Evolutionary Conservation of a Coding Function for D4Z4, the Tandem DNA Repeat Mutated in Facioscapulohumeral Muscular Dystrophy
2007; Elsevier BV; Volume: 81; Issue: 2 Linguagem: Inglês
10.1086/519311
ISSN1537-6605
AutoresJannine Clapp, L. M. Mitchell, Daniel J. Bolland, Judy Fantes, Anne E. Corcoran, Paul J. Scotting, John A.L. Armour, Jane Hewitt,
Tópico(s)RNA modifications and cancer
ResumoFacioscapulohumeral muscular dystrophy (FSHD) is caused by deletions within the polymorphic DNA tandem array D4Z4. Each D4Z4 repeat unit has an open reading frame (ORF), termed "DUX4," containing two homeobox sequences. Because there has been no evidence of a transcript from the array, these deletions are thought to cause FSHD by a position effect on other genes. Here, we identify D4Z4 homologues in the genomes of rodents, Afrotheria (superorder of elephants and related species), and other species and show that the DUX4 ORF is conserved. Phylogenetic analysis suggests that primate and Afrotherian D4Z4 arrays are orthologous and originated from a retrotransposed copy of an intron-containing DUX gene, DUXC. Reverse-transcriptase polymerase chain reaction and RNA fluorescence and tissue in situ hybridization data indicate transcription of the mouse array. Together with the conservation of the DUX4 ORF for >100 million years, this strongly supports a coding function for D4Z4 and necessitates re-examination of current models of the FSHD disease mechanism. Facioscapulohumeral muscular dystrophy (FSHD) is caused by deletions within the polymorphic DNA tandem array D4Z4. Each D4Z4 repeat unit has an open reading frame (ORF), termed "DUX4," containing two homeobox sequences. Because there has been no evidence of a transcript from the array, these deletions are thought to cause FSHD by a position effect on other genes. Here, we identify D4Z4 homologues in the genomes of rodents, Afrotheria (superorder of elephants and related species), and other species and show that the DUX4 ORF is conserved. Phylogenetic analysis suggests that primate and Afrotherian D4Z4 arrays are orthologous and originated from a retrotransposed copy of an intron-containing DUX gene, DUXC. Reverse-transcriptase polymerase chain reaction and RNA fluorescence and tissue in situ hybridization data indicate transcription of the mouse array. Together with the conservation of the DUX4 ORF for >100 million years, this strongly supports a coding function for D4Z4 and necessitates re-examination of current models of the FSHD disease mechanism. Facioscapulohumeral muscular dystrophy (FSHD [MIM 158900]) is the third most common muscular dystrophy in whites, with an autosomal dominant pattern of inheritance and an incidence of ∼1 in 20,000.1Padberg GW Facioscapulohumeral muscular dystrophy.in: Upadhyaya M Cooper DN Facioscapulohumeral muscular dystrophy (FSHD): clinical medicine and molecular cell biology. BIOS Scientific Publishers, Oxford, United Kindgom2004: 41-54Google Scholar The disease is caused by a unique and enigmatic mechanism; almost all cases of FSHD are associated with contractions within a DNA tandem array (D4Z4) that is located in the subtelomeric region of chromosome 4q35.2Wijmenga C Hewitt JE Sandkuijl LA Clark LN Wright TJ Dauwerse HG Gruter A-M Hofker MH Moerer P Williamson R et al.Chromosome 4q DNA rearrangements associated with facioscapulohumeral muscular dystrophy.Nat Genet. 1992; 2: 26-30Crossref PubMed Scopus (546) Google Scholar, 3van Deutekom JCT Wijmenga C van Tienhoven EAE Gruter A-M Hewitt JE Padberg GW van Ommen G-JB Hofker MH Frants RR FSHD associated rearrangements are due to deletion of integral copies of a 3.2 kb tandemly repeated unit.Hum Mol Genet. 