Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

A Yeast Model of the Neurogenic Ataxia Retinitis Pigmentosa (NARP) T8993G Mutation in the Mitochondrial ATP Synthase-6 Gene

2007; Elsevier BV; Volume: 282; Issue: 47 Linguagem: Inglês

10.1074/jbc.m703053200

ISSN

1083-351X

Autores

Malgorzata Rak, Emmanuel Tétaud, Stéphane Duvezin‐Caubet, Nahia Ezkurdia, Maïlis Bietenhader, Joanna Rytka, Jean-Paul di Rago,

Tópico(s)

Photosynthetic Processes and Mechanisms

Resumo

NARP (neuropathy, ataxia, and retinitis pigmentosa) and MILS (maternally inherited Leigh syndrome) are mitochondrial disorders associated with point mutations of the mitochondrial DNA (mtDNA) in the gene encoding the Atp6p subunit of the ATP synthase. The most common and studied of these mutations is T8993G converting the highly conserved leucine 156 into arginine. We have introduced this mutation at the corresponding position (183) of yeast Saccharomyces cerevisiae mitochondrially encoded Atp6p. The “yeast NARP mutant” grew very slowly on respiratory substrates, possibly because mitochondrial ATP synthesis was only 10% of the wild type level. The mutated ATP synthase was found to be correctly assembled and present at nearly normal levels (80% of the wild type). Contrary to what has been reported for human NARP cells, the reverse functioning of the ATP synthase, i.e. ATP hydrolysis in the F1 coupled to F0-mediated proton translocation out of the mitochondrial matrix, was significantly compromised in the yeast NARP mutant. Interestingly, the oxygen consumption rate in the yeast NARP mutant was decreased by about 80% compared with the wild type, due to a selective lowering in cytochrome c oxidase (complex IV) content. This finding suggests a possible regulatory mechanism between ATP synthase activity and complex IV expression in yeast mitochondria. The availability of a yeast NARP model could ease the search for rescuing mechanisms against this mitochondrial disease. NARP (neuropathy, ataxia, and retinitis pigmentosa) and MILS (maternally inherited Leigh syndrome) are mitochondrial disorders associated with point mutations of the mitochondrial DNA (mtDNA) in the gene encoding the Atp6p subunit of the ATP synthase. The most common and studied of these mutations is T8993G converting the highly conserved leucine 156 into arginine. We have introduced this mutation at the corresponding position (183) of yeast Saccharomyces cerevisiae mitochondrially encoded Atp6p. The “yeast NARP mutant” grew very slowly on respiratory substrates, possibly because mitochondrial ATP synthesis was only 10% of the wild type level. The mutated ATP synthase was found to be correctly assembled and present at nearly normal levels (80% of the wild type). Contrary to what has been reported for human NARP cells, the reverse functioning of the ATP synthase, i.e. ATP hydrolysis in the F1 coupled to F0-mediated proton translocation out of the mitochondrial matrix, was significantly compromised in the yeast NARP mutant. Interestingly, the oxygen consumption rate in the yeast NARP mutant was decreased by about 80% compared with the wild type, due to a selective lowering in cytochrome c oxidase (complex IV) content. This finding suggests a possible regulatory mechanism between ATP synthase activity and complex IV expression in yeast mitochondria. The availability of a yeast NARP model could ease the search for rescuing mechanisms against this mitochondrial disease. Most of the cellular ATP requirements in human are produced by the mitochondrial F1F0-ATP synthase. This enzyme synthesizes ATP from ADP and inorganic phosphate by using the electrochemical proton gradient formed across the inner mitochondrial membrane in the course of electron transfer to oxygen by the respiratory chain (complexes I–IV). The ATP synthase harbors two major structural domains, a transmembrane component (F0) containing a proton-permeable pore and a peripheral, matrix-localized, catalytic component (F1) where the ATP is synthesized (1Boyer P.D. Annu. Rev. Biochem. 