scholar, 34Fucharoen S. Shimizu K. Fukumaki Y. Nucleic Acids Res. 1990; 18: 5245-5253Crossref PubMed Scopus (83) Google Scholar, 35Berry M. Grosveld F. Dillon N. Nature. 1992; 358: 499-502Crossref PubMed Scopus (113) Google Scholar, 36Ronchi A. Bottardi S. Mazzucchelli C. Ottolenghi S. Santoro C. J. Biol. Chem. 1995; 270: 21934-21941Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). One CCAAT-binding protein, α-CP1, was purified to homogeneity using an α-globin CCAAT box affinity column and found to be a trimeric factor most likely identical to NF-Y (15Kim C.G. Sheffrey M. J. Biol. Chem. 1990; 265: 13362-13369Abstract Full Text PDF PubMed Google Scholar). Moreover, competition and supershift EMSA experiments performed with nuclear extracts determined that a CCAAT binding activity similar to NF-Y (termed CP1 in the globin field) binds to the γ-globin promoters (32Mantovani R. Superti-Furga G. Gilman J. Ottolenghi S. Nucleic Acids Res. 1989; 17: 6681-6691Crossref PubMed Scopus (49) Google Scholar, 33Superti-Furga G. Barberis A. Schaffner G. Busslinger M. EMBO J. 1988; 7: 3099-3107Crossref PubMed Scopus (95) Google Scholar). However, identification of CCAAT binding activities in other promoters is less certain; therefore, we wished to definitely determine which of the globin CCAAT boxes represents a bona fide NF-Y-binding site and establish a hierarchy of affinities. We then focused our attention on the highly regulated γ-globin duplicated CCAAT box region. Because of the histone-like nature of NF-Y and its ability to distort DNA, we examined the possibility that NF-Y organizes this region. The starting plasmid for the circular permutation assays was pBend2 (14Ronchi A. Bellorini M. Mongelli N. Mantovani R. Nucleic Acids Res. 1995; 23: 4565-4572Crossref PubMed Scopus (86) Google Scholar). The proximal and distal CCAAT box oligos described in Table I were inserted by blunt end ligation into the XbaI site. The double CCAAT and the phasing analysis oligos were also cloned into the XbaI site.Table IList of oligonucleotides used in this studyNameSequenceEαATTTTTCTGATTGGTTAAAAGTαGGCGGCGCTCATTGGCTGGCGCGGAGCCCCGζCCTCACCTGACCAATGGCCACAGCCTGGCTGGεACACAGGTCAGCCTTGACCAATGACTTTTAAGhγPGGCAAACTTGACCAATAGTCTTAGAhγDGCCTTGCCTTGACCAATAGCCTTGACAβACCCTAGGGTTGGCCAATCTACTCCCAGGgγPAAAGTGACCTTGACCAATAGCCTCAGAGCgγDATCCTTGCCTTGACCAATAGGCTTGACAANsGTCAGTTAGGGTGTGGAAAGTDouble CCAATGCCTTGCCTTGACCAATAGCCTTGACAAGGCAAACTTGACCAATAGTCTTAGAG−114GCCTTGCCTTGACTAATAGCCTTGACAAGGCAAACTTGACCAATAGTCTTAGAG−87GCCTTGCCTTGACCAATAGCCTTGACAAGGCAAACTTGACTAATAGTCTTAGAG−114/−87GCCTTGCCTTGACTAATAGCCTTGACAAGGCAAACTTGACTAATAGTCTTAGAG+3GCCTTGCCTTGACCAATAGCCTTGACACTGAGGCAAACTTGACCAATAGTCTTAGAGΔ3GCCTTGCCTTGACCAATAGCCTTGACGCAAACTTGACCAATAGTCTTAGAGΔ5GCCTTGCCTTGACCAATAGCCTTGACAAACTTGACCAATAGTCTTAGAGΔ8GCCTTGCCTTGACCAATAGCCTTGAACTTGACCAATAGTCTTAGAG Open table in a new tab Plasmids for in vitro transcription (pAG1 and mutants thereof) were obtained by inserting the γ-globin promoter (−299 to +35) into the PA101 vector (38Mantovani R. Methods Mol. Biol. 1994; 31: 289-298PubMed Google Scholar). The SV40 promoter was excised by cutting with HindIII and BamHI, filling in with Klenow, and religating. Mutants were derived by polymerase chain reaction before cloning into PA101; pAG2 contains mutations in the distal CCAAT 3′ region (−109 AGCC to GACT) that render it identical to the ε-globin CCAAT box. pAG3 has a mutation at position −86 of the proximal CCAAT (A to C). pAG4 contains a 13-bp deletion of the distal CCAAT (from −122 to −109). pAG5 harbors both the distal CCAAT-ε swap of pAG2 and the point mutation (− 86 A to C) of pAG3 in the proximal CCAAT. pAG6 contains a triple mutation (CCAAT to TCTAG) in both the