1993; 2: 2037-2042Crossref PubMed Scopus (443) Google Scholar The number of 3.3-kb repeat units within this array is highly polymorphic, varying between 11 and 100 in unaffected individuals. In patients with FSHD, one allele has ≤10 repeats.4Tawil R van der Maarel SM Facioscapulohumeral muscular dystrophy.Muscle Nerve. 2006; 34: 1-15Crossref PubMed Scopus (248) Google Scholar However, loss of a complete D4Z4 array on one allele does not result in the disease, suggesting that the repeats themselves play a role in FSHD. A similar tandem array is located on chromosome 10q26 and has 98% nucleotide identity to D4Z4.5Deidda G Cacurri S Grisanti P Vigneti E Piazzo N Felicetti L Physical mapping evidence for a duplicated region on chromosome 10qter showing high homology with the FSHD locus on chromosome 4qter.Eur J Hum Genet. 1995; 3: 155-167PubMed Google Scholar, 6van Geel M Dickson MC Beck AF Bolland DJ Frants RR van der Maarel SM de Jong PJ Hewitt JE Genomic analysis of human chromosome 10q and 4q telomeres suggests a common origin.Genomics. 2002; 79: 210-217Crossref PubMed Scopus (111) Google Scholar Although this chromosome 10q locus is also polymorphic, short arrays are not associated with FSHD.4Tawil R van der Maarel SM Facioscapulohumeral muscular dystrophy.Muscle Nerve. 2006; 34: 1-15Crossref PubMed Scopus (248) Google Scholar The 4q telomere has two variants, termed "4qA" and "4qB."6van Geel M Dickson MC Beck AF Bolland DJ Frants RR van der Maarel SM de Jong PJ Hewitt JE Genomic analysis of human chromosome 10q and 4q telomeres suggests a common origin.Genomics. 2002; 79: 210-217Crossref PubMed Scopus (111) Google Scholar However, D4Z4 deletions result in FSHD only when they occur on a 4qA chromosome.7Lemmers RJ de Kievit P Sandkuijl L Padberg GW van Ommen GJ Frants RR van der Maarel SM Facioscapulohumeral muscular dystrophy is uniquely associated with one of the two variants of the 4q subtelomere.Nat Genet. 2002; 32: 235-236Crossref PubMed Scopus (213) Google Scholar The underlying mechanism whereby these deletions cause FSHD is still unclear.4Tawil R van der Maarel SM Facioscapulohumeral muscular dystrophy.Muscle Nerve. 2006; 34: 1-15Crossref PubMed Scopus (248) Google Scholar D4Z4 repeats contain two dispersed repeat elements (LSau and hhspm3) that are characteristic of heterochromatic regions of the human genome.8Hewitt JE Lyle R Clark LN Valleley EM Wright TJ Wijmenga C van Deutekom JCT Francis F Sharpe PT Hofker M et al.Analysis of the tandem repeat locus D4Z4 associated with facioscapulohumeral muscular dystrophy.Hum Mol Genet. 1994; 3: 1287-1295Crossref PubMed Scopus (258) Google Scholar, 9Winokur ST Bengtsson U Feddersen J Mathews KD Weiffenbach B Bailey H Markovich RP Murray JC Wasmuth JJ Altherr MR et al.The DNA rearrangement associated with facioscapulohumeral muscular dystrophy involves a heterochromatin-associated repetitive element: implications for a role of chromatin structure in the pathogenesis of the disease.Chromosome Res. 1994; 2: 225-234Crossref PubMed Scopus (131) Google Scholar One widely held view is that D4Z4 has a noncoding, regulatory function and plays a role in the formation or maintenance of heterochromatin at the 4q telomere, repressing the expression of genes within chromosome 4q35. In this epigenetic model, contractions of the array below a threshold number of repeats alters the local chromatin organization, resulting in loss of repression of one or more nearby genes.4Tawil R van der Maarel SM Facioscapulohumeral muscular dystrophy.Muscle Nerve. 