1997; 66: 717-749Crossref PubMed Scopus (1554) Google Scholar, 2Abrahams J.P. Leslie A.G. Lutter R. Walker J.E. Nature. 1994; 370: 621-628Crossref PubMed Scopus (2719) Google Scholar, 3Bianchet M.A. Hullihen J. Pedersen P.L. Amzel L.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 11065-11070Crossref PubMed Scopus (224) Google Scholar, 4Stock D. Leslie A.G. Walker J.E. Science. 1999; 286: 1700-1705Crossref PubMed Scopus (1073) Google Scholar). In the F0, the core of the proton channel consists in a ring of 10–12 Atp9p subunits and one Atp6p subunit (referred to as subunits c and a in Escherichia coli, respectively). Proton movements through this channel coincide with rotation of the Atp9p-ring (5Fillingame R.H. Nat. Struct. Biol. 2000; 7: 1002-1004Crossref PubMed Scopus (16) Google Scholar, 6Noji H. Yasuda R. Yoshida M. Kinosita Jr., K. Nature. 1997; 386: 299-302Crossref PubMed Scopus (1925) Google Scholar, 7Kato-Yamada Y. Noji H. Yasuda R. Kinosita Jr., K. Yoshida M. J. Biol. Chem. 1998; 273: 19375-19377Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar, 8Sambongi Y. Iko Y. Tanabe M. Omote H. Iwamoto-Kihara A. Ueda I. Yanagida T. Wada Y. Futai M. Science. 1999; 286: 1722-1724Crossref PubMed Scopus (411) Google Scholar, 9Panke O. Gumbiowski K. Junge W. Engelbrecht S. FEBS Lett. 2000; 472: 34-38Crossref PubMed Scopus (178) Google Scholar), which results in conformational changes favoring ATP synthesis in the F1 (1Boyer P.D. Annu. Rev. Biochem. 1997; 66: 717-749Crossref PubMed Scopus (1554) Google Scholar). The ATP synthase can function reversibly by hydrolyzing ATP coupled to proton extrusion out of the mitochondrial matrix. NARP 5The abbreviations used are: NARP, neuropathy, ataxia, and retinitis pigmentosa; MILS, maternally inherited Leigh syndrome; mtDNA, mitochondrial DNA; CCCP, carbonyl cyanide p-chlorophenylhydrazone; TMPD, N,N,N,N-tetramethyl-p-phenylenediamine; MOPS, 4-morpholinepropanesulfonic acid; BN, blue Native. 5The abbreviations used are: NARP, neuropathy, ataxia, and retinitis pigmentosa; MILS, maternally inherited Leigh syndrome; mtDNA, mitochondrial DNA; CCCP, carbonyl cyanide p-chlorophenylhydrazone; TMPD, N,N,N,N-tetramethyl-p-phenylenediamine; MOPS, 4-morpholinepropanesulfonic acid; BN, blue Native. (neuropathy, ataxia, and retinitis pigmentosa) and MILS (maternally inherited Leigh syndrome) are mitochondrial disorders associated with point mutations of the mitochondrial DNA (mtDNA) in the ATP6 gene encoding the Atp6p subunit of the ATP synthase (see Ref. 10Schon E.A. Santra S. Pallotti F. Girvin M.E. Semin. Cell Dev. Biol. 2001; 12: 441-448Crossref PubMed Scopus (98) Google Scholar for review). The most common and studied NARP/MILS mutation is T8993G converting a highly conserved leucine residue into arginine, at Atp6p amino acid position 156 (11Holt I.J. Harding A.E. Petty R.K. Morgan-Hughes J.A. Am. J. Hum. Genet. 1990; 46: 428-433PubMed Google Scholar). Wild type and mutated mtDNAs always co-exist in cells and tissues of the patients. Typically between 70 and 90% of mutated mtDNA result in the NARP syndrome, whereas the far more severe MILS syndrome usually occurs when the mutation load exceeds 90–95% (12Tatuch Y. Christodoulou J. Feigenbaum A. Clarke J.T. Wherret J. Smith C. Rudd N. Petrova-Benedict R. Robinson B.H. Am. J. Hum. Genet. 1992; 50: 852-858PubMed Google Scholar). Numerous studies with cells and transmitochondrial cell hybrids (cybrids) containing high levels of T8993G all showed important decreases in mitochondrial ATP synthesis rate, i.e. 50 to 90% (13Houstek J. Klement P. Hermanska J. Houstkova H. Hansikova H. Van den Bogert C. Zeman J. Biochim. Biophys. Acta. 1995; 1271: 349-357Crossref PubMed Scopus (94) Google Scholar, 14Manfredi G. Gupta N. Vazquez-Memije M.E. Sadlock J.E. Spinazzola A. De Vivo D.C. Schon E.A. J. Biol. Chem. 1999; 274: 9386-9391Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 15Tatuch Y. Robinson B.H. Biochem. Biophys. Res. Commun. 