distal and the proximal CCAAT boxes. All constructs were checked by sequencing. Labeled oligonucleotides (10,000 cpm) containing the different globin CCAAT boxes were incubated with K562 nuclear extracts (5 μg) for 30 min at 25 °C. Binding reactions for NF-Y were performed incubating labeled oligonucleotides for 20 min at 20 °C, in a buffer containing 5% glycerol, 50 mm NaCl, 20 mm Tris, pH 7.5, 0.5 mm EDTA, 5 mm MgCl2, and 1 mm dithiothreitol, and run in 4% polyacrylamide gels (acrylamide/bis-acrylamide ratio of 29:1) at 4 °C. Supershift experiments were performed as described in Ref. 12Mantovani R. Pessara U. Tronche F. Li X.Y. Knapp A.M. Pasquali J.L. Benoist C. Mathis D. EMBO J. 1992; 11: 3315-3322Crossref PubMed Scopus (165) Google Scholar. Competition experiments were performed following two different incubation procedures as described in Fig. 6: increasing concentrations (1, 3, 10, and 25 ng) of cold competitors were incubated either before addition of the labeled oligos (6000 cpm) or after 10 min of incubation of NF-Y with the probe. Recombinant NF-YA9 and purified NF-YB/C were prepared as in Refs. 22Bellorini M. Zemzoumi K. Farina A. Berthelsen J. Piaggio G. Mantovani R. Gene (Amst.). 1997; 193: 119-125Crossref PubMed Scopus (0) Google Scholarand 39Mantovani R. Li X.Y. Pessara U. Hooft van Huijsduijnen R. Benoist C. Mathis D. J. Biol. Chem. 1994; 269: 20340-20346Abstract Full Text PDF PubMed Google Scholar. For circular permutation assays, NF-Y was incubated with end-labeled fragments generated by cuts with different enzymes (2000 cpm in each reaction). Fragments generated by the centralXhoI digestions were used for the phasing analysis. Location of the points of flexure and amplitudes of the bending angles were described previously (14Ronchi A. Bellorini M. Mongelli N. Mantovani R. Nucleic Acids Res. 1995; 23: 4565-4572Crossref PubMed Scopus (86) Google Scholar, 40Kerrpola T. Curran T. Cell. 1991; 66: 316-327Google Scholar). Briefly, the mobilities of the NF-Y-DNA complexes were normalized to the mobilities of the corresponding free DNA fragments; bending angles were calculated considering the ratio between the fastest and the slowest migrating complexes in EMSA, according to the formula m M/m E = cosa/2, where m M is the relative mobility of the complex exactly in the middle, m E is the relative mobility of the complex at the end of the fragment, anda is the angle of deviation. To determine bending centers, the normalized mobility of each NF-Y-DNA complex was plotted as a function of the distance between the center of the CCAAT sequence and the end of the DNA fragment; the bend was determined as the position at which the NF-Y-DNA complex was at a minimum. In the phasing analysis, the mobility of the upper bands of the +3, Δ3, and Δ5 oligos was normalized for the mobility of the lower bands and plotted against that of the wt fragment. The best fitting equation and the R2 value were calculated by means of Microsoft Excel 7. Preparation of transcriptionally competent K562 nuclear extracts and in vitro transcription reactions were detailed in Ref. 38Mantovani R. Methods Mol. Biol. 1994; 31: 289-298PubMed Google Scholar. Two independent CsCl plasmid preparations of the pAG vectors were used in different sets of experiments. To determine which of the globin CCAAT boxes is recognized by NF-Y, we labeled oligonucleotides (see Table I) for EMSA experiments with nuclear extracts, challenging the resulting complexes with anti-NF-YB- and anti-NF-YA-purified antibodies (12Mantovani R. Pessara U. Tronche F. Li X.Y. Knapp A.M. Pasquali J.L. Benoist C. Mathis D. EMBO J. 1992; 11: 3315-3322Crossref PubMed Scopus (165) Google Scholar). Bands of different