2006; 34: 1-15Crossref PubMed Scopus (248) Google Scholar Because the D4Z4 repeat unit contains a substantial ORF (DUX4) with the potential to encode a homeodomain protein,8Hewitt JE Lyle R Clark LN Valleley EM Wright TJ Wijmenga C van Deutekom JCT Francis F Sharpe PT Hofker M et al.Analysis of the tandem repeat locus D4Z4 associated with facioscapulohumeral muscular dystrophy.Hum Mol Genet. 1994; 3: 1287-1295Crossref PubMed Scopus (258) Google Scholar, 9Winokur ST Bengtsson U Feddersen J Mathews KD Weiffenbach B Bailey H Markovich RP Murray JC Wasmuth JJ Altherr MR et al.The DNA rearrangement associated with facioscapulohumeral muscular dystrophy involves a heterochromatin-associated repetitive element: implications for a role of chromatin structure in the pathogenesis of the disease.Chromosome Res. 1994; 2: 225-234Crossref PubMed Scopus (131) Google Scholar an alternative mechanism has been proposed in which the FSHD deletions perturb the expression of this putative homeobox gene.10Gabriels J Beckers M Ding H De Vriese A Plaisance S van der Maarel S Padberg GW Frants RR Hewitt JE Collen D et al.Nucleotide sequencing of the partially deleted D4Z4 locus in a patient with FSHD identifies a putative gene within each 3.3 kb element.Gene. 1999; 236: 25-32Crossref PubMed Scopus (270) Google Scholar However, no transcript from the array has been identified; consequently, D4Z4 is generally considered to represent an accumulation of pseudogenes and to have only a noncoding function. Although there is some experimental evidence to support the chromatin hypothesis for FSHD, it remains unproven. This region of 4q is not decorated by histone modifications that are characteristic of heterochromatin.11Yang F Shao CB Vedanarayanan V Ehrlich M Cytogenetic and immuno-FISH analysis of the 4q subtelomeric region, which is associated with facioscapulohumeral muscular dystrophy.Chromosoma. 2004; 112: 350-359Crossref PubMed Scopus (32) Google Scholar Although chromosome 4q35 is spatially associated with two heterochromatic domains within the nucleus, the nuclear envelope, and the nucleolar region, there is no difference in 4qter nuclear localization between FSHD cells and controls.12Masny PS Bengtsson U Chung SA Martin JH van Engelen B van der Maarel SM Winokur ST Localization of 4q35.2 to the nuclear periphery: is FSHD a nuclear envelope disease?.Hum Mol Genet. 2004; 13: 1857-1871Crossref PubMed Scopus (80) Google Scholar, 13Tam R Smith KP Lawrence JB The 4q subtelomere harboring the FSHD locus is specifically anchored with peripheral heterochromatin unlike most human telomeres.J Cell Biol. 2004; 167: 269-279Crossref PubMed Scopus (68) Google Scholar D4Z4 has a high GC content (71%) and is highly methylated.9Winokur ST Bengtsson U Feddersen J Mathews KD Weiffenbach B Bailey H Markovich RP Murray JC Wasmuth JJ Altherr MR et al.The DNA rearrangement associated with facioscapulohumeral muscular dystrophy involves a heterochromatin-associated repetitive element: implications for a role of chromatin structure in the pathogenesis of the disease.Chromosome Res. 1994; 2: 225-234Crossref PubMed Scopus (131) Google Scholar Partial hypomethylation of the D4Z4 array has been reported in patients with FSHD,14van Overveld PGM Lemmers RJ Sandkuijl LA Enthoven L Winokur ST Bakels F Padberg GW van Ommen GJ Frants RR van der Maarel SM Hypomethylation of D4Z4 in 4q-linked and non-4q-linked facioscapulohumeral muscular dystrophy.Nat Genet. 2003; 35: 315-317Crossref PubMed Scopus (301) Google Scholar, 15van Overveld PGM Enthoven L Ricci E Rossi M Felicetti L Jeanpierre M Winokur ST Frants RR Padberg GW van der Maarel SM Variable hypomethylation of D4Z4 in facioscapulohumeral muscular dystrophy.Ann Neurol. 