1993; 192: 124-128Crossref PubMed Scopus (117) Google Scholar, 16Trounce I. Neill S. Wallace D.C. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8334-8338Crossref PubMed Scopus (171) Google Scholar, 17Vazquez-Memije M.E. Shanske S. Santorelli F.M. Kranz-Eble P. Davidson E. DeVivo D.C. DiMauro S. J. Inherit. Metab. Dis. 1996; 19: 43-50Crossref PubMed Scopus (55) Google Scholar, 18Baracca A. Barogi S. Carelli V. Lenaz G. Solaini G. J. Biol. Chem. 2000; 275: 4177-4182Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 19Garcia J.J. Ogilvie I. Robinson B.H. Capaldi R.A. J. Biol. Chem. 2000; 275: 11075-11081Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 20Sgarbi G. Baracca A. Lenaz G. Valentino L.M. Carelli V. Solaini G. Biochem. J. 2006; 395: 493-500Crossref PubMed Scopus (90) Google Scholar). However, the precise impact of the leucine to arginine pathogenic change on the ATP synthase is still unknown. Some authors proposed that the underlying mechanism for the impaired ATP production would be a defect in the assembly/stability of the ATP synthase (13Houstek J. Klement P. Hermanska J. Houstkova H. Hansikova H. Van den Bogert C. Zeman J. Biochim. Biophys. Acta. 1995; 1271: 349-357Crossref PubMed Scopus (94) Google Scholar, 21Nijtmans L.G. Henderson N.S. Attardi G. Holt I.J. J. Biol. Chem. 2001; 276: 6755-6762Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 44Carrozzo R. Wittig I. Santorelli F.M. Bertini E. Hofmann S. Brandt U. Schagger H. Ann. Neurol. 2006; 59: 265-275Crossref PubMed Scopus (72) Google Scholar), whereas others concluded that the T8993G mutation essentially affects in some unknown way the functioning of the enzyme proton channel (10Schon E.A. Santra S. Pallotti F. Girvin M.E. Semin. Cell Dev. Biol. 2001; 12: 441-448Crossref PubMed Scopus (98) Google Scholar, 18Baracca A. Barogi S. Carelli V. Lenaz G. Solaini G. J. Biol. Chem. 2000; 275: 4177-4182Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 19Garcia J.J. Ogilvie I. Robinson B.H. Capaldi R.A. J. Biol. Chem. 2000; 275: 11075-11081Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 20Sgarbi G. Baracca A. Lenaz G. Valentino L.M. Carelli V. Solaini G. Biochem. J. 2006; 395: 493-500Crossref PubMed Scopus (90) Google Scholar, 45Cortes-Hernandez P. Vazquez-Memije M.E. Garcia J.J. J. Biol. Chem. 2007; 282: 1051-1058Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). The use of model organisms easily tractable to genetic manipulations may help to better understand ATP synthase alterations involved in human diseases. E. coli ATP synthase was found to be very sensitive to the leucine to arginine pathogenic change induced by T8993G (at position 207 of the homologous subunit a) as evidenced by a complete loss of both ATP synthesis and ATP-driven proton pumping activities (22Hartzog P.E. Cain B.D. J. Biol. Chem. 1993; 268: 12250-12252Abstract Full Text PDF PubMed Google Scholar). However, whereas the assembly of L156R-Atp6p in human cells containing high levels, up to 100%, of T8993G was found to be unaffected (19Garcia J.J. Ogilvie I. Robinson B.H. Capaldi R.A. J. Biol. Chem. 2000; 275: 11075-11081Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 45Cortes-Hernandez P. Vazquez-Memije M.E. Garcia J.J. J. Biol. Chem. 2007; 282: 1051-1058Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), the mutated L207R-subunit a failed to insert into the bacterial ATP synthase complex (23Carrozzo R. Murray J. Santorelli F.M. Capaldi R.A. FEBS Lett. 2000; 486: 297-299Crossref PubMed Scopus (27) Google Scholar). The more sophisticated structure of mitochondrial ATP synthase, with at least 10 subunits not present in the bacterial enzyme (24Velours J. Arselin G. J. Bioenerg. Biomembr. 