mobilities and intensities are generated with all oligos (Fig. 1), with the α (lanes 4–6), ζ (lanes 8–10), hγP (human γ proximal, lanes 16–18), gγP (prosimian Galago crassicaudatus γ proximal, see Ref. 36Ronchi A. Bottardi S. Mazzucchelli C. Ottolenghi S. Santoro C. J. Biol. Chem. 1995; 270: 21934-21941Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, lanes 28–30), hγD (human γ distal, lanes 20–22) and gγD (G. crassicaudatus γ distal, lanes 32–34), one predominant shifted band is visible; these complexes are supershifted by specific anti-YB and anti-YAc antibodies (12Mantovani R. Pessara U. Tronche F. Li X.Y. Knapp A.M. Pasquali J.L. Benoist C. Mathis D. EMBO J. 1992; 11: 3315-3322Crossref PubMed Scopus (165) Google Scholar). In each case we ran parallel migrations of the Y box oligo incubated with recombinant NF-YA and purified NF-YB/NF-YC; as shown in Fig. 1, the bands have electrophoretic behaviors identical to the endogenous K562 bands shifted by the anti-NF-Y antibodies. On the other hand, with the β and ε CCAAT multiple bands are visualized (lanes 12–14 and 24–26); for the ε a weak band comigrating with NF-Y and supershifted by the antibodies is observed, and for the β the four major bands detected have different mobilities compared with the Y/NF-Y band, and no supershift is evident. These data show that NF-Y binding is readily visualized on all globin CCAAT boxes and is the most prominent binding protein, with the exception of ε and β, which show a much higher affinity for proteins unrelated to NF-Y. To determine the relative affinity of NF-Y for each of the globin CCAAT boxes, we then incubated purified NF-YB/NF-YC and recombinant NF-YA with the different labeled oligos in the absence (Fig. 2, see lane 1) or in the presence of 20- and 100-fold excess of cold competing oligos containing the different CCAAT boxes examined above. Results are shown in lanes 2–19. Y box binding is efficiently competed only by ζ, whereas α and the γP, both from human andGalago, have a somewhat lower affinity (see quantification of the data in Fig. 2 B). All these CCAAT boxes clearly have a higher affinity in cross-competitions than ε and the very low affinity β. Note that the complex generated with the ε- and β-globin CCAAT boxes is visible only after prolonged exposures (3 and 7 days, respectively, in the experiment shown). In general, all data are consistent with the fact that the better binders in direct EMSA are also the most avid competitors. Cross-competition experiments establish that the relative affinity of NF-Y for the different CCAAT boxes varies profoundly by more than 2 orders of magnitude, ranging from very high (ζ and Y) to high (α, hγP, and gγP) to medium (gγD) to low (ε and β).Figure 2A, cross-competition analysis of globin CCAAT oligos. The indicated labeled oligos were incubated with purified NF-Y in the absence (lanes 1) or presence of a 20- (even numbers) or a 100-fold (uneven numbers) molar excess of the competing oligos (lanes 2–19). For the ε and β oligos, long exposures of 60 h and 7 days, respectively, were necessary to visualize the NF-Y bands. B, quantification of the data in A were obtained by densitometric scanning of the gels.View Large Image Figure ViewerDownload (PPT) We next focused our attention on the developmentally regulated γ-globin promoter. We fused the minimal tissue-specific γ-globin promoter (−299 to +35) to a rabbit β-globin reporter gene (plasmid pAG1) and generated mutants in the proximal or in the distal CCAAT boxes (see scheme in Fig. 3 A). The wt and mutated constructs were tested in a functional in vitro assay with transcriptionally competent erythroid K562 extracts. RNA was purified and hybridized to a