2005; 58: 569-576Crossref PubMed Scopus (99) Google Scholar but patients with immunodeficiency, centromeric instability, and facial anomalies (ICF) syndrome (who have mutations in the DNA methyltransferase gene DNMT3B) show extensive hypomethylation of D4Z4 but no muscular dystrophy symptoms,16Kondo T Bobek MP Kuick R Lamb B Zhu X Narayan A Bourc'his D Viegas-Pequignot E Ehrlich M Hanash SM Whole-genome methylation scan in ICF syndrome: hypomethylation of non-satellite DNA repeats D4Z4 and NBL2.Hum Mol Genet. 2000; 9: 597-604Crossref PubMed Scopus (146) Google Scholar arguing against a causal role for the methylation status of the repeat in FSHD. Gabellini et al.17Gabellini D Green MR Tupler R Inappropriate gene activation in FSHD: a repressor complex binds a chromosomal repeat deleted in dystrophic muscle.Cell. 2002; 110: 339-348Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar identified a repressor protein complex bound to D4Z4 and postulated a cis-acting model in which loss of repeats from D4Z4 results in a decrease in the amount of repressor complex that is bound and a concomitant loss of transcriptional repression of chromosome 4q35 genes. RT-PCR data in that study showed increased expression of three chromosome 4q35 genes (FRG1, FRG2, and ANT1) in FSHD muscle samples.17Gabellini D Green MR Tupler R Inappropriate gene activation in FSHD: a repressor complex binds a chromosomal repeat deleted in dystrophic muscle.Cell. 2002; 110: 339-348Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar However, this gene-expression data has not been reproduced by other studies using microarray and quantitative and allelic RT-PCR approaches.18van Deutekom JCT Lemmers RJLF Grewal PK van Geel M Romberg S Dauwerse HG Wright TJ Padberg GW Hofker MH Hewitt JE et al.Identification of the first gene (FRG1) from the FSHD region on human chromosome 4q35.Hum Mol Genet. 1996; 5: 581-589Crossref PubMed Scopus (111) Google Scholar, 19Jiang GF Yang PG van Overveld PGM Vedanarayanan V van der Maarel SM Ehrlich M Testing the position-effect variegation hypothesis for facioscapulohumeral muscular dystrophy by analysis of histone modification and gene expression in subtelomeric 4q.Hum Mol Genet. 2003; 12: 2909-2921Crossref PubMed Scopus (126) Google Scholar, 20Winokur ST Chen YW Masny PS Martin JH Ehmsen JT Tapscott SJ van der Maarel SM Hayashi Y Flanigan KM Expression profiling of FSHD muscle supports a defect in specific stages of myogenic differentiation.Hum Mol Genet. 2003; 12: 2895-2907Crossref PubMed Scopus (172) Google Scholar, 21Osborne RJ Welle S Venance SL Thornton CA Tawil R Expression profile of FSHD supports a link between retinal vasculopathy and muscular dystrophy.Neurology. 2007; 68: 569-577Crossref PubMed Scopus (110) Google Scholar Although transgenic mice expressing very high levels of human FRG1 in skeletal muscle do develop a muscular-dystrophy phenotype,22Gabellini D D'Antona G Moggio M Prelle A Zecca C Adami R Angeletti B Ciscato P Pellegrino MA Bottinelli R et al.Facioscapulohumeral muscular dystrophy in mice overexpressing FRG1.Nature. 2006; 439: 973-977Crossref PubMed Scopus (177) Google Scholar the lack of robust data supporting up-regulation of this gene in patients means that the relationship between FRG1 and FSHD is unclear. Little is known about D4Z4 sequences in other organisms. In original comparative studies, D4Z4 homologues were identified only in higher primates, and the DNA sequences of these loci were not determined.23Clark LNC Koehler U Ward DC Wienberg J Hewitt JE Analysis of the organisation and localisation of the FSHD-associated tandem array in primates: implications for the origin and evolution of the 3.3 kb repeat family.Chromosoma. 