2000; 32: 383-390Crossref PubMed Scopus (91) Google Scholar), together with important differences in subunit a and Atp6p structures (10Schon E.A. Santra S. Pallotti F. Girvin M.E. Semin. Cell Dev. Biol. 2001; 12: 441-448Crossref PubMed Scopus (98) Google Scholar), might be responsible for the different sensitivities of the bacterial and human ATP synthases to the leucine to arginine pathogenic change. The yeast Saccharomyces cerevisiae, a facultative aerobic eukaryote, obviously is a much better model than bacteria for the study of human mitochondrial disorders (46Onishi T. Kroger A. Heldt H.W. Pfaff E. Klingenberg M. Eur. J. Biochem. 1967; 1: 301-311Crossref PubMed Scopus (52) Google Scholar), especially those involving mutations of the ATP synthase, an enzyme that is highly similar in yeast and human (24Velours J. Arselin G. J. Bioenerg. Biomembr. 2000; 32: 383-390Crossref PubMed Scopus (91) Google Scholar). As in human, the yeast Atp6p gene lies within the mtDNA, and S. cerevisiae is one of the rare organisms tractable to site-directed mutagenesis of the mtDNA (25Bonnefoy N. Fox T.D. Methods Cell Biol. 2001; 65: 381-396Crossref PubMed Google Scholar). Due to its normal incapacity to stably propagate an heteroplasmic state, one can easily obtain yeast populations where all the mtDNA molecules bear a given mutation, thus creating excellent conditions to investigate the consequences of specific mtDNA alterations on mitochondrial structure and function. Yeast Strains and Media—The S. cerevisiae strains and their genotypes are listed in Table 1. The media used for growth of yeast were: YPGA (1% (w/v) yeast extract, 1% (w/v) peptone, 2% (w/v) glucose, and 40 mg liter–1 adenine); N3 (1% (w/v) yeast extract, 1% (w/v) peptone, 2% (w/v) glycerol, and 50 mm potassium phosphate buffer, pH 6.2); YPGALA (1% (w/v) yeast extract, 1% (w/v) peptone, 2% (w/v) galactose, and 40 mg liter–1 adenine); WO (0.17% (w/v) yeast nitrogen base without amino acids or ammonium sulfate, 0.5% (w/v) ammonium sulfate, 2% (w/v) glucose), and other supplements depending on the strain auxotrophic markers. Solid media contained 2% (w/v) agar.TABLE 1Genotypes and sources of yeast strainsStrainNuclear genotypemtDNASourceDFS160MATα leu2Δ ura3-52 ade2-101 arg8::URA3 kar1-1ρ°Ref. 28Steele D.F. Butler C.A. Fox T.D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5253-5257Crossref PubMed Scopus (150) Google ScholarNB40-3CMATa lys2 leu2-3,112 ura3-52 his3ΔHindIII arg8::hisGρ+cox2-62Ref. 28Steele D.F. Butler C.A. Fox T.D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5253-5257Crossref PubMed Scopus (150) Google ScholarMR6MATa ade2-1 his3-11,15 trp1-1 leu2-3,112 ura3-1 CAN1 arg8::HIS3ρ+ WTRef. 27Rak M. Tetaud E. Godard F. Sagot I. Salin B. Duvezin-Caubet S. Slonimski P.P. Rytka J. di Rago J.-P. J. Biol. Chem. 2007; 280: 10853-10864Abstract Full Text Full Text PDF Scopus (93) Google ScholarMR10MATa ade2-1 his3-11,15 trp1-1 leu2-3,112 ura3-1 CAN1 arg8::HIS3ρ+ atp6::ARG8mRef. 27Rak M. Tetaud E. Godard F. Sagot I. Salin B. Duvezin-Caubet S. Slonimski P.P. Rytka J. di Rago J.-P. J. Biol. Chem. 2007; 280: 10853-10864Abstract Full Text Full Text PDF Scopus (93) Google ScholarSDC30MATα leu2Δ ura3-52 ade2-101 arg8::URA3 kar1-1ρ− ATP6Ref. 27Rak M. Tetaud E. Godard F. Sagot I. Salin B. Duvezin-Caubet S. Slonimski P.P. Rytka J. di Rago J.