single-stranded end-labeled DNA probe; subsequent S1 mapping allowed the determination of qualitative and quantitative changes in the transcription rate. As an internal control we added a plasmid containing the adenovirus major late promoter TATA box devoid of any activating sequences and fused to the same reporter gene. Fig. 3 B shows that our system efficiently transcribes the γ-globin promoter and faithfully reproduces the correct start site used in vivo. We tested the different mutants: alteration of the proximal CCAAT box or destruction of the distal by a 13-base pair deletion (pAG3 and pAG4) decreases transcription 3–4-fold (Fig. 3 C, lanes 3 and 4). Swapping the weak ε-globin CCAAT box into the distal CCAAT box position partially restores transcription when the proximal CCAAT is mutated, while having minor effects when the proximal CCAAT is intact (pAG2 and pAG5, respectively; Fig. 3 C, lanes 1, 2 and 5). A mutant promoter containing mutations in both CCAAT boxes (pAG6) was also compared with wt pAG1 and resulted in the lowest transcriptional rate (6-fold down, compare Fig. 3 C, lanes 6 and 7). Note that the signals in Fig. 3 C result from a 4-h exposure. These data indicate that both CCAAT elements contribute to the optimal promoter activity. However, other important activators are probably operating, since mutations in the CCAAT boxes do not abolish transcription completely. By having shown that both γ-globin CCAAT boxes bind NF-Y and are important for in vitro promoter activity, we investigated their interplay; we labeled a long oligo encompassing the two CCAAT boxes, incubating increasing concentrations of recombinant NF-Y, containing wt NF-YA and NF-YB and the homology domain of NF-YC. Fig. 4 shows that two bands of different electrophoretic mobility are generated (lanes 1–4); to ascertain whether the slow migrating complex corresponds to DNA fragments bound by two NF-Y molecules, we used fragments mutated in the distal CCAAT (C−114), in the proximal CCAAT (the corresponding C to T mutation at −87), or in both. We have deliberately chosen this mutation because genetic evidence strongly associates it with HPFH syndromes in humans (34Fucharoen S. Shimizu K. Fukumaki Y. Nucleic Acids Res. 1990; 18: 5245-5253Crossref PubMed Scopus (83) Google Scholar). Mutations in such position are known to essentially abolish NF-Y binding to all CCAAT boxes tested so far, including the γ-globin (13Dorn A. Bollekens J. Staub A. Benoist C. Mathis D. Cell. 1987; 50: 863-872Abstract Full Text PDF PubMed Scopus (476) Google Scholar, 14Ronchi A. Bellorini M. Mongelli N. Mantovani R. Nucleic Acids Res. 1995; 23: 4565-4572Crossref PubMed Scopus (86) Google Scholar, 15Kim C.G. Sheffrey M. J. Biol. Chem. 1990; 265: 13362-13369Abstract Full Text PDF PubMed Google Scholar,40Kerrpola T. Curran T. Cell. 1991; 66: 316-327Google Scholar). 2A. Ronchi, unpublished observations. The faster complex is only modestly affected by mutations in the distal CCAAT; the slower complex is greatly diminished in the −87 CCAAT mutant and in the double mutant (compare lanes 4, 12 and 16). Surprisingly, the −114 mutant exhibited a considerable level of the upper complex (compare lanes 4 and 8 and see the calculated ratios in Fig. 4 B). With the double mutant, both the slower and the faster complexes were also crippled (lanes 13–16). These data suggest that the faster band corresponds to NF-Y binding to either the proximal or the distal site, whereas the upper one results from double occupancy of the two CCAAT boxes. Interestingly, consistent with the cross-competition experiments, binding of NF-Y to the proximal CCAAT is predominant and compensates for a crippling mutation in the distal CCA