1996; 105: 180-189Crossref PubMed Scopus (31) Google Scholar, 24Winokur ST Bengtsson U Vargas JC Wasmuth JJ Altherr MR The evolutionary distribution and structural organisation of the homeobox-containing repeat D4Z4 indicates a functional role for the ancestral copy in the FSHD region.Hum Mol Genet. 1996; 5: 1567-1577Crossref PubMed Google Scholar Physical-mapping data showed that genomes of great apes (chimpanzee, gorilla, and orangutan) all have D4Z4-related arrays at orthologous chromosomal locations.23Clark LNC Koehler U Ward DC Wienberg J Hewitt JE Analysis of the organisation and localisation of the FSHD-associated tandem array in primates: implications for the origin and evolution of the 3.3 kb repeat family.Chromosoma. 1996; 105: 180-189Crossref PubMed Scopus (31) Google Scholar, 24Winokur ST Bengtsson U Vargas JC Wasmuth JJ Altherr MR The evolutionary distribution and structural organisation of the homeobox-containing repeat D4Z4 indicates a functional role for the ancestral copy in the FSHD region.Hum Mol Genet. 1996; 5: 1567-1577Crossref PubMed Google Scholar In addition, these species also contain many related, dispersed 3.3-kb repeats; as in humans, these are found primarily at heterochromatic locations, such as on acrocentric chromosomes.23Clark LNC Koehler U Ward DC Wienberg J Hewitt JE Analysis of the organisation and localisation of the FSHD-associated tandem array in primates: implications for the origin and evolution of the 3.3 kb repeat family.Chromosoma. 1996; 105: 180-189Crossref PubMed Scopus (31) Google Scholar, 24Winokur ST Bengtsson U Vargas JC Wasmuth JJ Altherr MR The evolutionary distribution and structural organisation of the homeobox-containing repeat D4Z4 indicates a functional role for the ancestral copy in the FSHD region.Hum Mol Genet. 1996; 5: 1567-1577Crossref PubMed Google Scholar Old and New World monkeys also contain two D4Z4-like arrays, equivalent to the human 4qter and 10qter loci, but appear to lack significant numbers of the dispersed repeats.23Clark LNC Koehler U Ward DC Wienberg J Hewitt JE Analysis of the organisation and localisation of the FSHD-associated tandem array in primates: implications for the origin and evolution of the 3.3 kb repeat family.Chromosoma. 1996; 105: 180-189Crossref PubMed Scopus (31) Google Scholar, 24Winokur ST Bengtsson U Vargas JC Wasmuth JJ Altherr MR The evolutionary distribution and structural organisation of the homeobox-containing repeat D4Z4 indicates a functional role for the ancestral copy in the FSHD region.Hum Mol Genet. 1996; 5: 1567-1577Crossref PubMed Google Scholar Here, we have taken advantage of the extensive DNA sequence data from whole-genome projects to re-examine the extent of D4Z4 evolutionary conservation. We have identified D4Z4 homologues in several mammalian species, allowing us to infer the evolutionary history of this locus and to identify a protein-coding function for the repeat. To identify sequences with similarity to D4Z4, the human repeat sequence was used to search the National Center for Biotechnology Information Trace Archive by use of discontinuous megablast (BLAST). Trace files for each species were downloaded and then were assembled and manually edited using Sequencher (Genecodes). Reiterative rounds of searching were then used to identify all matching traces within the appropriate archive. Interspersed DNA repeat elements were identified using RepeatMasker. Species for which sequence data were assembled were chimpanzee (Pan troglodytes), orangutan (Pongo pygmaeus pygmaeus), rhesus macaque (Macaca mulatta), white tufted-ear marmoset (Callithrix jacchus), tree shrew (Tupaia belangeri), mouse (Mus musculus), rat (Rattus norvegicus), tenrec (Echinops telfairi), hyrax (Procavia capensis), and African elephant (Loxodonta africana). Apes have two D4Z4-related arrays, corresponding to the human 4q35 and 10q26 loci.21Osborne RJ Welle S Venance SL Thornton CA Tawil R Expression profile of FSHD supports a link between retinal vasculopathy and muscular dystrophy.Neurology. 