-P. J. Biol. Chem. 2007; 280: 10853-10864Abstract Full Text Full Text PDF Scopus (93) Google ScholarSDC31MATα leu2Δ ura3-52 ade2-101 arg8::URA3 kar1-1ρ− atp6-L183RThis studyMR14MATa ade2-1 his3-11,15 trp1-1 leu2-3,112 ura3-1 CAN1 arg8::HIS3ρ+ atp6-L183RThis study Open table in a new tab Construction of ATP6-L183R Mutant Strain MR14—The ATP6 locus of wild type yeast mtDNA (from strain FY1679 entirely sequenced (26Foury F. Roganti T. Lecrenier N. Purnelle B. FEBS Lett. 1998; 440: 325-331Crossref PubMed Scopus (319) Google Scholar)), from nucleotide position –316 upstream of the ATP6 initiator codon to nucleotide position +275 downstream of the ATP6 stop codon, was PCR amplified as a BamHI-BamHI fragment (described in Ref. 27Rak M. Tetaud E. Godard F. Sagot I. Salin B. Duvezin-Caubet S. Slonimski P.P. Rytka J. di Rago J.-P. J. Biol. Chem. 2007; 280: 10853-10864Abstract Full Text Full Text PDF Scopus (93) Google Scholar). Its unique EcoRI site (internal to the ATP6 coding sequence) was cut and the two resulting BamHI-EcoRI fragments cloned separately into pUC19, to give pSDC8 and pSDC9. The pSDC8 plasmid contains the 5′ end of the ATP6 locus where the leucine TTA codon 183 (equivalent to the leucine 156 codon of human ATP6 gene) is located. Using the QuikChange XL Site-directed Mutagenesis Kit of Stratagene, the TTA codon 183 of the yeast ATP6 gene in pSDC8 was changed into the arginine AGA codon with primers 5′-CGCTAGAGCTATTTCAAGAGGTTTAAGATTAGGTTCTAATATCTTAGCTGG and 5′-CCAGCTAAGATATTAGAACCTAATCTTAAACCTCTTGAAATAGCTCTAGCG (the mutagenic bases are in bold), to give plasmid pSDC15. The SapI-EcoRI ATP6 fragment of pSDC15 was isolated and ligated with pJM2 cut with the same enzymes, to give pSDC17. The pJM2 plasmid contains the yeast mitochondrial COX2 gene as a marker for mitochondrial transformation (28Steele D.F. Butler C.A. Fox T.D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5253-5257Crossref PubMed Scopus (150) Google Scholar). The 3′ part of the wild type ATP6 locus in pSDC9 was liberated by a SapI + EcoRI digestion and cloned into the same sites of pSDC17, to give pSDC22, thus reconstructing a whole ATP6 gene containing the L183R mutation. The pSDC22 plasmid was introduced by co-transformation with the nuclear selectable LEU2 plasmid pFL46 into the ρ0 strain DFS160 by microprojectile bombardment using a biolistic PDS-1000/He particle delivery system (Bio-Rad) as described (25Bonnefoy N. Fox T.D. Methods Cell Biol. 2001; 65: 381-396Crossref PubMed Google Scholar). Mitochondrial transformants were identified among the Leu+ nuclear transformants by their ability to produce respiring clones when mated to the nonrespiring NB40-3C strain bearing a deletion in the mitochondrial COX2 gene (25Bonnefoy N. Fox T.D. Methods Cell Biol. 2001; 65: 381-396Crossref PubMed Google Scholar). One mitochondrial transformant (synthetic ρ– SDC31) was crossed to the atp6::ARG8m deletion strain MR10 (27Rak M. Tetaud E. Godard F. Sagot I. Salin B. Duvezin-Caubet S. Slonimski P.P. Rytka J. di Rago J.-P. J. Biol. Chem. 2007; 280: 10853-10864Abstract Full Text Full Text PDF Scopus (93) Google Scholar). The crosses SDC31 x MR10 produced cytoductants (called MR14) harboring the MR10 nucleus and where the ARG8m open reading frame had been replaced with the ATP6-L183R gene. The MR14 clones were identified by virtue of their inability to grow in the absence of an external source of arginine and complementation tests with a ρ-strain (SDC30 (27Rak M. Tetaud E. Godard F. Sagot I. Salin B. Duvezin-Caubet S. Slonimski P.P. Rytka J. di Rago J.-P. J. Biol. Chem. 2007; 280: 10853-10864Abstract Full Text Full Text PDF Scopus (93) Google Scholar)) containing the wild type yeast ATP6 gene alone. Sequencing of the mutated atp6 locus in MR14 revealed no other changes than L183R. Miscellaneous Procedures—Cells that were ρ+ in MR14 cultures were identified by virtue of their ability to form pink colonies in the presence of limiting amounts of adenine, whereas ρ–/ρ° cells gave white colonies. The pink color is due to an intermediate of the adenine biosynthetic pathway that accumulates in strains with an auxotrophic mutation in the ADE2 gene (49Reaume S.L. Tatum E.L. Arch. Biochem. 