2007; 68: 569-577Crossref PubMed Scopus (110) Google Scholar In our sequence assemblies, lack of linkage information meant that it was not possible to assign individual sequences to a specific paralogue; hence, the consensus sequences are presumably derived from a mixture of the two loci. A search of several Laurasiatherian (dog, cat, and cow) or nonmammalian (zebrafish and chicken) genome sequences failed to identify D4Z4 homologues in these species. Intron-containing DUX homologues were identified by blastx (BLAST) searches of genome assemblies in the Ensembl database. Because homeodomains are generally highly conserved, sequences were assigned as DUX genes only if they met at least one of the following criteria: conservation of synteny with the human genes, a putative mRNA encoding two DUX-like homeodomains, or exon organization matching known DUX genes. Assembled nucleotide sequences from primate D4Z4 repeats were aligned using ClustalW.25Thompson JD Higgins DG Gibson TJ CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.Nucleic Acids Res. 1994; 22: 4673-4680Crossref PubMed Scopus (55635) Google Scholar These alignments are shown in figures 1 and 2. Pairwise divergence between aligned ORF and non-ORF sequences from human, chimpanzee, and orangutan was assessed with a 2×2 χ2 test for heterogeneity. Neutrality of aligned ORF sequences from human, chimpanzee, orangutan, macaque, and marmoset was tested using the codeml option in PAML, version 3.15,26Yang Z PAML: a program package for phylogenetic analysis by maximum likelihood.Comp Appl Biosci. 1997; 13: 555-556PubMed Google Scholar by comparing the likelihoods of model 0 (single ω value) versus model 1 (nearly neutral: two ω values) and model 2 (positive selection: three ω values, allowing one to be >1).Figure 1ClustalW alignment of ape D4Z4 repeats. The DNA sequences are from EMBL database accession numbers AF117653 (human), BN000980 (chimpanzee [chimp]), and BN000981 (orangutan [orang]). The ORF is underlined.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 1ClustalW alignment of ape D4Z4 repeats. The DNA sequences are from EMBL database accession numbers AF117653 (human), BN000980 (chimpanzee [chimp]), and BN000981 (orangutan [orang]). The ORF is underlined.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 2ClustalW alignments of primate D4Z4 sequences. The DNA sequences are from EMBL database accession numbers AF117653 (human), BN000980 (chimpanzee [chimp]), BN000981 (orangutan [orang]), BN000983 (rhesus macaque), and BN000982 (marmoset). Numbering is done according to the location within the database sequences.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 2ClustalW alignments of primate D4Z4 sequences. The DNA sequences are from EMBL database accession numbers AF117653 (human), BN000980 (chimpanzee [chimp]), BN000981 (orangutan [orang]), BN000983 (rhesus macaque), and BN000982 (marmoset). Numbering is done according to the location within the database sequences.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 2ClustalW alignments of primate D4Z4 sequences. The DNA sequences are from EMBL database accession numbers AF117653 (human), BN000980 (chimpanzee [chimp]), BN000981 (orangutan [orang]), BN000983 (rhesus macaque), and BN000982 (marmoset). Numbering is done according to the location within the database sequences.View Large Image Figure ViewerDownload Hi-res image Download (PPT) For phylogenetic analysis, the DUX homeodomain amino acid sequences were aligned using ClustalX.27Jeanmougin F Thompson JD Gibson TJ Gouy M Higgins DG Multiple sequence alignment with ClustalX.Trends Biochem Sci. 1998; 23: 403-405Abstract Full Text Full Text PDF PubMed Scopus (2382) Google Scholar Phylogenetic trees were computed with the maximum-likelihood method by use of PROML in the PHYLIP package28Felsenstein J PHYLIP—phylogeny inference package, version 3.2.Cladistics. 1989; 5: 164-166Google Scholar (version 3.6), with the Jones-Taylor-Thornton model of amino acid substitution. Output trees were drawn using Phylodendron. To evaluate the confidence of the maximum-likelihood tree, PROML analysis (jumble = 10) was performed using a bootstrap set of 100 pseudoalignments generated by SEQBOOT, and the consensus tree was computed with CONSENSE. Bootstrap values for equivalent nodes were placed onto a representative maximum-likelihood tree in figure 3. Probe labeling, DNA hybridization, and antibody detection were performed as described elsewhere.29Chong SS Pack SD Roschke AV Tanigami A Carrozzo R Smith ACM Dobyns WB Ledbetter DH A revision of the lissencephaly and Miller-Dieker syndrome critical regions in chromosome 17p13.3.Hum Mol Genet. 1997; 6: 147-155Crossref PubMed Scopus (154) Google Scholar Chromosome preparations were made from C5BL/6J mouse spleens by use of standard methods. A cosmid (cosmid 6) and a plasmid insert (Dux_4) were mapped to metaphase spreads, by use of inverted 4′,6-diamidino-2-phenylindole (DAPI) staining, to obtain a G-banded pattern for chromosome identification. The localization was confirmed by dual hybridization with a biotin-labeled mouse chromosome 10–specific paint (Cambio). DNA preparation, digestion, electrophoresis, transfer, and hybridization were performed using standard protocols.30Sambrook J Fritsch EF Maniatis T Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar For Southern analysis, genomic DNA (10 μg) was digested with the restriction enzyme indicated. For pulsed-field gel electrophoresis (PFGE), high–molecular-weight DNA from C57BL/6J or CD1 mice embedded in agarose blocks was digested with EcoRV, and fragments were separated by electrophoresis by use of CHEF DRII (BioRad). DNase treatment was performed using TURBO DNA-free (Ambion), in accordance with the manufacturer's instructions, by use of 10 μg RNA and 2 U or 4 U DNase. A OneStep reaction (Qiagen) was performed in a total volume of 50 μl, containing 1 μg of DNase-treated RNA. After amplification, 15 μl of reaction mix was analyzed on a 2% agarose gel. For a "no reverse transcriptase" control, RNA was added to the reaction mix only after the heating to 95°C had inactivated the reverse-transcriptase enzyme. The exact annealing temperatures and extension times depended on the primers used and the size of the expected product. Primer sequences and reaction details are provided in table 1.Table 1Primers Used in the Mouse Dux RT-PCR AnalysisPrimer Sequence (5′→3′)Primer NameForwardReverseAnnealing Temperature (°C)Product Size (bp)Dux_2GCACTCAAGCAGACAGCACAGTGTCCATTTGCTCCCATGT57400Dux_5CAGCACATGCAGGAAGATGATCAGACCCCCTTCCTTGACT57720Dux_7ACTTCTAGCCCCAGCGACTCCCATGCTGCCAGGATTTCTA57212Dux_10GCCCACAGCTCAAGATCAAGATCAAGGAGGGGTTCCAGAG59210Dux_13CCAACCTTCTGCAGAGAATCCCACTTGGGAAGGCTTGGACT57309Dux_3GAATGGGGGTCTCAGATTGCTGCCTGTACTTCCTGCTTCTTC57489Dux_ATG1TTTAAGGGGCAGTGGTCACACCAGCTCCTTCCTCTCCTTG59310Dux_ATG2AGTCGATTCTCCCAAGGTGAGGAGCCTCTGATGGACCTCT57273Dux_TGA1AACTGCTGACCGAAGTCCAACATTTCGGGAAGTCACTGGA57278Dux_TGA2AACTGCTGACCGAAGTCCAACACAGCTCTGCATGAAGCAT57626 