1949; 22: 331-338PubMed Google Scholar, 50Kim G. Sikder H. Singh K.K. Mutagenesis. 2002; 17: 375-381Crossref PubMed Scopus (19) Google Scholar). When respiration is totally abolished, this pigment is not oxidized and remains white. For mitochondrial enzyme assays and membrane potential analyses, mitochondria were prepared by the enzymatic method (29Guerin B. Labbe P. Somlo M. Methods Enzymol. 1979; 55: 149-159Crossref PubMed Scopus (189) Google Scholar), from MR6 and MR14 strains grown to middle exponential phase (3–4 × 107 cells ml–1) in YPGALA medium. Protein amounts were determined by the procedure of Ref. 30Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar in the presence of 5% SDS. Oxygen consumption rates were measured with a Clark electrode in the respiration buffer (0.65 m mannitol, 0.36 mm EGTA, 5 mm Tris phosphate, 10 mm Tris maleate, pH 6.8) as described previously (31Rigoulet M. Guerin B. FEBS Lett. 1979; 102: 18-22Crossref PubMed Scopus (64) Google Scholar). For ATP synthesis rate measurements, mitochondria (0.3 mg ml–1) were placed in a 2-ml thermostatically controlled chamber at 28 °C in respiration buffer. The reaction was started by the addition of 4 mm NADH and 1 mm ADP and stopped by 3.5% perchloric acid, 12.5 mm EDTA. Samples were then neutralized to pH 6.5 by addition of 2 n KOH, MOPS. 0.3 m ATP was quantified by luciferin/luciferase assay (ThermoLabsystems) on an LKB bioluminometer. Participation of the F1F0-ATP synthase in ATP production was assessed by oligomycin addition (20 μgmg–1 of protein). The specific ATPase activity was measured at pH 8.4 using a previously described procedure (32Somlo M. Eur. J. Biochem. 1968; 5: 276-284Crossref PubMed Scopus (68) Google Scholar). Variations in transmembrane potential (ΔΨ) were evaluated in the respiration buffer by measurement of rhodamine 123 fluorescence quenching with a SAFAS Monaco fluorescence spectrophotometer (33Emaus R.K. Grunwald R. Lemasters J.J. Biochim. Biophys. Acta. 1986; 850: 436-448Crossref PubMed Scopus (717) Google Scholar). Cytochrome spectral analysis was performed as in Ref. 47Venar R. Brèthes D. Giraud M.-F. Vaillier J. Velours J. Haraux F. Biochemistry. 2003; 42: 7626-7636Crossref PubMed Scopus (44) Google Scholar. SDS-PAGE was according to Laemmli (34Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (205531) Google Scholar). Western blot analyses were performed as described previously (35Arselin G. Vaillier J. Graves P.V. Velours J. J. Biol. Chem. 1996; 271: 20284-20290Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). Polyclonal antibodies raised against Atp6p, Atp7p, and OSCP (a gift from J. Velours) were used after dilution to 1:10,000. Polyclonal antibodies against yeast complex III cytochrome b subunit (a gift from T. Langer) were used after dilution to 1:2000. Monoclonal antibodies against Cox2p subunit of complex IV (from Molecular Probes) were used after dilution to 1:5000. Nitrocellulose membranes were incubated with peroxidase-labeled antibodies at a 1:10,000 dilution and revealed with the ECL reagent of Amersham Biosciences. Pulse labeling of mtDNA-encoded proteins and Northern blot analyses were performed as described in Ref. 27Rak M. Tetaud E. Godard F. Sagot I. Salin B. Duvezin-Caubet S. Slonimski P.P. Rytka J. di Rago J.-P. J. Biol. Chem. 2007; 280: 10853-10864Abstract Full Text Full Text PDF Scopus (93) Google Scholar. Converting Atp6p Leucine Residue 183 into Arginine Severely Compromises the Yeast Respiratory Growth—Leucine residue 156 of human Atp6p changed into arginine by the T8993G mutation corresponds to leucine residue 183 of yeast Atp6p. The TTA triplet encoding this residue was converted into the arginine AGA codon on a plasmid bearing the yeast wild type ATP6 gene. The resulting mutated plasmid (pSDC22) was introduced by biolistic transformation into the mitochondria of a yeast strain lacking mtDNA (ρ°). Crossings were then performed to fix the atp6-L183R mutation by mtDNA recombination into a complete (ρ+) mitochondrial genome, and give strain MR14. MR14 strain exhibited a very slow growth on media containing a non-fermentable carbon source (e.g. glycerol), both at 28 °C, the optimal temperature for growing yeast (Fig. 1), and at 36 °C (not shown), whereas the growth on glucose was normal (Fig. 1). The MR14 respiratory growth deficiency was rescued by crossing with a synthetic ρ– strain (SDC30) containing in its mitochondria the wild type ATP6 gene only (not shown), which proved that no other genetic alteration than atp6-L183R, in nuclear or mitochondrial DNA, was involved in the expression of MR14 respiratory growth-deficiency phenotype. The atp6-L183R Mutation Has a Minor Influence on Yeast mtDNA Stability—Quite often, in S. cerevisiae, mutations of the ATP synthase destabilize the mtDNA in the form of ρ–/ρ° petites issued from large deletions in the mtDNA (36Contamine V. Picard M. Microbiol. Mol. Biol. Rev. 2000; 64: 281-315Crossref PubMed Scopus (221) Google Scholar). It was thus important to determine whether the atp6-L183R mutation compromised the stability of the mtDNA. To this end, we scored the number of ρ–/ρ° cells produced by MR14 grown by fermentation with, as carbon source, either galactose, which does not elicit catabolite repression, or glucose. When grown on galactose, MR14 cultures contained only 5–10% of petites versus 2% for the corresponding wild type strain MR6, whereas <5 and <1% of petites accumulated in MR14 and MR6, respectively, when glucose was the carbon source. The poor growth of MR14 on non-fermentable substrates was thus not due to a defect in mtDNA maintenance. Influence of the atp6-L183R Mutation on the Yeast Mitochondrial Energy Transducing System—In the following sections we describe a number of experiments aiming to determine how the atp6-L183R mutation impacts the ATP synthase and respiration. All were performed using MR14 cells grown on galactose, i.e. in non-repressing conditions for a good mitochondrial expression, and at 28 °C, the optimal temperature for oxidative phosphorylation in yeast. The atp6-L183R Mutation Results in a Strong Lowering in Oxygen Consumption Due to a Poor Accumulation of Complex IV—Mitochondria isolated from MR14 exhibited a low respiratory activity. With NADH as an electron donor, the basal oxygen consumption rate (state 4) was 3 times lower compared with wild type (Table 2). In the presence of an excess of ADP (state 3), conditions in which the respiration rate normally increases to compensate for the use of the mitochondrial potential (ΔΨ) by the ATP synthase, to phosphorylate the added ADP, the oxygen consumption rate in MR14 was only very weakly stimulated, i.e. 1.1-fold versus 1.8 for the wild type. In the presence of the membrane potential uncoupler CCCP, where it is maximal, the oxygen consumption rate was still very low in MR14, indicating a strong decrease in respiratory enzyme content. However, the uncoupled respiration in MR14 was higher compared with state 3 by a factor of about 2, as in wild type mitochondria, which indicated that the atp6-L183R mutation did not increase the inner mitochondrial membrane passive permeability to protons.TABLE 2Influence of atp6-L183R mutation on yeast mitochondrial respiratory, ATP hydrolytic, and ATP synthesis activitiesStrainRespiration ratesATPase activityATP synthesis rateNADHNADH + ADPNADH + CCCPAsc/TMPD + CCCP-Oligo+Oligo-Oligo+Oligonmol O min−1 mg−1nmol Pi min−1 mg−1nmol Pi min−1 mg−1MR6364 ± 35647 ± 301231 ± 1451911 ± 2462439 ± 247375 ± 48911 ± 106174 ± 45MR14132 ± 15139 ± 13281 ± 24430 ± 182047 ± 92482 ± 9159 ± 6 90%) in the synthesis rate of the mitochondrially encoded Cox1p subunit of this complex (27Rak M. Tetaud E. Godard F. Sagot I. Salin B. Duvezin-Caubet

Referência(s)