Open table in a new tab Appropriate PCR products were cloned into pGEM-T Easy (Promega), for probe generation. For mouse Dux, this was 2,078–3,179 bp of EMBL accession number AM398151 (Dux_6). For Gcc2, the probe corresponded to 993–2,593 bp of GenBank accession number NM_027375. Probe generation and RNA FISH of mouse splenocytes was performed as described elsewhere.31Bolland DJ Wood AL Johnston CM Bunting SF Morgan G Chakalova L Fraser PJ Corcoran AE Antisense intergenic transcription in V(D)J recombination.Nat Immunol. 2004; 5: 630-637Crossref PubMed Scopus (191) Google Scholar Images of the DAPI stain and the fluorescein isocyanate (FITC) and Texas Red signals of the same region were taken using a black and white camera and were saved as JPEG files before being opened in Adobe Photoshop, where color was added. For FITC (green), the color settings were hue 120, saturation 100, and light −50; for Texas Red (red), the color settings were hue 360, saturation 100, and light −50; and, for DAPI (blue), the color settings were hue 240, saturation 100, and light −50. The files were then layered on top of each other to produce a composite image. In situ hybridization was performed on frozen and wax sections as described by Rex and Scotting,32Rex M Scotting SJ In situ hybridisation to sections (non-radioactive).in: Sharpe PT Mason I Molecular embryology: methods and protocols. Humana Press, Totowa, NJ1999: 645-654Crossref Scopus (4) Google Scholar by use of the same mouse Dux probe (Dux_6) as in the RNA-FISH studies. Digoxigenin (DIG)–labeled probes were produced using a T7/Sp6 labeling kit (Roche). The full-length mouse Dux ORF (2,025 bp) was cloned in-frame into the pEGFPN1 vector (Clontech) to give the construct Dux-EGFP. An amino-terminal enhanced green flourescence protein (EGFP)–tagged construct (EGFP-Dux) was made by cloning the ORF in-frame into the pEGFPC3 vector (Clontech). Constructs were also made that encoded either the N-terminus and the double homeodomain region or just the C-terminus. For the N-terminus and homeodomain regions, 1–566 bp of the Dux ORF were cloned in-frame into either pEGFPN1, to give the construct DuxHD-EGFP, or into pEGFPC3, to give the construct EGFP-DuxHD. For the C-terminal region, 580–2,025 bp of the ORF were cloned in-frame into pEGFPC1, to give the construct EGFP-CtermDux. C2C12 myoblasts were grown and maintained in Dulbecco's modified Eagle medium supplemented with 10% fetal calf serum and were transfected using Effectene transfection reagent (Qiagen). To examine EGFP expression, cells were seeded onto glass coverslips. Forty-eight hours after transfection, cells expressing EGFP constructs were washed in PBS, were fixed with 4% paraformaldehyde in PBS, and were washed in PBS before being mounted in VectaShield mounting medium with DAPI. We used megablast (BLAST) to identify DUX4 homologous sequences in shotgun-trace databases for four primates: chimpanzee (P. troglodytes), orangutan (P. pygmaeus pygmaeus), rhesus macaque (M. mulatta), and white tufted-ear marmoset (C. jacchus). Although draft genome assemblies are available for several of these species, we chose to search the raw shotgun data directly because of the inherent problems in correctly assembling tandem arrays. For each species, the locations and orientation of mate pairs, the high density of clones, and the identification of nucleotide variants (none of whi
Referência(s)